ID: 1107510989

View in Genome Browser
Species Human (GRCh38)
Location 13:41084742-41084764
Sequence TGTTAACACTGGGTATATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 271}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107510978_1107510989 20 Left 1107510978 13:41084699-41084721 CCCCTCTCCATGACCACTATGGG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1107510989 13:41084742-41084764 TGTTAACACTGGGTATATATGGG 0: 1
1: 0
2: 0
3: 20
4: 271
1107510983_1107510989 13 Left 1107510983 13:41084706-41084728 CCATGACCACTATGGGGTTTTCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1107510989 13:41084742-41084764 TGTTAACACTGGGTATATATGGG 0: 1
1: 0
2: 0
3: 20
4: 271
1107510985_1107510989 -8 Left 1107510985 13:41084727-41084749 CCGTTTTTCTCAACATGTTAACA 0: 1
1: 0
2: 3
3: 31
4: 443
Right 1107510989 13:41084742-41084764 TGTTAACACTGGGTATATATGGG 0: 1
1: 0
2: 0
3: 20
4: 271
1107510982_1107510989 18 Left 1107510982 13:41084701-41084723 CCTCTCCATGACCACTATGGGGT 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1107510989 13:41084742-41084764 TGTTAACACTGGGTATATATGGG 0: 1
1: 0
2: 0
3: 20
4: 271
1107510980_1107510989 19 Left 1107510980 13:41084700-41084722 CCCTCTCCATGACCACTATGGGG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1107510989 13:41084742-41084764 TGTTAACACTGGGTATATATGGG 0: 1
1: 0
2: 0
3: 20
4: 271
1107510984_1107510989 7 Left 1107510984 13:41084712-41084734 CCACTATGGGGTTTTCCGTTTTT 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1107510989 13:41084742-41084764 TGTTAACACTGGGTATATATGGG 0: 1
1: 0
2: 0
3: 20
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107510989 Original CRISPR TGTTAACACTGGGTATATAT GGG Intergenic
901581461 1:10247507-10247529 TGTTTTCACTAGGTATCTATAGG + Intronic
901621449 1:10591578-10591600 TGGTAACACTGGTTATAGAGAGG - Intronic
905899177 1:41569477-41569499 TGTTACCTCTGTGTATTTATTGG - Intronic
907260891 1:53217801-53217823 TGTTAACACTGATGATATAAAGG + Intronic
908979264 1:69934637-69934659 TATTAATAATGGTTATATATAGG - Intronic
909388354 1:75087312-75087334 TGTTAAAACTGCCTATATGTGGG - Intergenic
909930279 1:81489802-81489824 TTTTAACACTTTGAATATATTGG - Intronic
911844660 1:102735922-102735944 TGTTAATACTGAGAATAAATAGG + Intergenic
912139920 1:106711840-106711862 TCTCACTACTGGGTATATATAGG + Intergenic
913175250 1:116267408-116267430 AGCTACCACTGGGTATATAAGGG - Intergenic
913239296 1:116815372-116815394 TGTTAACACTGGCTATCTCTGGG - Intergenic
913708769 1:121457002-121457024 TGTGAAAACTGGGTAGGTATGGG + Intergenic
916901285 1:169226793-169226815 TGTTAACAGTGGTTATCTTTAGG - Intronic
920793251 1:209112971-209112993 TTTCAACACTGGTCATATATGGG - Intergenic
921504011 1:215943948-215943970 TGTTAACATTGGTTATTTATGGG + Intronic
921698420 1:218239028-218239050 TGTTAACAATGGCTATGAATGGG + Intergenic
923065860 1:230516831-230516853 TGTTAATACTGGTTATCTCTAGG + Intergenic
1062795258 10:340514-340536 TGCTAATAGTGGGTATTTATTGG + Intronic
1063967952 10:11361631-11361653 TGTTAACAATGGTTATTTCTGGG + Intergenic
1067540923 10:47152211-47152233 TGTTAACAGGGGGTTTATTTTGG + Intergenic
1068339219 10:55679200-55679222 TGTTAACATTTAGTGTATATTGG - Intergenic
1069436183 10:68385725-68385747 TGATTACACTAGGTAAATATAGG + Intronic
1069931422 10:71884560-71884582 TATTAACACTGGTTATCTCTGGG - Intergenic
1071319085 10:84434554-84434576 TTTTAACAGTTGGTAAATATAGG + Intronic
1073029021 10:100509789-100509811 AGTTAACATTGGGGTTATATAGG + Intronic
1075211216 10:120492851-120492873 TGTTAACAATTGCTATATCTAGG - Intronic
1075311513 10:121417959-121417981 TGTTAATAATGTGTATATCTGGG - Intergenic
1076220690 10:128730955-128730977 TGATAATATTTGGTATATATTGG - Intergenic
1079764605 11:24375713-24375735 TTTTAGCACAGGGTATACATGGG + Intergenic
1080340436 11:31257162-31257184 TGTTAATACTGGGCCTAGATAGG + Intronic
1080604034 11:33849427-33849449 TTTTAACACTTGGTTTACATTGG + Intergenic
1081635132 11:44716051-44716073 GGTAAACACTGGGCATATAGTGG - Intergenic
1082271405 11:50173180-50173202 TGTTAACAATGGCTATACTTGGG - Intergenic
1083369633 11:62167835-62167857 AGTTAACACTGGTTGTATATGGG + Intergenic
1086455163 11:86954010-86954032 TGTTAACATTGGTTATGTTTGGG - Intronic
1086872208 11:92051690-92051712 TATTAACAGTGAGTATATTTTGG - Intergenic
1088334862 11:108692666-108692688 TGTTAAAGCTGGGTATATGAGGG - Intronic
1089395079 11:118131437-118131459 TCTTAACACTGTTTCTATATTGG + Intergenic
1090163855 11:124524744-124524766 TCTTAACAGTGGTTATTTATGGG - Intergenic
1090284968 11:125492059-125492081 TGGTAACACTTTGGATATATTGG - Intronic
1090298391 11:125610937-125610959 TGTTAACAGTGGCTAGAGATGGG - Intronic
1090717122 11:129440533-129440555 TGTTGGCACTGGGAATTTATTGG + Intronic
1090873433 11:130768039-130768061 GGTTAACACTGAGTATTCATGGG + Intergenic
1093923444 12:24885809-24885831 TGGGAAAACTGGGTATACATAGG + Intronic
1096201944 12:49690512-49690534 TGATATCACTAGGTATATAGTGG - Intronic
1097652594 12:62319791-62319813 TGTCAACAGTGGTTATATCTAGG + Intronic
1098309659 12:69135630-69135652 TGTTAACAATGGTTATCTCTAGG - Intergenic
1099242344 12:80153087-80153109 GGTTAATACAGGGAATATATGGG - Intergenic
1099325579 12:81210587-81210609 TTCTAATTCTGGGTATATATTGG - Intronic
1099448664 12:82782212-82782234 TGTGAACACTGGGTAAAGATAGG + Intronic
1100070742 12:90713696-90713718 TGTCAACTCTTGCTATATATTGG - Intergenic
1100640692 12:96479754-96479776 TGTTAACAGTGGTTACATTTTGG - Intergenic
1101099958 12:101381678-101381700 TGTCAACACTGGGTCTGTATTGG + Intronic
1101552106 12:105772750-105772772 TGTGATCACTGGGGATCTATTGG + Intergenic
1103206981 12:119137536-119137558 TGTGAACACTGAGTATATTAAGG + Intronic
1104280629 12:127373327-127373349 GGTTAACTCTGGATATATTTTGG + Intergenic
1106126347 13:26902935-26902957 TCTTTACACTGGGTGTTTATAGG - Intergenic
1107510989 13:41084742-41084764 TGTTAACACTGGGTATATATGGG + Intergenic
1108135083 13:47348038-47348060 TGTTAACACTGGCTATCTTTGGG - Intergenic
1111024075 13:82495815-82495837 TGTTAATATTGTGTATATCTTGG + Intergenic
1111820733 13:93211397-93211419 TGGTAACACTGGATATCTACAGG + Intergenic
1115872349 14:37819025-37819047 TGTAATCACTGGGTATATACAGG + Intronic
1202844847 14_GL000009v2_random:159472-159494 TGTTAACAATGGGGAGAAATTGG + Intergenic
1202914248 14_GL000194v1_random:149714-149736 TGTTAACAATGGGGAGAAATTGG + Intergenic
1124464248 15:29921766-29921788 TGTTGAGAATGGGTATATGTGGG - Intronic
1125262505 15:37843616-37843638 TGTTAATTCTGTGTATATGTAGG - Intergenic
1127377738 15:58400548-58400570 TGCTAACACTTGTTATATTTTGG + Intronic
1127754603 15:62079200-62079222 TGTTAACTCTGGGAAAATAGTGG - Intergenic
1129094409 15:73188282-73188304 TGTTAACACTGGTTATCTTTGGG - Intronic
1130661662 15:85835667-85835689 AGTTAGCACTGGATTTATATAGG + Intergenic
1132121808 15:99182698-99182720 TGTCAACACTGGCTATTTCTGGG + Intronic
1134768654 16:16784803-16784825 TGTCAACACTGGTCATACATCGG + Intergenic
1134817426 16:17217394-17217416 TGTTAACAATGGTGATATTTTGG - Intronic
1135121690 16:19771641-19771663 TGTCAACAATGGTTATATCTGGG - Intronic
1136845979 16:33576247-33576269 TGTTAACTGTGGGTTTTTATAGG + Intergenic
1140273712 16:73488782-73488804 CGTAACAACTGGGTATATATTGG - Intergenic
1203107687 16_KI270728v1_random:1424901-1424923 TGTTAACTGTGGGTTTTTATAGG + Intergenic
1143931546 17:10433876-10433898 TATTCTCACTGTGTATATATCGG + Intergenic
1143956267 17:10671933-10671955 TGTAAACACTGCTTATATATCGG + Intergenic
1144075041 17:11710057-11710079 TATTAACAATGGCTATCTATGGG - Intronic
1144497721 17:15759042-15759064 TGTTAACAATGGGTGAATGTAGG + Intergenic
1144629519 17:16863529-16863551 TGTTAACAATGGGTGAATGTAGG + Intergenic
1144651910 17:17012588-17012610 TGTTAACAATGGGTGAATGTAGG - Intergenic
1144939048 17:18924348-18924370 TGTTAATTCTGGGCATATAAAGG + Intronic
1145161090 17:20574092-20574114 TGTTAACAATGGGTGAATGTAGG + Intergenic
1146781057 17:35672864-35672886 AGTTAACAGTGGCTATACATGGG - Intronic
1148510435 17:48164506-48164528 ATTTGACATTGGGTATATATGGG + Intronic
1149406874 17:56361321-56361343 TGATAACAATGGATATATTTTGG - Intronic
1149457315 17:56798382-56798404 TGTGAAGACAGGGGATATATGGG - Intronic
1154064926 18:11098309-11098331 TGTTAATAATGGTTATATCTAGG + Intronic
1155580346 18:27298081-27298103 TATTATCACTGGGAATTTATAGG + Intergenic
1157198667 18:45640743-45640765 TGTGAACAGTGGGTACATCTGGG - Intronic
1157381622 18:47223736-47223758 TGTTAACATTGGTTATCTCTAGG + Intronic
1158323651 18:56291460-56291482 TCTTAACACTGTGTCAATATTGG + Intergenic
1158837203 18:61343507-61343529 TGGAAACACTGGGTATCTAAAGG - Intronic
1159773545 18:72577219-72577241 TGTTAACAATGGTTATCTGTAGG + Intronic
1164797799 19:31048526-31048548 TGTTAATAGTGGGTATCTCTGGG - Intergenic
928571956 2:32618256-32618278 TGTTAACAAAGAATATATATTGG + Exonic
929047890 2:37808171-37808193 TGATAAGACTGGGTATTTAATGG - Intergenic
929137500 2:38638595-38638617 TTTAAACTCTGAGTATATATTGG - Intergenic
929700735 2:44160660-44160682 TGATAAAACTGGCTAGATATGGG + Intergenic
931434298 2:62233689-62233711 TGTTAACATTGGGAATACGTGGG - Intergenic
933471228 2:82727767-82727789 TCTTAAAACTGATTATATATTGG + Intergenic
933790234 2:85878303-85878325 TGTTAACAGTGGGTATCACTGGG - Intronic
936860836 2:117018351-117018373 TATTTACCCAGGGTATATATGGG - Intergenic
937165426 2:119810767-119810789 TGTTAACACTGGGTCAATTTAGG - Intronic
937165555 2:119812584-119812606 TGTTATCACTGGGTTTGTGTTGG + Intronic
939501520 2:142991510-142991532 TATTAACACTGGCTAAATACAGG - Intronic
939978129 2:148744616-148744638 TGCTAACAGTGGTTATATTTGGG + Intronic
942178880 2:173360792-173360814 TGTTAAAACTGAGTCTTTATGGG + Intronic
943207032 2:184913230-184913252 TGTTTACATTGTGTATACATTGG + Intronic
944128726 2:196322245-196322267 TATTAACAGTGGGTACATCTTGG + Intronic
944472994 2:200075215-200075237 TGTTAACAGTGGCTATATCTGGG + Intergenic
944726359 2:202474988-202475010 TATTAACAATGGTTGTATATGGG - Intronic
945770216 2:214033654-214033676 TGTTAACACTTGGGAAATCTGGG - Intronic
946672457 2:222120389-222120411 TGTTAATAATGGGTAAATCTGGG + Intergenic
1169614606 20:7426484-7426506 TCATAACACTGGGTAAATAATGG - Intergenic
1169685466 20:8266736-8266758 TGTTAAGAATGGGTACATCTGGG + Intronic
1170109750 20:12792100-12792122 TGATAACATTTGGAATATATTGG - Intergenic
1172514798 20:35525840-35525862 AGTTAAAAGTGGGTATAAATAGG - Intronic
1173197189 20:40925359-40925381 TGTTACCACTGGGGGAATATGGG + Intergenic
1176043293 20:63079469-63079491 TTTTAGCACTTGGAATATATTGG + Intergenic
1176633603 21:9164389-9164411 TGTTAACAATGGGGAGAAATTGG + Intergenic
1176639729 21:9290425-9290447 TGTTAACAATGGGGAGAAATTGG - Intergenic
1177023638 21:15894602-15894624 TGTCACCAGTGTGTATATATTGG + Intergenic
1178005188 21:28210984-28211006 TCTTTAAACTGGGTATAAATTGG + Intergenic
1178209493 21:30512951-30512973 TGTTAACACTTTTTATTTATTGG - Intergenic
1178253777 21:31031637-31031659 TGATAACCCTAGGAATATATGGG + Intergenic
1180029142 21:45191067-45191089 TGTTAACTCAGGGTCTCTATGGG + Intronic
1180348740 22:11779805-11779827 TGTTAACAATGGGGAGAAATTGG - Intergenic
1180373026 22:12063260-12063282 TGTTAACAATGGGGAGAAATTGG - Intergenic
1180416483 22:12722079-12722101 TGTTAACAATGGGGAGAAATTGG - Intergenic
1180423775 22:12897893-12897915 TGTTAACAATGGGGAGAAATTGG - Intergenic
1180567594 22:16687960-16687982 TGTTAACACTTGGTATTTCCTGG - Intergenic
1182798257 22:33007332-33007354 TGTTAACAGTGATTATATTTTGG + Intronic
1183236159 22:36619500-36619522 AGTCAACACTTGGTACATATTGG - Intronic
949335671 3:2972378-2972400 TGTCTACATTGGGTAAATATCGG - Intronic
949751851 3:7361084-7361106 TGTTAACACTGGTTAGACAATGG - Intronic
950397226 3:12742755-12742777 GGTTAATAGTGGGTATATACTGG + Intronic
951463714 3:22978734-22978756 TGTGAACACTTGTTGTATATGGG - Intergenic
951944665 3:28121882-28121904 TGTTAACAATGGGTAAATCTAGG - Intergenic
952451398 3:33437178-33437200 TGGTAATATTGGGAATATATTGG - Intronic
952852109 3:37737831-37737853 TGTTAACACTGGGTGAATCTGGG - Intronic
953737348 3:45507777-45507799 TGTTAACACTAGCTATCTCTGGG + Intronic
956776387 3:72568779-72568801 TGTTAACAGTGGTTATCTTTGGG - Intergenic
956923878 3:73961167-73961189 TGTTAGCACTGCGTCTGTATTGG - Intergenic
957100475 3:75820385-75820407 TGTTAACAATGGGGAGAAATTGG + Intergenic
957356069 3:79088440-79088462 TGTTAAGACTTTGTATATTTTGG - Intronic
957370522 3:79288719-79288741 TGTTAACAATAGCAATATATAGG - Intronic
959109404 3:102103995-102104017 TATTTGCACTTGGTATATATTGG - Intronic
959937227 3:112041618-112041640 TGATAAAGCAGGGTATATATGGG + Intronic
960348178 3:116560659-116560681 TGTTAAGATTGGTTATATCTGGG + Intronic
960596530 3:119412612-119412634 TGTTAACAGTGGTTATCTGTGGG + Intronic
961527365 3:127514005-127514027 TGTTAACAATGGTTATCTCTGGG - Intergenic
961582958 3:127898230-127898252 TGTTAACAATGGTTATCTCTGGG + Intergenic
964039030 3:152236567-152236589 TGATAACATTGTTTATATATTGG + Intergenic
964465733 3:156989725-156989747 TGTTAACACTAGGTGAAAATGGG - Intronic
966047355 3:175568672-175568694 TTTTGAGACTGGGTCTATATAGG - Intronic
966058381 3:175725568-175725590 TGTTCACATTTGGTAAATATTGG + Intronic
966110202 3:176391792-176391814 TGCTAGCACTGGGCATATAGTGG - Intergenic
966423710 3:179758898-179758920 TGTCAACAGTGGTTATAGATGGG - Intronic
966736534 3:183191239-183191261 TGTGAGCACAGGGGATATATGGG - Intronic
967175155 3:186855913-186855935 AGTTAATTCTGGGTAGATATGGG - Exonic
967571304 3:191031795-191031817 ACTAAACACTGGGTATATAATGG + Intergenic
1202747165 3_GL000221v1_random:114603-114625 TGTTAACAATGGGGAGAAATTGG + Intergenic
970039232 4:11777289-11777311 TATTAATAATGGGTATATTTTGG - Intergenic
971314630 4:25557267-25557289 TGTTAACAGTTGGTAAATTTAGG - Intergenic
973827245 4:54720624-54720646 TGTTAACAATGGTTATCTCTGGG - Intronic
973919986 4:55674803-55674825 TGTTTAAAATGAGTATATATGGG - Intergenic
973985126 4:56343851-56343873 TGTTAACACTGGTTGTCTCTGGG - Intronic
975488793 4:74966013-74966035 TGTTAACAATGGGAATAAGTGGG + Intronic
976716595 4:88129222-88129244 TATTAACCTTAGGTATATATGGG - Intronic
977141750 4:93382049-93382071 TCTTAGCACTTTGTATATATTGG + Intronic
978094056 4:104753377-104753399 TATGAACACTGCATATATATGGG - Intergenic
978331360 4:107616176-107616198 TGTTAACAGTGGTTATTTCTAGG + Intronic
978605913 4:110479086-110479108 TGTTAACAATGGCTATACTTGGG - Intronic
979318020 4:119289518-119289540 TCTTAAGACTTGGTACATATTGG + Intronic
980085885 4:128389396-128389418 TGTTAATAATGGCTATATCTGGG - Intergenic
981241504 4:142481846-142481868 TATTAACACTAGGTACATTTCGG - Intronic
981294637 4:143117529-143117551 TATTCATACTGGGTATATATAGG - Intergenic
981448698 4:144870696-144870718 TGTTAATACTGTGAATATTTTGG - Intergenic
983747656 4:171221640-171221662 TGTGACCACTGAGTATTTATTGG + Intergenic
1202754617 4_GL000008v2_random:48819-48841 TGTTAACAATGGGGAGAAATTGG - Intergenic
986929128 5:12795796-12795818 TATTAACAATGGGTAAACATTGG + Intergenic
988936581 5:36089570-36089592 ACTGAACACTGGGTATAAATTGG - Intergenic
989407985 5:41083141-41083163 TCTTCATACTGGGTTTATATGGG - Intergenic
989969327 5:50503533-50503555 TGTGAAAACTGGGTAGGTATGGG - Intergenic
991612202 5:68461193-68461215 TGTTAACAGTGGTAATCTATGGG - Intergenic
992062283 5:73065394-73065416 TGTTAACAGTGGTTATCTTTGGG - Intronic
992505210 5:77380676-77380698 TGTTAGCACTGGGTATACAAAGG + Intronic
995608455 5:113883675-113883697 TTTTAACACTGTGAACATATTGG + Intergenic
996762118 5:126996943-126996965 TGTTAACATTTGTTATATCTGGG + Intronic
998575818 5:143315115-143315137 TGTTAAGACTTGGTGAATATTGG - Intronic
1000396650 5:160782197-160782219 ATTAAACACTTGGTATATATTGG + Intronic
1000804564 5:165773662-165773684 TTTTAACACTGGACATTTATTGG - Intergenic
1000870437 5:166570462-166570484 TGTTTAGACTGAGGATATATTGG - Intergenic
1002354607 5:178615380-178615402 GGTTAACATTTGGAATATATGGG + Intronic
1002848326 6:968460-968482 TATTAAAAATGGGTATAAATGGG + Intergenic
1004063957 6:12224789-12224811 AATTAACACTTGGTATATGTTGG + Intergenic
1004859804 6:19791866-19791888 TGTTACCACTCGGTATACCTAGG + Intergenic
1004963163 6:20815743-20815765 TGTTAACAGTGGTTATCTCTGGG - Intronic
1005529750 6:26691092-26691114 TGTAGACACTGGGTATAAACTGG + Intergenic
1005541046 6:26810555-26810577 TGTAGACACTGGGTATAAACTGG - Intergenic
1005765378 6:29005966-29005988 TGTAAATGATGGGTATATATGGG - Intergenic
1006883085 6:37356184-37356206 TCTTACCACTGAGTTTATATGGG - Intronic
1007463023 6:42031649-42031671 TGTTAACAGTGGTTATTTCTTGG - Intronic
1009011861 6:57852643-57852665 TGTAGACACTGGGTATAAACTGG - Intergenic
1010268069 6:73890253-73890275 TGGTAAAACTGGATATATATAGG - Intergenic
1010951583 6:82043134-82043156 TGTTAACAGTGGTTATCTCTAGG + Intergenic
1011312008 6:85989739-85989761 TGTTAACACTGGCTTTCTAGTGG + Intergenic
1012233360 6:96785590-96785612 TTTTATCACTGGCTTTATATTGG + Intergenic
1013321756 6:108998397-108998419 TGTTAAGACTGTGGAGATATTGG - Intronic
1015068444 6:129059274-129059296 TGTTAAAACCAGATATATATTGG + Intronic
1015225805 6:130855495-130855517 TTTAAACACAGGGTATATAATGG - Intronic
1015958368 6:138621781-138621803 TGTACAGACTGGGTATATCTGGG - Intronic
1016471571 6:144380351-144380373 TGTTAATACTGGTTATCTCTGGG + Intronic
1016618625 6:146081215-146081237 TGTTAACATTTGGGAAATATGGG + Intronic
1016620281 6:146101419-146101441 TTTTAACAATGGGTACATAATGG - Intronic
1016663558 6:146609363-146609385 TGTTAACCCTGAATGTATATGGG - Intronic
1016958539 6:149649733-149649755 TGTTGGCACTGGGTATACAGTGG + Intergenic
1017191426 6:151657821-151657843 TGTAAAAAATGGTTATATATTGG + Intronic
1017860939 6:158396690-158396712 TGTAAACACTGGTTATTTCTAGG - Intronic
1018344275 6:162884487-162884509 TGTTAACAGTAGGTAAATCTGGG + Intronic
1020887710 7:13839989-13840011 AGTTTACACTGGGTGTGTATGGG - Intergenic
1021175446 7:17444682-17444704 TTTAAAAACTGGGTACATATTGG - Intergenic
1021580809 7:22150820-22150842 TGTTAACACTGGTTACACTTAGG + Intronic
1021947364 7:25741396-25741418 TGTTTATATTGGGTTTATATTGG - Intergenic
1021958490 7:25850769-25850791 TTTTAACAGTATGTATATATTGG - Intergenic
1022386744 7:29906864-29906886 TTTTAGCACTTGGAATATATGGG - Intronic
1022573521 7:31475864-31475886 TGTTAACAGTGGTTATCTGTGGG + Intergenic
1024015055 7:45306092-45306114 TGTTAATACTGGTTATCTCTTGG - Intergenic
1025047336 7:55703011-55703033 TGTTAACACTGGTTATCTCATGG + Intergenic
1026588120 7:71674184-71674206 TGTTAACATTGATTATATCTGGG - Intronic
1027110271 7:75432817-75432839 TGTTAACAATGGGTACCTACTGG + Intronic
1027454377 7:78370170-78370192 TATTAACACTGGTTATTTTTGGG - Intronic
1028745117 7:94319014-94319036 TATTAATACAGGGAATATATTGG - Intergenic
1030651112 7:112117140-112117162 TGTTAACACCAGGTATCAATGGG - Intronic
1032156439 7:129473203-129473225 TATTAACAGTGGCTATATGTAGG - Intronic
1032245536 7:130208291-130208313 TGTTAACAGTGGTTATCTCTGGG - Intronic
1033468025 7:141614812-141614834 TGTTAACATTTGTTAAATATAGG + Intronic
1033621426 7:143065149-143065171 TATTAACAATGGCTATATCTGGG + Intergenic
1038228329 8:25677282-25677304 TGATAACAATGGTTATATTTGGG + Intergenic
1038236606 8:25764152-25764174 ACTTTACACTGTGTATATATTGG - Intergenic
1038448146 8:27618399-27618421 TCTCATTACTGGGTATATATAGG - Intergenic
1039595163 8:38785244-38785266 TGTTATCACAGGGTAAATTTGGG - Intronic
1040709788 8:50174583-50174605 TGAAAACATTGGGTATATAATGG - Intronic
1041811336 8:61913891-61913913 TGTTAACACTGCATATTTCTAGG - Intergenic
1042029359 8:64458808-64458830 TATTAACAATGGTTATATCTCGG + Intergenic
1045522112 8:102912681-102912703 TCTTAAAACTGGCTATACATTGG - Intronic
1045580427 8:103473291-103473313 TCTTAACACTGGGTATAGTCAGG - Intergenic
1045614130 8:103886639-103886661 GGTTAACAATGGTTATATCTGGG - Intronic
1047861763 8:128974898-128974920 TGTTAAAAGTGTGTATACATGGG - Intergenic
1047882925 8:129216365-129216387 TGTTAACATTGTGTGTTTATTGG - Intergenic
1048904082 8:139070319-139070341 TGTTAAAACTGTGTATATTTGGG + Intergenic
1049390400 8:142365677-142365699 TGTTAACATTTGGGATATTTGGG + Intronic
1050144658 9:2554221-2554243 TATTAACAGTGGTTATGTATGGG + Intergenic
1050430958 9:5561033-5561055 TTTAGACACTGGGCATATATTGG - Intronic
1050469065 9:5965998-5966020 AGTTAATACTGGGTAAACATTGG - Intronic
1051734324 9:20182873-20182895 TGGTAACAATAGGTATACATTGG + Intergenic
1052628171 9:31003605-31003627 TGTTACCACTGGGGAAAAATGGG - Intergenic
1055936604 9:81610065-81610087 TGTTAACACTTTCTATAAATAGG - Intronic
1058214061 9:102210972-102210994 TGTAAACACTGGGTTTTTAACGG + Intergenic
1060805950 9:126576977-126576999 TGATAACACTTCGGATATATTGG + Intergenic
1062405977 9:136396788-136396810 TGTTAACAGTGGTTATTTCTGGG + Intronic
1062664459 9:137661184-137661206 TGTTAACACTTGGGGTATCTGGG - Intronic
1203756442 Un_GL000218v1:132018-132040 TGTTAACAATGGGGAGAAATTGG + Intergenic
1203715801 Un_KI270742v1:144693-144715 TGTTAACAATGGGGAGAAATTGG + Intergenic
1203535412 Un_KI270743v1:33538-33560 TGTTAACAATGGGGAGAAATTGG - Intergenic
1203650053 Un_KI270751v1:108253-108275 TGTTAACAATGGGGAGAAATTGG + Intergenic
1186986987 X:15027967-15027989 TGTTAACATTAGTTATCTATGGG + Intergenic
1187204934 X:17172806-17172828 TGTTAACAGTGGTTATCTCTGGG - Intergenic
1187544611 X:20236158-20236180 TGTTAACAGTGGTTATCTCTGGG + Intronic
1187886808 X:23896285-23896307 TGTTAACAGTGGTTGTCTATAGG + Intronic
1188703726 X:33300088-33300110 TGTTTCCACTGGGAATATATAGG - Intronic
1189395128 X:40614483-40614505 TGTTAACAGTTGGTAAATCTAGG + Intergenic
1190094219 X:47466088-47466110 TGTTAACACTGGTTAACTTTGGG + Intronic
1191616263 X:63173457-63173479 TGTAAACACTGGGTACACATGGG + Intergenic
1191620034 X:63205466-63205488 TGTAAACACTGGGTACACATGGG - Intergenic
1192169630 X:68846283-68846305 TATAAATACTGTGTATATATAGG - Intergenic
1192734608 X:73837624-73837646 TGTTAACACTGGGAAAAACTGGG + Intergenic
1192844238 X:74888856-74888878 TTTGAAAACTGAGTATATATAGG - Intronic
1193728500 X:85073075-85073097 TGTTAACAAAGGTTATATTTGGG + Intronic
1194141939 X:90219007-90219029 TGTTTCTCCTGGGTATATATAGG + Intergenic
1194696549 X:97059241-97059263 TGTTAAAAATGTGTATATTTTGG + Intronic
1195307777 X:103602659-103602681 TGTTAACAATGGGGAAATAAAGG + Intergenic
1195638435 X:107145487-107145509 TGTTAACAGTGGGTTAATCTAGG - Intronic
1196162024 X:112495714-112495736 TTCTAATTCTGGGTATATATTGG - Intergenic
1198378078 X:136059199-136059221 TGTTAACAATGGTTATCTTTGGG - Intergenic
1198748021 X:139909668-139909690 TGTTACCACTGGGGAGAAATTGG + Intronic
1199380498 X:147166748-147166770 CATTAAAACTGGGTATAAATGGG - Intergenic
1200098420 X:153674916-153674938 TTTTTACACAGAGTATATATGGG - Intronic
1200487700 Y:3788120-3788142 TGTTTCTCCTGGGTATATATAGG + Intergenic