ID: 1107526964

View in Genome Browser
Species Human (GRCh38)
Location 13:41242482-41242504
Sequence CTAGGGTTGTCCACTACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107526956_1107526964 23 Left 1107526956 13:41242436-41242458 CCCTGGTTCAAGAGAAAAATAGT 0: 1
1: 0
2: 2
3: 31
4: 292
Right 1107526964 13:41242482-41242504 CTAGGGTTGTCCACTACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 55
1107526957_1107526964 22 Left 1107526957 13:41242437-41242459 CCTGGTTCAAGAGAAAAATAGTA 0: 1
1: 0
2: 3
3: 18
4: 279
Right 1107526964 13:41242482-41242504 CTAGGGTTGTCCACTACTACTGG 0: 1
1: 0
2: 1
3: 6
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107526964 Original CRISPR CTAGGGTTGTCCACTACTAC TGG Intronic
906036625 1:42754465-42754487 CTAGTGTTGTCCACTTCCATAGG - Intronic
906773582 1:48507827-48507849 CCAGGGATGCTCACTACTACTGG + Intergenic
908658991 1:66418214-66418236 TTAGGGATGGCCACTACTACAGG - Intergenic
1064222174 10:13450815-13450837 CCAGGTTTGCCCACTTCTACAGG - Intronic
1068025982 10:51644733-51644755 CTAGGGTTGTCCATTGCTACTGG + Intronic
1072725067 10:97807602-97807624 CTAGAGTTGTCCACTGCTGGGGG - Intergenic
1075312488 10:121426320-121426342 CTAGGGTTGTCCCCTAGGACAGG - Intergenic
1077031149 11:468412-468434 CTCGTGTTGTCCAGTTCTACAGG - Intronic
1079622020 11:22566935-22566957 GAAGGGTTGTCCATTACTTCTGG + Intergenic
1084799046 11:71529344-71529366 CTAGGAGTGTTCACTGCTACAGG - Intronic
1090521182 11:127480988-127481010 CTATGGCTGCCCACCACTACTGG - Intergenic
1090538342 11:127671590-127671612 CTAGGTTTGTTCATTATTACTGG - Intergenic
1106713759 13:32366893-32366915 CTAGGGTTACTCACTACTACTGG - Intronic
1107526964 13:41242482-41242504 CTAGGGTTGTCCACTACTACTGG + Intronic
1107699249 13:43031482-43031504 CTAGGCTTGTCCTCTTCTACAGG - Intronic
1109314756 13:60736819-60736841 CTATGGTTGTCCACTTCTCGTGG - Intergenic
1113003553 13:105672469-105672491 CTTGGGGTGTTCACTACTTCTGG - Intergenic
1121036335 14:90706817-90706839 CTAGGGATGTTCACTGCTAATGG + Intronic
1128819666 15:70640357-70640379 CTTAGGTTGTTCACTGCTACTGG - Intergenic
1136041671 16:27584302-27584324 CTAGGGTTGTGCACTTGTCCTGG + Intronic
1150176257 17:63059922-63059944 CTAGACATGTCCACTGCTACTGG + Intronic
1161526680 19:4760227-4760249 CTAGGGTTCCCCACCACCACTGG - Intergenic
1166604929 19:44132916-44132938 CTAGTGTTTTACACCACTACAGG - Exonic
927999866 2:27514101-27514123 CTAGGTATGTTCACTGCTACTGG + Intronic
931845015 2:66194283-66194305 CAAGGGTTGTCCAGTGCCACGGG + Intergenic
939902605 2:147868453-147868475 CAAAGGTTGCCCACTGCTACAGG - Intronic
939977543 2:148736508-148736530 CTAGGGGTGTTCATTACTACTGG + Intronic
941869369 2:170367468-170367490 CTGGGGGTGTGCACAACTACCGG + Intronic
948962623 2:241352677-241352699 GTAGTGTTCTCCACTAATACTGG + Intronic
1172365805 20:34348207-34348229 CTATGGTTGTCCACAACTCCTGG + Intergenic
954492944 3:50924682-50924704 TCAGGGTTGCCCACTGCTACCGG + Intronic
955791892 3:62596663-62596685 CTAGTGTTCTCTAGTACTACAGG - Intronic
956783809 3:72625529-72625551 TTAGGGTTGGCCATTAGTACTGG + Intergenic
960967771 3:123116900-123116922 CTAGGGATGCCCACCTCTACAGG + Intronic
963286124 3:143436149-143436171 CTGGGGGTGTCCACTGGTACCGG + Intronic
965294501 3:166926352-166926374 CTAGACCTGTACACTACTACAGG + Intergenic
970668184 4:18362332-18362354 CTAGGCTTGTTCATTGCTACTGG + Intergenic
972920914 4:43940409-43940431 CTAGGTTTGCTCATTACTACTGG + Intergenic
975966537 4:79979264-79979286 GTAGGGCTTTCCACTACTCCTGG - Intronic
981563929 4:146077998-146078020 CTGGGCTTGTCAACTACTCCCGG + Intergenic
982798705 4:159675205-159675227 CTAGAGTTGTCTACTCTTACTGG + Intergenic
992910122 5:81388441-81388463 TTAGGGTTTTCCACTTCTGCTGG - Intronic
996299168 5:121960930-121960952 CTGGGACTGTCCACTGCTACAGG - Intergenic
997393994 5:133541853-133541875 CTAGGGGTGTACATTGCTACTGG + Intronic
1002675471 5:180908718-180908740 CTAGCGTGGTCCACCTCTACAGG + Exonic
1006779922 6:36625512-36625534 CTAGGGTGGTCCACTTCTTAGGG + Intergenic
1008028178 6:46662740-46662762 CTAGACTTGTCCCCTACTGCAGG + Intronic
1014635593 6:123843065-123843087 CTAGGGTTGTCCATGACCTCTGG + Intronic
1021642683 7:22755383-22755405 CAAGGGTTGCCAACAACTACTGG + Intergenic
1029060532 7:97793018-97793040 GCTGGGTTGTCCACTACCACTGG + Intergenic
1031741286 7:125434716-125434738 CTAGTGATGTCGAATACTACTGG + Intergenic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1037108834 8:15141964-15141986 CCAGGGTCTTCCACTGCTACAGG - Intronic
1038428637 8:27482114-27482136 CCAGGGTTTGCCACTACTGCTGG + Intergenic
1038430147 8:27493543-27493565 CTAGGAATGCCCACTGCTACAGG - Intronic
1039138451 8:34355140-34355162 TTAGGCTTGTCCACTACTGGTGG - Intergenic
1044766703 8:95583637-95583659 CTAGGCTTGTCCTCTACTTGAGG + Intergenic
1047365058 8:124203919-124203941 CTGGGGTTCTGCACTACTCCAGG - Intergenic
1187227348 X:17386310-17386332 CTCTGGTTGTCCTCTACCACAGG + Intronic
1193964942 X:87973691-87973713 CTAGGTTTTTCCAGTTCTACTGG + Intergenic
1195231365 X:102852262-102852284 CTAGAGTTGCCCATTACTATTGG + Intergenic
1196495797 X:116324036-116324058 CTAGGGTTGAGAATTACTACGGG - Intergenic
1199412618 X:147542236-147542258 CTAGGACTCTGCACTACTACTGG - Intergenic