ID: 1107526957

View in Genome Browser
Species Human (GRCh38)
Location 13:41242437-41242459
Sequence TACTATTTTTCTCTTGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 279}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107526957_1107526961 -1 Left 1107526957 13:41242437-41242459 CCTGGTTCAAGAGAAAAATAGTA 0: 1
1: 0
2: 3
3: 18
4: 279
Right 1107526961 13:41242459-41242481 ATTTGAAAATCACAATTTGGGGG 0: 1
1: 0
2: 4
3: 41
4: 544
1107526957_1107526964 22 Left 1107526957 13:41242437-41242459 CCTGGTTCAAGAGAAAAATAGTA 0: 1
1: 0
2: 3
3: 18
4: 279
Right 1107526964 13:41242482-41242504 CTAGGGTTGTCCACTACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 55
1107526957_1107526963 5 Left 1107526957 13:41242437-41242459 CCTGGTTCAAGAGAAAAATAGTA 0: 1
1: 0
2: 3
3: 18
4: 279
Right 1107526963 13:41242465-41242487 AAATCACAATTTGGGGGCTAGGG 0: 1
1: 0
2: 0
3: 19
4: 206
1107526957_1107526958 -4 Left 1107526957 13:41242437-41242459 CCTGGTTCAAGAGAAAAATAGTA 0: 1
1: 0
2: 3
3: 18
4: 279
Right 1107526958 13:41242456-41242478 AGTATTTGAAAATCACAATTTGG 0: 1
1: 1
2: 6
3: 58
4: 505
1107526957_1107526965 28 Left 1107526957 13:41242437-41242459 CCTGGTTCAAGAGAAAAATAGTA 0: 1
1: 0
2: 3
3: 18
4: 279
Right 1107526965 13:41242488-41242510 TTGTCCACTACTACTGGATTTGG 0: 1
1: 0
2: 0
3: 6
4: 65
1107526957_1107526959 -3 Left 1107526957 13:41242437-41242459 CCTGGTTCAAGAGAAAAATAGTA 0: 1
1: 0
2: 3
3: 18
4: 279
Right 1107526959 13:41242457-41242479 GTATTTGAAAATCACAATTTGGG 0: 1
1: 0
2: 2
3: 61
4: 576
1107526957_1107526960 -2 Left 1107526957 13:41242437-41242459 CCTGGTTCAAGAGAAAAATAGTA 0: 1
1: 0
2: 3
3: 18
4: 279
Right 1107526960 13:41242458-41242480 TATTTGAAAATCACAATTTGGGG 0: 1
1: 0
2: 6
3: 59
4: 624
1107526957_1107526962 4 Left 1107526957 13:41242437-41242459 CCTGGTTCAAGAGAAAAATAGTA 0: 1
1: 0
2: 3
3: 18
4: 279
Right 1107526962 13:41242464-41242486 AAAATCACAATTTGGGGGCTAGG 0: 1
1: 1
2: 5
3: 41
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107526957 Original CRISPR TACTATTTTTCTCTTGAACC AGG (reversed) Intronic