ID: 1107526956

View in Genome Browser
Species Human (GRCh38)
Location 13:41242436-41242458
Sequence ACTATTTTTCTCTTGAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 292}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107526956_1107526962 5 Left 1107526956 13:41242436-41242458 CCCTGGTTCAAGAGAAAAATAGT 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1107526962 13:41242464-41242486 AAAATCACAATTTGGGGGCTAGG 0: 1
1: 1
2: 5
3: 41
4: 453
1107526956_1107526965 29 Left 1107526956 13:41242436-41242458 CCCTGGTTCAAGAGAAAAATAGT 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1107526965 13:41242488-41242510 TTGTCCACTACTACTGGATTTGG 0: 1
1: 0
2: 0
3: 6
4: 65
1107526956_1107526960 -1 Left 1107526956 13:41242436-41242458 CCCTGGTTCAAGAGAAAAATAGT 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1107526960 13:41242458-41242480 TATTTGAAAATCACAATTTGGGG 0: 1
1: 0
2: 6
3: 59
4: 624
1107526956_1107526959 -2 Left 1107526956 13:41242436-41242458 CCCTGGTTCAAGAGAAAAATAGT 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1107526959 13:41242457-41242479 GTATTTGAAAATCACAATTTGGG 0: 1
1: 0
2: 2
3: 61
4: 576
1107526956_1107526964 23 Left 1107526956 13:41242436-41242458 CCCTGGTTCAAGAGAAAAATAGT 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1107526964 13:41242482-41242504 CTAGGGTTGTCCACTACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 55
1107526956_1107526961 0 Left 1107526956 13:41242436-41242458 CCCTGGTTCAAGAGAAAAATAGT 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1107526961 13:41242459-41242481 ATTTGAAAATCACAATTTGGGGG 0: 1
1: 0
2: 4
3: 41
4: 544
1107526956_1107526963 6 Left 1107526956 13:41242436-41242458 CCCTGGTTCAAGAGAAAAATAGT 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1107526963 13:41242465-41242487 AAATCACAATTTGGGGGCTAGGG 0: 1
1: 0
2: 0
3: 19
4: 206
1107526956_1107526958 -3 Left 1107526956 13:41242436-41242458 CCCTGGTTCAAGAGAAAAATAGT 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1107526958 13:41242456-41242478 AGTATTTGAAAATCACAATTTGG 0: 1
1: 1
2: 6
3: 58
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107526956 Original CRISPR ACTATTTTTCTCTTGAACCA GGG (reversed) Intronic