ID: 1107524317

View in Genome Browser
Species Human (GRCh38)
Location 13:41214709-41214731
Sequence AGGGAAAGCACAGCAATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 1, 2: 11, 3: 45, 4: 341}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107524317_1107524330 22 Left 1107524317 13:41214709-41214731 CCCAAAATTGCTGTGCTTTCCCT 0: 1
1: 1
2: 11
3: 45
4: 341
Right 1107524330 13:41214754-41214776 TGCTGCTAGGGGAACGGGGAAGG 0: 1
1: 0
2: 4
3: 48
4: 379
1107524317_1107524328 17 Left 1107524317 13:41214709-41214731 CCCAAAATTGCTGTGCTTTCCCT 0: 1
1: 1
2: 11
3: 45
4: 341
Right 1107524328 13:41214749-41214771 CCTGCTGCTGCTAGGGGAACGGG 0: 1
1: 0
2: 2
3: 27
4: 326
1107524317_1107524326 16 Left 1107524317 13:41214709-41214731 CCCAAAATTGCTGTGCTTTCCCT 0: 1
1: 1
2: 11
3: 45
4: 341
Right 1107524326 13:41214748-41214770 ACCTGCTGCTGCTAGGGGAACGG 0: 1
1: 0
2: 2
3: 31
4: 277
1107524317_1107524325 11 Left 1107524317 13:41214709-41214731 CCCAAAATTGCTGTGCTTTCCCT 0: 1
1: 1
2: 11
3: 45
4: 341
Right 1107524325 13:41214743-41214765 ACAGCACCTGCTGCTGCTAGGGG 0: 1
1: 0
2: 0
3: 24
4: 248
1107524317_1107524329 18 Left 1107524317 13:41214709-41214731 CCCAAAATTGCTGTGCTTTCCCT 0: 1
1: 1
2: 11
3: 45
4: 341
Right 1107524329 13:41214750-41214772 CTGCTGCTGCTAGGGGAACGGGG 0: 1
1: 0
2: 1
3: 19
4: 230
1107524317_1107524323 9 Left 1107524317 13:41214709-41214731 CCCAAAATTGCTGTGCTTTCCCT 0: 1
1: 1
2: 11
3: 45
4: 341
Right 1107524323 13:41214741-41214763 GCACAGCACCTGCTGCTGCTAGG 0: 1
1: 1
2: 3
3: 56
4: 544
1107524317_1107524324 10 Left 1107524317 13:41214709-41214731 CCCAAAATTGCTGTGCTTTCCCT 0: 1
1: 1
2: 11
3: 45
4: 341
Right 1107524324 13:41214742-41214764 CACAGCACCTGCTGCTGCTAGGG 0: 1
1: 0
2: 2
3: 32
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107524317 Original CRISPR AGGGAAAGCACAGCAATTTT GGG (reversed) Intergenic
900979374 1:6037613-6037635 ATCGAAAGCACAGCATCTTTAGG + Intronic
903986031 1:27229272-27229294 ATGGGAAAGACAGCAATTTTGGG - Intergenic
904738930 1:32656874-32656896 AGGGAAAGCAAACCATTGTTGGG - Intronic
905660012 1:39714610-39714632 AGGGAAGGCATAGTAATTTTGGG - Intronic
907117903 1:51985983-51986005 ACGAAAACCACAACAATTTTAGG + Intronic
907167388 1:52425920-52425942 CAGGAAAGCACATCAAGTTTGGG + Intronic
908429112 1:64038461-64038483 AAGGAAAGCAGAGCTATTCTAGG - Intronic
909781500 1:79553585-79553607 GGGAAAAGCATAACAATTTTTGG + Intergenic
910086429 1:83408302-83408324 AATGAAAGCAAAGCAAATTTGGG - Intergenic
912201010 1:107457829-107457851 AGAAAAAGCACATAAATTTTGGG + Intronic
912205737 1:107507160-107507182 AAGCAAAGCACAGTAATATTAGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913247895 1:116886467-116886489 AAGGAAAGCACACCACATTTAGG + Intergenic
913249809 1:116903674-116903696 AGGAAAAGCACAACTATTTGTGG + Intergenic
915175198 1:154008737-154008759 AAGAAAAGCAAAGTAATTTTTGG - Intronic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917070281 1:171142750-171142772 TGGGAAACCACTGCAATATTGGG + Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917623619 1:176823527-176823549 TGGTAAATCACTGCAATTTTAGG - Intronic
918259355 1:182781665-182781687 AGGGTTAGAACAGCACTTTTGGG - Intergenic
918619035 1:186581377-186581399 AAGGAAAGCACAGAAGTTTTGGG - Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919262521 1:195215819-195215841 AGGGAGAGCACAGATAATTTAGG - Intergenic
919613205 1:199772460-199772482 AGAGAAAGCAAAGCAGTTTGAGG - Intergenic
921769648 1:219021483-219021505 AGGAAAAGTTCAGTAATTTTGGG + Intergenic
921998133 1:221444044-221444066 AGGAAAATCAAAGCAATTTTCGG + Intergenic
922015099 1:221637303-221637325 AAGGAAAGCACAGTAAGTTTTGG + Intergenic
922288928 1:224194365-224194387 AGGGAAAGCAAAGTATTTTGGGG - Intergenic
922595858 1:226812438-226812460 AGAGAAAGGACAGCAGGTTTAGG - Intergenic
923253099 1:232195130-232195152 TGGGAAACCACAGAAATCTTAGG - Intergenic
923645757 1:235818972-235818994 AGGGGGAGAACAGCAATCTTGGG - Intronic
924008133 1:239634843-239634865 GGGGATAGCCTAGCAATTTTTGG + Intronic
924211742 1:241775713-241775735 AAGGAAAGCAAAGAAAATTTAGG - Intronic
1063354324 10:5383894-5383916 AGGGAATACACATGAATTTTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066526660 10:36287311-36287333 AGTGGAAGTACAGCATTTTTTGG - Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1069187353 10:65441294-65441316 AGGAAAAGTACAGCTATTATTGG - Intergenic
1069336350 10:67356045-67356067 AGGGAAAACCCAGGAACTTTGGG - Intronic
1071252965 10:83839660-83839682 AAGGAAAGCCCAGCCATTTGTGG - Intergenic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1073870789 10:107861868-107861890 AGGGAGAGCTCAGCAGCTTTGGG - Intergenic
1074265676 10:111900834-111900856 AGGGTTAGCACAGTCATTTTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075128110 10:119717049-119717071 AGGGAAAGAACAGCACTATTAGG + Intergenic
1075941949 10:126397266-126397288 AGAGAAGGCACAGGAATTTCTGG + Intergenic
1077143475 11:1034946-1034968 AGGGGAAGCACAGCCAGTCTGGG - Intronic
1078294442 11:10053386-10053408 AGGAAAAACAAAACAATTTTGGG - Intronic
1078766379 11:14302527-14302549 AGGGCAAGAACAGCTAGTTTAGG + Intronic
1079192993 11:18297458-18297480 ATGGAAAGGACAACAAATTTGGG + Intronic
1080287107 11:30628056-30628078 AGAGAAAGCACAACATTTCTTGG + Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082176998 11:49072098-49072120 AGAGAAAGCTCAGAAACTTTTGG - Intergenic
1082802488 11:57425189-57425211 AGGAAGAGAAGAGCAATTTTAGG + Intronic
1082925699 11:58544604-58544626 AGGGGTATCACAGCAAGTTTGGG - Intronic
1083512887 11:63227935-63227957 AGGAAGAGCACAGCAATTACGGG - Intronic
1083699089 11:64462738-64462760 AGGGAAAGGATAGTAACTTTTGG + Intergenic
1084045785 11:66567109-66567131 AGGGAGAGCTCAGGAATTATGGG + Intronic
1085473216 11:76771403-76771425 ATGGAAAGCACTGCCATGTTTGG + Intergenic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086688711 11:89763761-89763783 AGAGAAAGCTCAGAAACTTTAGG + Intergenic
1086717147 11:90076196-90076218 AGAGAAAGCTCAGAAACTTTAGG - Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087549713 11:99633725-99633747 AGGAAAAGTGCAGCAATATTAGG + Intronic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088815652 11:113419079-113419101 GGGGAAATCACTGCACTTTTTGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090760090 11:129828886-129828908 AAGCAAAGAACAGCAACTTTAGG + Intronic
1093134476 12:15433982-15434004 AGTGAAAGGACAGAAAATTTTGG - Intronic
1093581730 12:20791194-20791216 AGGGAAAGAACAGCAACTGGGGG - Intergenic
1094015624 12:25860063-25860085 AGGGAAACCACAGCACATTGAGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1098463758 12:70763671-70763693 AGCAGAAGCACAGCAATTTAAGG + Intronic
1098843385 12:75505071-75505093 AGATAAAGCAGAGCTATTTTGGG - Intronic
1100355543 12:93825684-93825706 AGGAGAAGCACAGCAGTATTAGG + Intronic
1101472828 12:105014758-105014780 AGGGACATCACAGCAAAATTTGG + Intronic
1102753175 12:115313955-115313977 AGGTAAAGCACTGCAGGTTTAGG - Intergenic
1103124989 12:118414060-118414082 ATGGAAAGCACAGCAATCTTGGG - Intronic
1103896890 12:124278912-124278934 AAGGAAAATACAGCAATTTAGGG + Intronic
1106399718 13:29418100-29418122 TGGTAAACCACAGCAATGTTTGG + Intronic
1107078887 13:36353119-36353141 AGACAAAACACAGCATTTTTTGG - Intronic
1107524317 13:41214709-41214731 AGGGAAAGCACAGCAATTTTGGG - Intergenic
1108381309 13:49857239-49857261 TGGGAAAGCCCAACAATTTGGGG - Intergenic
1108955566 13:56152811-56152833 AGTGAAAGGACAGTAATTTATGG - Intergenic
1109203828 13:59459912-59459934 GGGGAAGGCACAGCAATTGCAGG + Intergenic
1110426189 13:75370015-75370037 AGGAAAACCATTGCAATTTTAGG + Intronic
1110856177 13:80299040-80299062 AGGAAAAGCTCAGAAAGTTTTGG + Intergenic
1112261102 13:97879300-97879322 AGGGAAAGCATAGCTATTTAGGG - Intergenic
1112560693 13:100511073-100511095 AGGAAAAGCAGAGCAAGGTTAGG - Intronic
1113602830 13:111582862-111582884 AGGGAAAGCACAGCAGCTGGGGG - Intergenic
1113649693 13:112026902-112026924 AGAGAAACCACAGCCATTTTGGG + Intergenic
1114306306 14:21426271-21426293 AGTGAAAGCAAAGAAAATTTAGG + Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116489938 14:45493316-45493338 AGGGAAAGCACAGCAATTTGAGG - Intergenic
1116504906 14:45665908-45665930 AGGAAGAACACAGCAATTGTGGG - Intergenic
1117284155 14:54270267-54270289 AGGGAAAGGAAAGCTAATTTAGG - Intergenic
1118574251 14:67225859-67225881 AGTGGAAGCAATGCAATTTTAGG + Intronic
1119260034 14:73232519-73232541 AGGGAAAGAACAGGAATTCCTGG - Intergenic
1119474083 14:74917228-74917250 AGGTAAAACAAAACAATTTTGGG - Intronic
1119757186 14:77127455-77127477 AGGGAAGGCTCAGCAAATCTTGG + Intronic
1120308620 14:82802258-82802280 AGGGAAACCAAAACATTTTTGGG + Intergenic
1123047415 14:105525899-105525921 AGGGAAGTCACAGCAGTTCTGGG + Intergenic
1124999700 15:34756533-34756555 TGGGAAAACACACCAAGTTTGGG - Intergenic
1125394160 15:39228630-39228652 AGGGAAAGCACAGAACCCTTAGG + Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127209687 15:56760375-56760397 TGGGAAACCAGAGCATTTTTAGG + Intronic
1127219302 15:56860985-56861007 AGAGAAAACACAGCAAGTCTTGG + Intronic
1127956184 15:63855784-63855806 AGTGAAATCACTGCAATCTTTGG - Intergenic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128042063 15:64583860-64583882 AGGAAAAGATCAGCAATTTGTGG - Intronic
1128819056 15:70635775-70635797 CTGGAAAGAACAGCAAATTTGGG + Intergenic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130747046 15:86665895-86665917 AGAGAAAGCACAAAAATCTTGGG - Intronic
1131171523 15:90182235-90182257 ATGGAAAGCACAGCTAAATTAGG - Intronic
1131287965 15:91077972-91077994 AGGCAAAGCACAGAGTTTTTAGG - Intergenic
1131389581 15:92035852-92035874 AGGGAAAAGACAGAAGTTTTGGG + Intronic
1131666844 15:94580122-94580144 AGAGACAGCACATCAATTTGAGG - Intergenic
1133163968 16:3933481-3933503 AATGAAAGTACATCAATTTTCGG + Intergenic
1133794268 16:9033543-9033565 AGGGAAACCAAAGGAATTTCAGG - Intergenic
1134635629 16:15789778-15789800 AGAGAAAGGAGAGAAATTTTTGG + Intronic
1136077585 16:27827610-27827632 AGGAAAAGCTCAGAAATTTCTGG + Intronic
1136407439 16:30056470-30056492 ATGTAAAACACAGCAACTTTGGG - Intronic
1136986790 16:35113638-35113660 AGGGAAGGCACAGCAAACCTGGG + Intergenic
1137839009 16:51622573-51622595 AGGGAAAGCACACTGCTTTTAGG + Intergenic
1141727977 16:85802304-85802326 AGGAAAAGCACAGCAAGGTGAGG - Intronic
1143062726 17:4216195-4216217 AGGGAAAACACAGCAATAGGTGG + Intronic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1146684809 17:34834508-34834530 AGGCAATGGACAGAAATTTTAGG + Intergenic
1148070447 17:44905733-44905755 AGGGAAAGGACACCAAGTCTTGG + Intronic
1148129095 17:45252334-45252356 AGGTAGAGCACAGAATTTTTAGG + Intergenic
1149570684 17:57670204-57670226 AGGGACAACACAGAAATTATTGG + Intronic
1150669642 17:67181296-67181318 AGGGAAAGCTCTGTCATTTTAGG - Intronic
1152537590 17:80959674-80959696 AAGGAAAGCAAAGCACATTTTGG - Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1154980008 18:21495967-21495989 AGAGAACACCCAGCAATTTTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1159542861 18:69801737-69801759 AGAGAAAGAACAGTAACTTTTGG - Intronic
1159775443 18:72598856-72598878 AGAGAGAGTGCAGCAATTTTGGG - Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160548193 18:79675952-79675974 AGGGGAAGGACAGCAGTTGTAGG - Intergenic
1162866309 19:13550095-13550117 AAGGAAATAACAGCCATTTTGGG + Intronic
1164946580 19:32298809-32298831 AGGGATTGCACTGAAATTTTAGG + Intergenic
925697131 2:6592495-6592517 AGGTGAAGCACAGCAGTTTGAGG + Intergenic
926109330 2:10172037-10172059 AGGGGAAGCACAGCTCCTTTGGG + Intronic
926299276 2:11590472-11590494 AGGGAAGGAACAGCAAGTGTGGG - Intronic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926961524 2:18363351-18363373 ATGCACAGGACAGCAATTTTAGG - Intergenic
927277047 2:21271235-21271257 TGGGATTGCACAGCAACTTTGGG + Intergenic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928416973 2:31102792-31102814 ATTGAAAACACAGAAATTTTAGG - Intronic
928645759 2:33350876-33350898 AGGAAAAGAACAGCATTTTGTGG - Intronic
928725060 2:34162834-34162856 AGGAAAAACACAGAAATATTGGG - Intergenic
930042168 2:47134332-47134354 AGGGAGAACACAGGATTTTTAGG - Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931760347 2:65411314-65411336 AGGGATATCACAGCAATGTTAGG - Intronic
931990579 2:67785966-67785988 ACGAAAAGCAGAGCTATTTTAGG - Intergenic
933133981 2:78708273-78708295 AGGCAAAGCTGAACAATTTTAGG + Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
939802485 2:146727491-146727513 AAAGAAATCACAGCAATATTTGG + Intergenic
939808169 2:146800481-146800503 GTGGAAAACACAGCATTTTTGGG + Intergenic
940937684 2:159517316-159517338 AGTGAAAAAACAGCAATTTGGGG - Intronic
941188431 2:162345207-162345229 AAGGAAAGCAAATCAATTTTAGG - Intronic
941528352 2:166633025-166633047 AGGGAGAGCCCAGCAATTCTGGG - Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942265795 2:174224428-174224450 AGGGAAAGTAAAACAATTCTAGG + Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942391893 2:175503362-175503384 AGGGACAGCATAGCAATTGGTGG - Intergenic
944046046 2:195413426-195413448 AGGAAGAGCACAGCAATCGTGGG + Intergenic
945058206 2:205886228-205886250 TGGGAGAGCACAGCATTTTCTGG - Intergenic
945893101 2:215451128-215451150 AGGGAAAGCAGAGCACAGTTGGG + Intergenic
945919577 2:215742153-215742175 AGGGAAAGTACTGGAAGTTTGGG - Intergenic
947098982 2:226598524-226598546 AGGGTATGCAAAGCAATATTTGG - Intergenic
948477260 2:238227983-238228005 AGGGAAAGCCCAGCAAAAGTGGG + Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169364523 20:4981050-4981072 AGGAAATTCACAGCTATTTTAGG - Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170683179 20:18544958-18544980 TGGGAAAGGAGAGCAACTTTAGG + Intronic
1170933887 20:20793315-20793337 CAGGTAAGCACAGCATTTTTGGG - Intergenic
1171297503 20:24031413-24031435 AGGGAAAGCAGAGCTATTTCTGG + Intergenic
1174158773 20:48535495-48535517 AGGGAAAGGAGAGTAACTTTTGG + Intergenic
1175325443 20:58124094-58124116 AGGTAAAGCACAGGGAATTTAGG + Intergenic
1176390024 21:6158559-6158581 AGGGAAAGGGTAGCACTTTTAGG + Intergenic
1177212768 21:18091042-18091064 AGGGAAAGCACAGCACCTGGGGG + Intronic
1177542632 21:22515325-22515347 AGACAAAGGAAAGCAATTTTGGG + Intergenic
1177620026 21:23577592-23577614 GGTGAAAGCAAAGCAGTTTTTGG - Intergenic
1178333400 21:31721403-31721425 ACGGATATCACAGTAATTTTCGG + Intronic
1178551244 21:33541791-33541813 AGAGAAAGTACACCAATTTAGGG + Intronic
1179529298 21:42008099-42008121 AGGGAAAGAGAAGAAATTTTAGG - Intronic
1179733442 21:43379681-43379703 AGGGAAAGGGTAGCACTTTTAGG - Intergenic
1180592980 22:16956436-16956458 AGGGGAAGCACAGCAATCTCTGG - Intergenic
1184756032 22:46516476-46516498 AGGGATAGCACACCGGTTTTGGG + Intronic
949962388 3:9323194-9323216 AGGGACAGCACAGGGAGTTTTGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
954488447 3:50877420-50877442 AGGGAAAGCACACAGATTTCTGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
959409150 3:105998399-105998421 AGGGACAGCACAGCAACTCTGGG - Intergenic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960564811 3:119122244-119122266 AGAGAGAACACAGCAATTTGGGG + Intronic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961349431 3:126290289-126290311 AGGGAAAGCACAGGGATGCTTGG + Intergenic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
961778955 3:129310261-129310283 GGGAAAAGCACAGCAATTGCAGG - Intergenic
963011738 3:140776310-140776332 AAGGGAAGCAGAGCATTTTTTGG - Intergenic
963386829 3:144607632-144607654 GAGGAAATCACAGCAAATTTTGG + Intergenic
963584952 3:147175495-147175517 AGTGAAAACATAGCAATGTTTGG + Intergenic
964179222 3:153864281-153864303 AAGGAAAGCACAGTGATTTAGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
967201389 3:187075453-187075475 AGGGAAAGCTCTCCAAATTTGGG + Intronic
967416333 3:189222833-189222855 AGGGATAGCACCGGAAATTTGGG - Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968716713 4:2165437-2165459 AGGCAGAGCACAGGATTTTTAGG + Intronic
970316852 4:14836160-14836182 AAGTAAAGCACAGAAATATTTGG + Intergenic
971060061 4:22957963-22957985 AGAGAAAGGTCAGCAATTCTTGG + Intergenic
972257384 4:37371938-37371960 AGGGAATGCAAATAAATTTTAGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972304037 4:37814475-37814497 TGGGAAACCACAGCAAATTGTGG - Intergenic
972668310 4:41189459-41189481 AGGGAAAGCACACAGATCTTAGG - Intronic
972747384 4:41950152-41950174 TGGGGAAGCAGAGAAATTTTAGG + Intronic
973169468 4:47121265-47121287 AAGAAAAGCACAGCAATTGTGGG - Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977414318 4:96712159-96712181 AGGGAAAGCAAAGCAATGCTTGG + Intergenic
977521740 4:98093745-98093767 AGGCAAAGCACAGCAATTGGGGG + Intronic
978233968 4:106434968-106434990 AGGCAAAGGACAGTAATTTGGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
979990002 4:127364169-127364191 AAGAAAAGCACATCAATTTTAGG - Intergenic
980446848 4:132921187-132921209 AGGGAAAGCAAAGCCCTTATAGG + Intergenic
980705819 4:136492330-136492352 AGGGAAAGCTGATCAATTTGGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981786457 4:148484853-148484875 GATGAAAGCACAGCAATTATTGG + Intergenic
982880741 4:160711690-160711712 AGAGAAACCACTGCAATTTCAGG + Intergenic
982978546 4:162100530-162100552 AGGCAAAGCACAGATATTTAGGG + Intronic
983037123 4:162880583-162880605 AATGAAAGTACAGCATTTTTTGG + Intergenic
983306011 4:165988101-165988123 AGTCAAAGCACAGTAACTTTAGG - Intronic
983400247 4:167254613-167254635 AAGGAAAGCACAGAACTTATTGG + Intergenic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
990258073 5:53992207-53992229 GAGGAAAACACAGCAATGTTTGG - Intronic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992261697 5:74977220-74977242 AGTGATAGAACAGCCATTTTGGG + Intergenic
992319335 5:75595597-75595619 AGGCAAAACACAGGAATTTTAGG + Intronic
992939249 5:81747081-81747103 GGAGAAGGCACAGAAATTTTAGG - Intronic
994114075 5:96041994-96042016 AGGGAAATCAAAGTAATTTTCGG + Intergenic
995173873 5:109150429-109150451 AGGGGAAGCTAAACAATTTTTGG - Intronic
995401200 5:111743875-111743897 GTGGATAGCACAGTAATTTTTGG - Intronic
995557426 5:113344123-113344145 AGGGAAAGCACAGCAAGTGGGGG + Intronic
995836344 5:116403258-116403280 AGTGAAAGCACAGCAATGGTGGG - Intronic
997155876 5:131556674-131556696 TGAGAAAGAAGAGCAATTTTAGG - Intronic
997243479 5:132325951-132325973 AGGGAAAGGGTAGTAATTTTTGG - Intronic
997334622 5:133098145-133098167 AGGGAAAACATAGCAGTATTTGG + Intronic
998751352 5:145324896-145324918 AGGGAAAGCAAAGTATTTGTAGG + Intergenic
1000733692 5:164870621-164870643 TTGGAAAGGACAGCAATGTTTGG - Intergenic
1003844070 6:10154569-10154591 AAAGAAAGAAAAGCAATTTTAGG - Intronic
1003991096 6:11487353-11487375 TGAGAAAGTACAGAAATTTTAGG - Intergenic
1008648813 6:53543666-53543688 AGGGAAGGCACAAAAAGTTTTGG + Intronic
1008775769 6:55035745-55035767 AGGGAGAGCAGAGGAATTTTTGG - Intergenic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009696435 6:67110376-67110398 AGGGAATGAACAGGAAATTTAGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010239722 6:73603718-73603740 AGTAAAGGGACAGCAATTTTAGG - Intronic
1010255291 6:73750355-73750377 AGAGAAAGAACAGCCAGTTTTGG + Intronic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011522017 6:88218064-88218086 CTGGAAAGCACAGCAATTGCAGG + Intergenic
1012783124 6:103589062-103589084 AGGGAAAGCGCAGCAATAGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1012992737 6:105942716-105942738 AGGGCAGGCACAGCAAATTTGGG + Intergenic
1014039109 6:116803697-116803719 AAAGAAAGCACAGCATCTTTAGG - Intronic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1014496833 6:122135283-122135305 GGGCTAAGCACAGAAATTTTGGG + Intergenic
1014840902 6:126219007-126219029 AGGGAAAGCATAACAATTGTGGG - Intergenic
1015307709 6:131728460-131728482 AGTGAAAGGACAGGAACTTTTGG - Intronic
1015907173 6:138129277-138129299 AGGGAGAGCGCAGTAGTTTTGGG + Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017239838 6:152155784-152155806 TGGGAAGCCACAGCTATTTTTGG + Intronic
1017408627 6:154146704-154146726 AGGGGAAGCACAGCATATTAAGG - Intronic
1017670632 6:156766381-156766403 ATGGAAGTCATAGCAATTTTAGG - Intergenic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021431412 7:20562626-20562648 CAGGAAAGCACAGCAAGGTTTGG - Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022642623 7:32202648-32202670 TGGGCAAGCAGAGAAATTTTGGG + Intronic
1024566110 7:50682202-50682224 TGGCTAAACACAGCAATTTTAGG + Intronic
1024850374 7:53708010-53708032 AGAAAAGGCACAGCAAGTTTTGG - Intergenic
1025639084 7:63350449-63350471 AGGGAAGGCACAGCAAACTCGGG - Intergenic
1025643615 7:63397643-63397665 AGGGAAGGCACAGCAAACTCGGG + Intergenic
1027303312 7:76864779-76864801 AATGAAAGCAAAGCAAATTTGGG - Intergenic
1027636126 7:80677004-80677026 AGAAAAAGCACAGGAATTTAAGG - Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028850590 7:95533175-95533197 AGGGAGAGGCCTGCAATTTTAGG + Intronic
1029798106 7:102916489-102916511 AGGCAAAGCTCAGGAATCTTGGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1030983463 7:116212263-116212285 AGGTGAAGCACAGGATTTTTAGG + Intronic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031869588 7:127077408-127077430 CTGGAAATCACAGCAATTTGGGG - Intronic
1032971909 7:137174567-137174589 AGGGAGAGCACAGAAATGTGAGG + Intergenic
1032989481 7:137376318-137376340 AGAGAAAGAACAGTAATTTTAGG - Intergenic
1034033846 7:147799306-147799328 GGGGAAAGCACACTAGTTTTAGG + Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034395970 7:150825127-150825149 AAAGAAAGCACAGCATGTTTGGG - Intronic
1034941536 7:155233841-155233863 AGGGAATGCACAGCACATTAAGG + Intergenic
1036086595 8:5619223-5619245 AGTGAAAGCAGAGACATTTTGGG - Intergenic
1036522561 8:9505496-9505518 AGGGAGAGGCCAGTAATTTTAGG - Intergenic
1038983783 8:32787248-32787270 TAGGAAAAGACAGCAATTTTGGG - Intergenic
1041456718 8:58068384-58068406 AGGGAAAGCACAGAAACTCATGG - Intronic
1041494157 8:58467779-58467801 AGAGAAAGCATAGCTACTTTTGG - Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1042181992 8:66099386-66099408 AGAGAAAGCATAACCATTTTGGG + Intronic
1042723405 8:71847671-71847693 TGGAAAAGCACTGCAATTTTAGG - Intronic
1042899497 8:73708660-73708682 ATGGAAAGCACACCATATTTGGG + Intronic
1043066871 8:75583680-75583702 AGGGAGAACACAGGATTTTTAGG + Intergenic
1043178542 8:77053428-77053450 TGGAAAATCACAGCAATTTCTGG - Intergenic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044468439 8:92535837-92535859 AGGGAAAGAAAAGAAAGTTTGGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047426361 8:124750400-124750422 AGGGAAAGAAGAGCAAATTGTGG - Intergenic
1050051602 9:1607884-1607906 ATGGAAAGAAAAGCAATTTAAGG - Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052014757 9:23451723-23451745 AGGGAAAACAAAGCATTCTTTGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052258900 9:26491793-26491815 AGGGAGAACACAGCAGTTGTGGG - Intergenic
1052550824 9:29946380-29946402 ATGGAATGCAGAGCATTTTTGGG - Intergenic
1052897653 9:33762784-33762806 AAGCAAAGAACAGCAACTTTAGG + Intronic
1053314406 9:37039262-37039284 AGGGAAAGCACCCCAATCCTGGG - Intergenic
1053536257 9:38929329-38929351 AAGGAAAGAACCACAATTTTTGG + Intergenic
1053672586 9:40382770-40382792 AAGGAAAGCAGAGAAAATTTAGG - Intergenic
1053922400 9:43009131-43009153 AAGGAAAGCAGAGAAAATTTAGG - Intergenic
1054383697 9:64522802-64522824 AAGGAAAGCAGAGAAAATTTAGG - Intergenic
1054512039 9:65993539-65993561 AAGGAAAGCAGAGAAAATTTAGG + Intergenic
1054629878 9:67434619-67434641 AAGGAAAGAACCACAATTTTTGG - Intergenic
1055220204 9:73920062-73920084 AGGGAAAGCACAGCAAATACAGG - Intergenic
1055546879 9:77386404-77386426 AGGCCAAGCACAGTAAATTTGGG - Intronic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058225740 9:102360038-102360060 AGTGAAAGCAAAGAAATTCTGGG - Intergenic
1058698028 9:107576285-107576307 AGGAAAAGCTCAACAATTTAGGG + Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1058838500 9:108881771-108881793 AGGAAAAACACAATAATTTTAGG + Intronic
1059181764 9:112221544-112221566 AGGGAAAAAAAAGCAAGTTTTGG + Exonic
1059775768 9:117473939-117473961 AGGTAAAACACAACATTTTTAGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1059921137 9:119161146-119161168 AGGGAAAGCACAGTCATCTCTGG + Intronic
1060132754 9:121120607-121120629 AGGGGAAGCAAAGGAGTTTTGGG - Intronic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060972806 9:127748457-127748479 AGGGAAACCACAGAAACTTGGGG + Intronic
1062677130 9:137753158-137753180 GGGGAAAGCTCGGCAAGTTTGGG + Intronic
1185832988 X:3319314-3319336 AGGCAAAGGACAGCAAATGTGGG + Intronic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188943167 X:36264556-36264578 AGGAGAAGCATAGCAATTGTGGG - Intronic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188973266 X:36642555-36642577 AGGAAAAGCAAAGCAACTGTGGG - Intergenic
1189155909 X:38756585-38756607 AGGGAAAGTAAAGGAAATTTTGG + Intergenic
1189248517 X:39581782-39581804 AGAGAAAGGAAAGAAATTTTGGG + Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193150401 X:78118661-78118683 AGGGACAGTACAGTAATTTGGGG + Intronic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1193856825 X:86612604-86612626 AGGGAAAGCATAGCTATTATGGG - Intronic
1193912137 X:87318258-87318280 AGCGAAAGAACAGCAATTGTGGG - Intergenic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194936881 X:99960874-99960896 AAGGATAGCAAAGAAATTTTTGG - Intergenic
1194999372 X:100627282-100627304 AGGCAACCCACATCAATTTTGGG + Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195823204 X:108969769-108969791 AGAGAAAGTGCAGCAATTGTGGG + Intergenic
1195993610 X:110708952-110708974 TGGGGAAGCAAAGCAAATTTGGG - Intronic
1197151897 X:123229226-123229248 ATGGAAAGCACATCAATCTGGGG - Intronic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197435761 X:126425959-126425981 AGGGAGAAAACAGCAATTATGGG - Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197489386 X:127099386-127099408 TTGGAAAGCACAGTAATTTAAGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198486564 X:137093116-137093138 AGGGAATTCACAGAAATCTTGGG + Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1201858879 Y:18573521-18573543 ATGGTAAGCACAGCATTTGTAGG - Intronic
1201874443 Y:18746860-18746882 ATGGTAAGCACAGCATTTGTAGG + Intronic