ID: 1107511297

View in Genome Browser
Species Human (GRCh38)
Location 13:41088102-41088124
Sequence AACTGGGACTACAGGCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 16, 3: 55, 4: 300}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107511287_1107511297 19 Left 1107511287 13:41088060-41088082 CCTGCTGAGCTCAAGTGATTTTC 0: 1
1: 11
2: 312
3: 5483
4: 42889
Right 1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG 0: 1
1: 0
2: 16
3: 55
4: 300
1107511291_1107511297 -7 Left 1107511291 13:41088086-41088108 CCTCCACCTCCTAAGTAACTGGG 0: 1
1: 32
2: 986
3: 17916
4: 222262
Right 1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG 0: 1
1: 0
2: 16
3: 55
4: 300
1107511289_1107511297 -6 Left 1107511289 13:41088085-41088107 CCCTCCACCTCCTAAGTAACTGG 0: 1
1: 0
2: 28
3: 318
4: 3232
Right 1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG 0: 1
1: 0
2: 16
3: 55
4: 300
1107511286_1107511297 25 Left 1107511286 13:41088054-41088076 CCTCGACCTGCTGAGCTCAAGTG 0: 1
1: 73
2: 1378
3: 9446
4: 36886
Right 1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG 0: 1
1: 0
2: 16
3: 55
4: 300
1107511288_1107511297 -3 Left 1107511288 13:41088082-41088104 CCTCCCTCCACCTCCTAAGTAAC 0: 1
1: 0
2: 57
3: 1170
4: 20300
Right 1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG 0: 1
1: 0
2: 16
3: 55
4: 300
1107511293_1107511297 -10 Left 1107511293 13:41088089-41088111 CCACCTCCTAAGTAACTGGGACT 0: 1
1: 48
2: 725
3: 2111
4: 2583
Right 1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG 0: 1
1: 0
2: 16
3: 55
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107511297 Original CRISPR AACTGGGACTACAGGCAAAC AGG Intergenic
900763164 1:4486494-4486516 CACTGGGACTCAAAGCAAACTGG + Intergenic
901460781 1:9390298-9390320 AGCTGGGACTACAGACATGCTGG - Intergenic
901575272 1:10195703-10195725 AAATGGGACTACAGGACTACAGG + Intergenic
901899406 1:12345970-12345992 CACTGGGACTACAGGCAGGAAGG - Intronic
902591745 1:17479999-17480021 AGCTGGGACTACAGGCATGGTGG - Intergenic
904628181 1:31820545-31820567 AACTGGGACTACAGGGAGTATGG - Intergenic
905229334 1:36504852-36504874 AGCTGGGACTACAGGGGCACAGG + Intergenic
906038975 1:42772125-42772147 CACTGGGTGTACTGGCAAACAGG - Intronic
909786895 1:79624251-79624273 AACTGGGATTACAGGGTTACAGG + Intergenic
910079300 1:83322193-83322215 TACTGGGACTACACTCAACCTGG - Intergenic
910218657 1:84867079-84867101 AACTGGGATATCAGGCAGACAGG + Intronic
910818157 1:91314383-91314405 AGCTGGGACCACAGGCACATTGG + Intronic
911004756 1:93208461-93208483 AGCTGGGACTACAGGCACAAGGG + Intronic
911594137 1:99781610-99781632 AGCTGGGACTACAGGCATGCAGG + Intergenic
911778233 1:101842397-101842419 AGCTGGGACTATAGGCTACCAGG - Intronic
912917293 1:113828149-113828171 AACTGGCACCACAGCCAAAGGGG - Intronic
913244688 1:116861319-116861341 CACTGGGCTTCCAGGCAAACAGG - Intergenic
914864639 1:151416368-151416390 AGCTGGGACTACAGGCATGTTGG - Intronic
917474673 1:175358880-175358902 AACAGAGAGTACAGGCTAACAGG - Intronic
917928680 1:179809133-179809155 TACTGGGGCTTCAGGGAAACTGG + Intronic
917950779 1:180032647-180032669 AAGAGTGACTACAGGCAAATAGG - Intronic
918975722 1:191483395-191483417 AGCTGGGACTACAGGACCACAGG + Intergenic
920324892 1:205155524-205155546 AGCTGGGATTACAGGCAGCCAGG - Intronic
1064484466 10:15771184-15771206 AGTTGGGACTACAGGCAACAGGG + Intergenic
1065359975 10:24880382-24880404 AGCTGGGATTACAGGCTACCAGG + Intronic
1065703320 10:28446280-28446302 AGCTGGGACTACAGGTGTACTGG + Intergenic
1066560803 10:36667989-36668011 AACTGGGACTTCAGGAACCCTGG - Intergenic
1068428902 10:56907183-56907205 AGCTGGGAATACAGGAATACAGG + Intergenic
1069277260 10:66608219-66608241 ATCTGGGAATACAGGTAATCGGG + Intronic
1069397258 10:68003283-68003305 AGCTGGGACTACAGGCCTGCAGG + Intronic
1069465952 10:68639288-68639310 AGCTGGGATTACAGGCTCACAGG - Intronic
1070245531 10:74728083-74728105 AGCTGGGACTACAGGCATGTGGG + Intergenic
1070486245 10:76934580-76934602 AATGGGGTCTACAGGCAAAAGGG - Intronic
1070500630 10:77069789-77069811 AAGAGGGACTACTGGCATACAGG - Intronic
1070622910 10:78027680-78027702 AGCTGGGGTTACAGGCATACAGG + Intronic
1071063372 10:81600671-81600693 AGCTGGGACTACAGGCAGGCAGG + Intergenic
1071437233 10:85658692-85658714 AACTGGGACTGTGGGCAAAGAGG + Intronic
1072454668 10:95565202-95565224 ACCTGGGTCCACAGGGAAACGGG + Intergenic
1073119641 10:101113655-101113677 ATCAGGAACTATAGGCAAACAGG + Intronic
1073220711 10:101870805-101870827 AGCTGGGACTACAGGCTACCAGG - Intronic
1073357752 10:102870399-102870421 ACTTGGGACTACAGGCTCACTGG - Intronic
1074094929 10:110303656-110303678 AACTGGTAATTCAGGCAGACAGG - Intronic
1074113912 10:110441623-110441645 AGCTGGGACTACAGGACTACAGG - Intergenic
1075750116 10:124761796-124761818 AGCTGGGACTACAGGCGCACAGG - Intronic
1076023508 10:127093375-127093397 AGCTGGGACCACAGGCATCCAGG + Intronic
1076638350 10:131898031-131898053 AGCTAGGACTACAGACATACGGG + Intergenic
1077653789 11:3999204-3999226 AGCTTGGACTACAGGCACAGGGG - Intronic
1077899146 11:6475810-6475832 AGCTGGGACTACAGGACTACAGG + Exonic
1078228500 11:9416065-9416087 AACTGGGATTACAGGCTTACAGG - Intronic
1079429787 11:20378432-20378454 AGCTGGGACTACAGGCATGAGGG + Intronic
1080007509 11:27425460-27425482 AGCTAGGACTACAGGCATGCAGG + Intronic
1080102855 11:28479581-28479603 AAAAGAGACTACAGGCAAGCTGG - Intergenic
1084425641 11:69083229-69083251 AACTGCGACTTCAAGCAAAACGG - Intronic
1085281409 11:75333485-75333507 AACTGGGGGCACAGACAAACGGG + Intronic
1085593428 11:77786933-77786955 AACTGGGTAAAGAGGCAAACAGG + Intronic
1090925724 11:131248745-131248767 AACTGGGAGTGCAGGCTAATTGG + Intergenic
1091204522 11:133810549-133810571 AACTGGGCCCACAGGCCAGCAGG - Intergenic
1091736837 12:2929431-2929453 AGCTAGGACTACAGACACACAGG + Intronic
1097443663 12:59642904-59642926 AATTGGGAATACAGGCACAAAGG + Intronic
1097794534 12:63847219-63847241 AAGTGGAACCACAGGCACACTGG - Intronic
1098564640 12:71919304-71919326 AGCTGGGACTACAGGTCTACAGG + Intronic
1098695593 12:73550243-73550265 TACTGGGGCTGCAGGGAAACTGG + Intergenic
1100123742 12:91398267-91398289 AACTGGGCCTAAATTCAAACGGG - Intergenic
1100515088 12:95319789-95319811 AAATGGGACTACAGGGTGACTGG + Intergenic
1100682933 12:96948743-96948765 CACTAGGAATAAAGGCAAACTGG - Intronic
1102052541 12:109873310-109873332 ATCTGGGACATCAGGCTAACTGG - Intronic
1103221666 12:119251476-119251498 AACTGACACTGCAGGCAAAAAGG + Intergenic
1103334810 12:120181331-120181353 AGCTGGGACTACAGGCATGCTGG - Intronic
1103506927 12:121447797-121447819 AGCTGGGACTACAGGCGTGCTGG + Intronic
1103615985 12:122152623-122152645 AGCTGGGACTACAGGTGTACAGG + Intergenic
1103623974 12:122204896-122204918 AGCTGGGACTACAGGCGTGCAGG - Intronic
1103750783 12:123158957-123158979 AGCTGGGATTACAGGCACATGGG - Intronic
1104939005 12:132386187-132386209 AATTGGGGCTAGAGGCACACGGG + Intergenic
1105390121 13:19968372-19968394 AGCTGGGACTACAGGTGCACTGG + Intronic
1106151883 13:27112413-27112435 AACTGGGACCTCAGGCACTCAGG + Intronic
1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG + Intergenic
1107978442 13:45712895-45712917 AACTGTGACCACAGGCTCACAGG + Intronic
1108394576 13:49979989-49980011 AGCTGGGACTACAGGCACCGTGG - Intergenic
1108566879 13:51708345-51708367 AGCTGAGACTACAGGCTAATTGG - Intronic
1109511393 13:63379209-63379231 AGCTGGGACTACAGGTATTCAGG - Intergenic
1110227677 13:73136652-73136674 AGCTGGGACTACAGGCACACAGG + Intergenic
1110356299 13:74571776-74571798 AGCTGGGACTACAGGCACACAGG - Intergenic
1111096960 13:83529023-83529045 AGCTGGGACTACAGGCCACCAGG + Intergenic
1111949492 13:94699487-94699509 AATTGGGACTACAGGCTATTTGG + Intergenic
1112302959 13:98247108-98247130 AGCTGGGATTACAGGCATGCGGG - Intronic
1113931034 13:113969003-113969025 GACTGGGATTACAGCCAACCTGG + Intergenic
1115562612 14:34596798-34596820 AGCTGGGATTACAGGCACGCAGG + Intronic
1116495586 14:45555673-45555695 AGCTGGGATTACAGGCAATTTGG + Intergenic
1116662278 14:47726054-47726076 AGCTGGGACTACAGGCTACTCGG + Intergenic
1117259616 14:54017966-54017988 ACCTGGGAATACAGGTAATCAGG + Intergenic
1117506444 14:56408088-56408110 ACCTAGGAATACAGCCAAACAGG + Intergenic
1117684149 14:58236415-58236437 AGCTGGGATTACAGGCATACAGG - Intronic
1118267179 14:64305908-64305930 AAATGGGACTACAGAAAAATAGG + Intronic
1118356764 14:65020555-65020577 AGCTGGGACTACAGGCATACAGG + Intronic
1118360127 14:65048993-65049015 AGCTGGGATTACAGGCAACGTGG - Intronic
1120441137 14:84541581-84541603 AACTGGGACTGCAGGCAAAAAGG - Intergenic
1121285295 14:92730556-92730578 AGCTGGGACTACAAGCATGCTGG + Intronic
1121659993 14:95627650-95627672 AGCTGGGACTACAGGCGCACAGG - Intergenic
1121994566 14:98592339-98592361 GACTGGGAGCACAGGCAAATAGG + Intergenic
1122086518 14:99311034-99311056 AGCTGGGATTACAGGCTTACAGG + Intergenic
1122644555 14:103185248-103185270 AGCTGGGACTACAGGCACCATGG - Intergenic
1122649202 14:103216498-103216520 ATCTGTGACTTCAGGGAAACGGG + Intergenic
1126589346 15:50323732-50323754 AGCTGGGACTACAGGAAGACAGG - Intronic
1127055850 15:55130351-55130373 AGCTTGGATTACAGGCACACCGG + Intergenic
1127144017 15:56006710-56006732 AACTTGGAATACAGGAAAAAGGG - Intergenic
1127234397 15:57032558-57032580 AGCTGGGACTACAGGCATATGGG + Intronic
1127693602 15:61422019-61422041 ATCTGGGCCTAAAGGAAAACAGG - Intergenic
1128070553 15:64793541-64793563 AGCTGGGACTACAGGCATACAGG - Intergenic
1128303561 15:66582708-66582730 AGCTGGGACTACAGGCACATGGG + Intronic
1130920775 15:88342750-88342772 AACCTGGACTAGAAGCAAACTGG - Intergenic
1131319183 15:91369698-91369720 AGCTAGGACAACAGGCCAACAGG - Intergenic
1131698359 15:94904554-94904576 AGCTGGGACTACAGGCAAGAAGG + Intergenic
1132609173 16:806708-806730 AACTGGGACTACAGGCGCGCAGG - Intronic
1133979269 16:10621519-10621541 AGCTGGGACTACAGGGCTACAGG - Intergenic
1134366317 16:13582556-13582578 AGCTGGGATTACTGGCACACGGG + Intergenic
1134861258 16:17562443-17562465 AGCTGGGACTACAGGCACCCAGG + Intergenic
1135178222 16:20250498-20250520 AGCTGAGACTACAGGCGCACAGG + Intergenic
1135411093 16:22235010-22235032 AGCTGGGATTACAGGCAACATGG + Intronic
1135851946 16:25971797-25971819 AGCTGGGATTACAGGCCCACTGG - Intronic
1137520563 16:49191590-49191612 AACTGGGTCTCCAGGGAAAGGGG + Intergenic
1138046573 16:53731694-53731716 AGCTGGGACTACAGGACTACAGG + Intronic
1138635836 16:58337642-58337664 AACTAGGACTACAGGACTACAGG - Intronic
1139065469 16:63307904-63307926 AGCTGGGACTGCAGGCATGCAGG + Intergenic
1139785434 16:69388488-69388510 AGCTGGGATTACAGGAAAGCAGG + Intronic
1139962306 16:70725069-70725091 AGCTGGGGCCAGAGGCAAACAGG + Intronic
1140447664 16:75044348-75044370 AGCTAGGACTATAGGCATACAGG + Intronic
1140516978 16:75550314-75550336 AACAGGGACAACCAGCAAACAGG - Intronic
1141193394 16:81841362-81841384 AGCTGGGATTACAGGCACCCAGG + Intronic
1143543231 17:7581794-7581816 AGCTGGGATTACAGGCCAGCTGG - Exonic
1143646187 17:8231877-8231899 AACTGGGACTCCAGGGACCCAGG - Intronic
1143648306 17:8246772-8246794 AGCTGGAATTACAGGCATACAGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144342107 17:14318459-14318481 CACTGGGAGTACCGGCAAGCAGG - Intronic
1144441657 17:15287967-15287989 CATTGGTTCTACAGGCAAACAGG + Intergenic
1147202749 17:38814410-38814432 AGCTGGGACTACAGGCACCCAGG + Intronic
1147665558 17:42145039-42145061 AGCTGGGACTACAGGCCTATAGG - Intronic
1148127341 17:45243613-45243635 AACTGGGAATCCAGAGAAACTGG - Intronic
1149745565 17:59094158-59094180 TGCTGGGATTACAGGCATACAGG + Intronic
1149835727 17:59910210-59910232 AGCTGGGACTATAGGCACCCGGG - Intronic
1150510236 17:65744383-65744405 AGCTGGGACTACAGGCCACCAGG + Intronic
1150550065 17:66201997-66202019 AACTGTGATGACAGGCAACCTGG + Intergenic
1151609550 17:75163357-75163379 AGCTGGGATTACAGGCATCCGGG + Intronic
1153213526 18:2794353-2794375 AGCTCGGATTACAGGCAAATTGG - Intronic
1153599547 18:6766351-6766373 AACTAGGACTAAAGACAAAGAGG - Intronic
1153653992 18:7265988-7266010 AACTGGGACCACAGGTGCACAGG - Intergenic
1155943422 18:31822318-31822340 AGCTGGGACTACAGGTGAAATGG - Intergenic
1156422255 18:36967626-36967648 GACTGGGACATCAGGAAAACTGG + Intronic
1156675290 18:39520596-39520618 AGCTGGGAATACAGGCATACAGG - Intergenic
1158554235 18:58461894-58461916 AGCTGGGATTACAGGCATGCTGG - Intergenic
1159233311 18:65636869-65636891 AGCTGGTACCACAGGCAAGCTGG + Intergenic
1160783404 19:888685-888707 AACAGGAAATACAGACAAACGGG + Intronic
1161558280 19:4956694-4956716 AACTGGAACTAGAGGGAAGCGGG - Exonic
1162231978 19:9274549-9274571 AGCTGGGATTACAGGCATACAGG - Intergenic
1163092972 19:15034146-15034168 AGCTGGGACTACAGGCATACAGG - Intergenic
1163984690 19:20934643-20934665 AGCTGGGACTACAGGACTACAGG - Intronic
1165239671 19:34455904-34455926 TGCTGGGATTACAGGCATACAGG + Intronic
1167004910 19:46769363-46769385 AACTGGGATTACAGGCATGAAGG - Intronic
1167076592 19:47253764-47253786 GACTGGCACTACAGGCAATCTGG + Intergenic
1167470173 19:49671315-49671337 AGCTGGGATTACAGGCATGCCGG - Intronic
1167555638 19:50193529-50193551 AGCTGAAACTACAGGCATACAGG + Intronic
1168024652 19:53635102-53635124 AGCTGGGACTACAGGTCTACAGG + Intronic
1168268438 19:55236420-55236442 TACTGGGATTACAGGCACTCAGG + Intronic
1168661130 19:58167693-58167715 AGCTGGGATTACAGGCATATGGG - Intergenic
1168676637 19:58283107-58283129 AGCTGGGACTACAGGCAGCCTGG + Intronic
925091784 2:1162322-1162344 AACAAGGACTTCAGGCACACTGG + Intronic
925442640 2:3901530-3901552 AAGTGGTACTAGAGGAAAACAGG - Intergenic
926949824 2:18229308-18229330 ACCTAGGAATACAGGTAAACAGG - Intronic
927822714 2:26282523-26282545 TGCTGGGATTACAGGCATACAGG + Intronic
928440900 2:31291039-31291061 AGCTGGGATTACAGGCATGCAGG - Intergenic
931218568 2:60268300-60268322 CACTGGGAGAACAGACAAACCGG + Intergenic
931947434 2:67325583-67325605 AACTGTGCCTACAAGCTAACAGG - Intergenic
932021029 2:68086993-68087015 AGCTGGGACTACAGGACTACAGG - Intronic
932038410 2:68272236-68272258 AACTTTGACTGCTGGCAAACTGG - Intergenic
934031395 2:88051053-88051075 AGCTGGGACTACAAGCATGCGGG + Intronic
934515889 2:94986193-94986215 AGCTGGGATTACAGGCACCCAGG + Intergenic
934968808 2:98746327-98746349 AGCTGGGACCACAGGCAACCAGG + Intergenic
935644515 2:105323173-105323195 CACTGGGACCACAAGAAAACTGG - Intronic
936770604 2:115908252-115908274 AAATAGGACTACAGGCTCACTGG + Intergenic
936837952 2:116730915-116730937 AACTGGGGCTAAAGGGAAATGGG - Intergenic
937374830 2:121329063-121329085 ATCTAGGACTATAGGCATACAGG + Intergenic
937400438 2:121578288-121578310 AGCTGGGACTGCAGGCATGCAGG - Intronic
938052847 2:128190920-128190942 AGCAGGGACTAAAGGCAAATGGG - Exonic
938882268 2:135603111-135603133 AGCTGGGACTACAGGCTTGCAGG + Intronic
939941705 2:148359133-148359155 AGCTGGGACTACAGGCGTGCAGG - Intronic
939986930 2:148838425-148838447 CACTGGGATTACAGGCATAATGG + Intergenic
940877556 2:158913153-158913175 AGCTGAGACTACAGGCATCCTGG - Intergenic
941697814 2:168572158-168572180 AACTGTGGCTAAAGGCATACAGG - Intronic
942557386 2:177185923-177185945 GACTGGGACTACAAGCATGCAGG + Intergenic
943853318 2:192756092-192756114 AACTGGGAATAATGGCAAGCAGG + Intergenic
944054059 2:195504499-195504521 AGCTGGGACTACAGGCATGCGGG + Intergenic
947934991 2:233997140-233997162 AGCTGGGACTACAGGACTACAGG - Intronic
948202516 2:236139878-236139900 AGCTGGGACTACAGGCACCTGGG - Intergenic
1169268901 20:4184109-4184131 AGCTGGGACCACAGGCATGCCGG + Intronic
1169818545 20:9684158-9684180 AACTGTGACTACAGAGATACTGG + Intronic
1174199319 20:48796029-48796051 AACTGGGGCTGGAGGCAACCAGG + Intronic
1174290721 20:49506642-49506664 TGCTGGGATTACAGGCAAGCCGG + Exonic
1175600714 20:60270479-60270501 AACTGGGGCTGCAAGCAGACTGG + Intergenic
1177158429 21:17522111-17522133 AGCTGGGACTACAGGCACCTAGG + Intronic
1177600300 21:23302321-23302343 AGCTGGGACTACAGGCCTACAGG + Intergenic
1177862766 21:26474176-26474198 AGCTGGGACTACAGGCCCACAGG + Intronic
1178077039 21:29021977-29021999 AGCTGGGACTACAGGCCTACAGG - Intergenic
1178275200 21:31230658-31230680 AGCTGGGACTACAGGCTACTAGG + Intronic
1178286043 21:31326286-31326308 AGCTGGGACAACAGGAAGACAGG - Intronic
1178572986 21:33758147-33758169 TACTGGGATTACAGGCACCCAGG + Intronic
1179111017 21:38445271-38445293 AGCTGGGATTACAGGCACAGTGG + Intronic
1179254829 21:39706607-39706629 CACTTGGAAGACAGGCAAACAGG + Intergenic
1180628547 22:17210910-17210932 AGCTGGGACCACAGGCATGCTGG - Intronic
1181299552 22:21869750-21869772 AGCTGGGACTACAGGCACACCGG - Intergenic
1182483847 22:30627486-30627508 AACTGGGATTACAGGCATGCAGG - Intergenic
1183054501 22:35295312-35295334 AATTGGGAATACAGAGAAACAGG + Exonic
1183928047 22:41219871-41219893 AGCTGGGACTACAGGCCACCTGG + Intronic
1185319738 22:50195089-50195111 AACCTGGGCAACAGGCAAACAGG - Intronic
949508006 3:4744832-4744854 AAATGGGAATTCAGGGAAACAGG + Intronic
949992319 3:9589908-9589930 AGCTGGGACTACAGGCATGTAGG - Intergenic
950778439 3:15370898-15370920 GACTGGGACTACTGGCAAACAGG - Intergenic
951903435 3:27679924-27679946 TGCTGGGATTACAGGCATACAGG - Intergenic
952400336 3:32957474-32957496 ATCTGGGATTGCAGGCACACTGG - Intergenic
953702267 3:45206084-45206106 AGCTGGAACTACAGGCATGCAGG + Intergenic
953835181 3:46336886-46336908 AGCTGGGACTACAGGCATCTGGG + Intergenic
954180912 3:48880708-48880730 AGCTGGGACTACAGGCAAGCCGG + Intronic
954689873 3:52389986-52390008 AGCTGGGATTACAGGCTTACAGG - Intronic
955773051 3:62405348-62405370 GGCTGTGACAACAGGCAAACCGG + Intronic
956309076 3:67859200-67859222 AATTGGAAATACAGGCACACAGG + Intergenic
956640508 3:71411444-71411466 AGCTGGGACTACACACACACAGG + Intronic
957960977 3:87252246-87252268 AACTGGGGCTCCTGGCAAATAGG - Intronic
958935032 3:100247582-100247604 AACTGGGACTACAGACTAACTGG + Intergenic
959257768 3:104036583-104036605 AGCTGGGACTACAGGCGTACAGG + Intergenic
959915070 3:111807613-111807635 AAGTGGGACTACAGGACTACAGG - Intronic
960949972 3:122992963-122992985 ACCTGGGGCCACAGGCACACCGG + Intronic
961586811 3:127935951-127935973 AACTTTTACTACAGACAAACAGG + Intronic
962600242 3:136986079-136986101 AGCTGGGACTACAGGCGACGGGG - Intronic
962852442 3:139318224-139318246 AGCTGGGACTACAGTCCAACAGG + Intronic
962934376 3:140066245-140066267 CACTGGGACTGCAGACAGACAGG - Intronic
963033766 3:141006178-141006200 AGCTGGGATTACAGGCACACAGG + Intergenic
963508040 3:146212579-146212601 AACTGGGACTACAGGAGTACAGG + Intronic
965085440 3:164089899-164089921 AGCTGGGACTACAGGCATGTGGG + Intergenic
966069574 3:175859233-175859255 TGCTGGGATTACAGGCATACAGG - Intergenic
966613161 3:181888440-181888462 AGCTGGGACTACAGGCACACAGG - Intergenic
966759284 3:183402320-183402342 AGCTGGGACTACAGGCACCCGGG - Intronic
966890423 3:184403708-184403730 AGCTGGGACTACAGGTGCACAGG + Intronic
967568240 3:190996611-190996633 AACTGGTATTACAGACCAACTGG - Intergenic
968210594 3:196845495-196845517 AGCTGGGATTACAGGCATGCCGG + Intergenic
968255685 3:197268549-197268571 AGCTGGGACTACAGGCATGAAGG + Intronic
968338880 3:197937805-197937827 AGCTGGGACTACAGCCACACTGG - Intronic
972032985 4:34485980-34486002 AGCTGGGACTACTGGTAAAGTGG + Intergenic
972465768 4:39355301-39355323 AGCTGGGACTACAGGCATGCAGG - Intronic
972706502 4:41549154-41549176 TGCTGGGATTACAGGCATACGGG + Intronic
973033325 4:45372521-45372543 AACTGGGACTACAGGTGCACAGG - Intergenic
973080739 4:45989795-45989817 AACTATGACCACAGTCAAACTGG + Intergenic
973124132 4:46562964-46562986 AACTGGAAACACAGGCAAAGAGG - Intergenic
973275188 4:48299654-48299676 AGCTGGGATTCTAGGCAAACAGG + Intergenic
973302459 4:48603581-48603603 AAGTGGGAATACAGGCTAAGAGG + Intronic
973686517 4:53376122-53376144 ACCTGGGACTACAGACAAGCAGG - Intergenic
974251375 4:59389378-59389400 AACTAAGGGTACAGGCAAACAGG + Intergenic
974604478 4:64133143-64133165 AGCTGGGACTACAGGCATGTGGG - Intergenic
975772650 4:77744767-77744789 AACTGGGAATACAGGAAAAAGGG - Exonic
976248536 4:83027380-83027402 AGCTGGGACTACAGGCACACTGG - Intergenic
976561326 4:86504907-86504929 AAGAGGGACTGTAGGCAAACTGG - Intronic
978555277 4:109973103-109973125 AGGTGGGACCACAGGCAGACAGG - Intronic
980044292 4:127971120-127971142 AGCTGGGACCACAGGCACACAGG - Intronic
980278005 4:130680195-130680217 AGCTGGGACTACAGGACTACAGG - Intergenic
981140491 4:141262355-141262377 AACCTGCACTACAGGCAAAGTGG + Intergenic
981874138 4:149520377-149520399 CCCTGGGACAACAGGCAAAATGG - Intergenic
982570398 4:157043307-157043329 GACAGGCACTACAAGCAAACAGG + Intergenic
983077949 4:163348511-163348533 AGCTGGGACTACAGGCACGTGGG - Intronic
983218489 4:165022552-165022574 AGCTGGGACTGCAGGCATGCAGG + Intergenic
983266247 4:165511266-165511288 AACTGGAACTAAATGCAAAATGG - Intergenic
984120574 4:175737373-175737395 AGCTGGGATTACAGGCATGCAGG - Intronic
986448960 5:7848274-7848296 GCCTGGGAGAACAGGCAAACAGG + Intronic
988556508 5:32240730-32240752 AGCCAGGACTACAGGCACACAGG + Intronic
988938845 5:36120188-36120210 AGCTGGGACTACAGGTAGGCTGG + Intronic
988938863 5:36120290-36120312 AGCTGGGACTACAGGTAGGCTGG + Intronic
989015862 5:36932927-36932949 AGCTGGGAGTACAGGCATATAGG + Intronic
989147601 5:38264221-38264243 CCCTGGGACCTCAGGCAAACTGG - Intronic
990067967 5:51741793-51741815 AGCTGGGATTACAGGCATGCAGG - Intergenic
990216851 5:53543076-53543098 AGCTGGGACTACAGGCAACTTGG - Intergenic
990572499 5:57093482-57093504 AGCTGGGATTACAGTCAACCCGG - Intergenic
990828517 5:59930028-59930050 AGCTGGGACTACAGGCGATGGGG - Intronic
991956685 5:72001754-72001776 AACTGGGAATTCAGGCAAGATGG - Intergenic
993707924 5:91192561-91192583 AGCTGGGACTACAGGTATACAGG - Intergenic
995516792 5:112962297-112962319 AGCTGGGATTACAGGCTTACAGG - Intergenic
995560298 5:113374026-113374048 AGCTGGGACCACAGGCCCACAGG + Intronic
996976268 5:129438806-129438828 AGCTGGGACCACAGACAAAGGGG - Intergenic
998386371 5:141759359-141759381 AGCTGGGACTACAGGCACTGTGG + Intergenic
999225769 5:150022940-150022962 AGCTGGGAACACAGGCACACAGG + Intronic
999335675 5:150714336-150714358 AACAGGGACCACAAGCAAACAGG - Intronic
1000605933 5:163327541-163327563 AGCTGGGACTAAAGGCATGCAGG + Intergenic
1001495247 5:172183577-172183599 AGCTGGGATTACAGGCTTACAGG + Intronic
1001838708 5:174854689-174854711 AGCTGGGACTACAAGCCTACAGG + Intergenic
1002208022 5:177577592-177577614 AGCTGGGACTACAGGCCTACAGG + Intergenic
1002984999 6:2181040-2181062 AGCTGGGACTACAGGCACCCAGG - Intronic
1005941176 6:30561428-30561450 AACTGCTGCTACAGGCAACCTGG + Intronic
1006390993 6:33758405-33758427 AGCTGGGACTACAGGACTACAGG - Intergenic
1006752149 6:36385332-36385354 AGCTGGGACTACAGGCACACTGG - Intronic
1006770581 6:36549261-36549283 AGCTGGGACTACAGGACTACAGG + Intergenic
1008944466 6:57082665-57082687 AACTGGGAGGACAGTCCAACTGG - Intergenic
1009196689 6:60695326-60695348 AACTGGGACCACAGGCATGTGGG + Intergenic
1009294282 6:61925588-61925610 AGCTGGGACTACAGGTGTACAGG - Intronic
1014251212 6:119117240-119117262 AACTTGGACTACTGGGAATCAGG + Intronic
1015764828 6:136705424-136705446 AGCTAGGACTACAGGCCTACAGG + Intronic
1016099273 6:140077340-140077362 AGCTGGGACTACAGGCATGCAGG - Intergenic
1016898881 6:149080833-149080855 AACGGGGGCTTCAGGCAACCTGG - Intergenic
1016932024 6:149421024-149421046 AGCTGGGACTACAGGTGTACAGG - Intergenic
1017253911 6:152311905-152311927 AGCTGGGACTACACGCACCCAGG + Intronic
1018249986 6:161859477-161859499 AGCTGAGATTACAGGCATACAGG - Intronic
1019990290 7:4685478-4685500 TGCTGGGATTACAGGCATACAGG + Intronic
1020056708 7:5122637-5122659 AGCTGGGATTACAGGCAATTAGG - Intergenic
1020078023 7:5271335-5271357 AGCTGGGACTACAGGCATGGTGG + Intergenic
1020171196 7:5846325-5846347 AGCTGGGATTACAGGCAATTAGG + Intergenic
1021889278 7:25171854-25171876 AACTGGGGCCACAGGGGAACTGG - Intronic
1025089959 7:56053620-56053642 AGCTGGGACTACAGGCGTGCAGG - Intronic
1025111551 7:56221158-56221180 AGCTGGGACTAGAGGCATGCTGG - Intergenic
1026343377 7:69453236-69453258 AGCTGGGACTACAGGCAAAACGG - Intergenic
1027297067 7:76787478-76787500 TACTGGGACTACACTCAACCTGG - Intergenic
1027992310 7:85377906-85377928 AGCTAGGACTACAGGCCTACAGG - Intergenic
1028848132 7:95506023-95506045 AGCTGAGACTACAGGCACATGGG + Intronic
1029389356 7:100264689-100264711 TGCTGGGATTACAGGCATACTGG + Intronic
1032247531 7:130225566-130225588 AGCTGGGACTACAGGCGCCCGGG - Intergenic
1033284911 7:140033082-140033104 AGCTGGGACTACAGGCGCACAGG + Intronic
1033824995 7:145178687-145178709 CACTGGGCTTACAGGCAAATGGG - Intergenic
1034658849 7:152751665-152751687 AAATGGGACTCCAGGCAATCTGG - Intergenic
1034938185 7:155213172-155213194 AGCTGGGACTACAGGTGTACAGG - Intergenic
1036467505 8:9014472-9014494 AGCTGGGATTACAGGCACCCAGG + Intronic
1037933135 8:22895950-22895972 AACTGGGAGCACAGGCAGAGAGG - Intronic
1038702354 8:29860561-29860583 TGCTGGGATTACAGGCAATCTGG - Intergenic
1038804439 8:30777566-30777588 AGCTGGGACCACAGGCATGCAGG - Intronic
1039825092 8:41166252-41166274 AGCTGGGACTACAGGCAGACAGG + Intergenic
1040600821 8:48882546-48882568 AGCTGGGACCACAGGCATATTGG + Intergenic
1041236936 8:55812553-55812575 ACCTGGGACTACAGGATTACAGG - Intronic
1042525293 8:69758316-69758338 AGCTGGGACTACAGGCGCAGTGG + Intronic
1043176653 8:77029858-77029880 AACTGAGCAAACAGGCAAACTGG - Intergenic
1043499240 8:80836630-80836652 AGCTGGGACTACAGGCATGGTGG + Intronic
1043572133 8:81616835-81616857 AGCTGGGACTACAGGCACGCCGG - Intergenic
1044560048 8:93603987-93604009 TACTGGGATTACAGGCATACAGG + Intergenic
1046080760 8:109367769-109367791 AGCTAGGACTACAGGCAGGCAGG - Intronic
1047533629 8:125699310-125699332 AGCTGGGATTACAGGCACATGGG + Intergenic
1047740508 8:127802846-127802868 AAATGGGACCACAGCCAACCAGG + Intergenic
1048918305 8:139204777-139204799 AGCTGGGACCACAGCCACACAGG + Intergenic
1050468433 9:5958518-5958540 AGCTGGGACCACAGGCGAGCTGG - Intronic
1051395226 9:16613211-16613233 AACTGGCACAATAGGCATACAGG - Intronic
1053664546 9:40308308-40308330 AAGTGGGACCACAGGCACAATGG - Intronic
1054520068 9:66067976-66067998 AAGTGGGACCACAGGCACAATGG + Intergenic
1057042703 9:91858967-91858989 ACCGGGGACACCAGGCAAACAGG + Intronic
1058817101 9:108694543-108694565 AGCTGGGACTACAGGCACACAGG - Intergenic
1059181809 9:112222059-112222081 AGCTGGGACTACAGGCGCACAGG + Exonic
1060551536 9:124487761-124487783 AGCTGGGGCTCCAGGGAAACTGG - Intronic
1060603531 9:124894502-124894524 AGCTGGAACTATAGGCACACAGG + Intronic
1060805582 9:126573951-126573973 AGCTGGGACTACAGGCGCACAGG + Intergenic
1060868612 9:127021119-127021141 AACTGGAACTATAGGCAGATGGG - Intronic
1061121058 9:128642637-128642659 AGCTGGGACTACAGGCACCCAGG - Intronic
1061292298 9:129657767-129657789 AGCTGGGATTACAGGCAGACAGG - Intergenic
1061698033 9:132392570-132392592 AACGGGGACTTCAGGCTAAGGGG - Intronic
1062148338 9:135003792-135003814 AGCTGGGATTACAGGCTCACAGG + Intergenic
1062511022 9:136906172-136906194 AGCTGGGACTATAGGAATACAGG - Intronic
1062567822 9:137171096-137171118 AGCTGGGACTCCACGTAAACCGG + Exonic
1062662217 9:137643470-137643492 AGCTGGGACTACAGGACTACAGG + Intronic
1186978085 X:14929726-14929748 GATTGGGCCTACAGGCACACAGG - Intergenic
1187463959 X:19512604-19512626 AGCTGGGACCACAGGCACATGGG + Intronic
1188058897 X:25576350-25576372 AACAGGGATTTCAGGGAAACAGG - Intergenic
1188428034 X:30072324-30072346 AGCTGGGACTATAGGCACAGAGG - Intergenic
1190094180 X:47465673-47465695 AGCTGGGACTACAGGCACATGGG - Intronic
1190810342 X:53877218-53877240 ACCTGGGAATACAGCTAAACAGG - Intergenic
1191852529 X:65596187-65596209 AACTGGGACTGAATGGAAACTGG + Intronic
1192399818 X:70823886-70823908 AGCCGGGACTACAGGCATGCGGG - Intronic
1194365760 X:93011599-93011621 AAATGGGACTTCAGGAAGACTGG - Intergenic
1194909796 X:99627998-99628020 AACTAGGAATACAGCTAAACAGG + Intergenic
1196540938 X:116907191-116907213 AACTGTGACAAGAGGCAAAGAGG - Intergenic
1196732769 X:118957825-118957847 AGCTGGGATTACAGGCTTACAGG - Intergenic
1197454706 X:126664844-126664866 AGCTGGGACCACAGGCTAATGGG + Intergenic
1198871909 X:141185111-141185133 AGCTGGGATTACAGGCACCCAGG + Intergenic
1199707318 X:150439814-150439836 AGCTGGGATTACAGGCACCCAGG - Intronic
1200673979 Y:6127849-6127871 AAATGGGACTTCAGGAAGACTGG - Intergenic