ID: 1107526964

View in Genome Browser
Species Human (GRCh38)
Location 13:41242482-41242504
Sequence CTAGGGTTGTCCACTACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107526957_1107526964 22 Left 1107526957 13:41242437-41242459 CCTGGTTCAAGAGAAAAATAGTA 0: 1
1: 0
2: 3
3: 18
4: 279
Right 1107526964 13:41242482-41242504 CTAGGGTTGTCCACTACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 55
1107526956_1107526964 23 Left 1107526956 13:41242436-41242458 CCCTGGTTCAAGAGAAAAATAGT 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1107526964 13:41242482-41242504 CTAGGGTTGTCCACTACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107526964 Original CRISPR CTAGGGTTGTCCACTACTAC TGG Intronic