ID: 1107527399

View in Genome Browser
Species Human (GRCh38)
Location 13:41246862-41246884
Sequence GAACTCAGATAGCCTAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107527399_1107527400 18 Left 1107527399 13:41246862-41246884 CCAGTCTTAGGCTATCTGAGTTC 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1107527400 13:41246903-41246925 CTTCCTAGCTGTCTGTCCACAGG 0: 1
1: 0
2: 4
3: 44
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107527399 Original CRISPR GAACTCAGATAGCCTAAGAC TGG (reversed) Intronic
902160576 1:14527198-14527220 CAACACAAATAGACTAAGACCGG - Intergenic
907904650 1:58773315-58773337 AAGCTCAGAGAGCCTAAGGCAGG + Intergenic
909629562 1:77757705-77757727 GAATTCAGATAGATTAAGATTGG - Intronic
910226699 1:84943289-84943311 AAACTCAGTTTGCCCAAGACAGG - Intronic
913280671 1:117182154-117182176 GAAATCAGACTGCCTAAGACAGG - Intronic
914505376 1:148284441-148284463 GAAATGAGACAGCCTCAGACAGG - Intergenic
914507186 1:148299710-148299732 GAAATGAGACAGCCTCAGACAGG + Intergenic
917913194 1:179673380-179673402 GAACTCAGAAAATCTGAGACAGG + Intronic
919573766 1:199280843-199280865 GAACTGTGATTGCCTAACACTGG + Intergenic
923371904 1:233322875-233322897 GAACTCAGAAAGACGAAGAAGGG - Intergenic
1064498251 10:15939068-15939090 GACCTCAGGTAGCCTTAGAGTGG - Intergenic
1066242470 10:33551681-33551703 GAACTCAGAAAATCTGAGACAGG - Intergenic
1069253318 10:66299306-66299328 GAACTCAGAAAATCTGAGACAGG - Intronic
1071132283 10:82408783-82408805 GAAGTCACATAGACTAAGAGTGG + Intronic
1077278833 11:1732802-1732824 GAACTCAGAAAGCTTCAGCCAGG + Exonic
1079141020 11:17809749-17809771 GGAGTCAGATAGCCTTAGCCAGG + Intronic
1082942072 11:58716705-58716727 GAACCCAGAAAATCTAAGACAGG + Intronic
1086119269 11:83288503-83288525 GTAAACAGATAGCCTAAGAATGG - Intergenic
1087758897 11:102084803-102084825 GAACTAAGATAGGCTTAGTCTGG + Intergenic
1088276051 11:108086810-108086832 GCCTTCAGATGGCCTAAGACAGG + Intronic
1091028050 11:132159539-132159561 GAAATAAGATAGGATAAGACAGG + Intronic
1091346205 11:134855954-134855976 GAACCCAGAAAGTCTGAGACAGG - Intergenic
1092760028 12:11801729-11801751 AAACTCAGATAGGCTAAGGGTGG + Intronic
1092935283 12:13356567-13356589 GAACTCAGTTAGCCTGTGGCTGG - Intergenic
1093653496 12:21670825-21670847 TAACACAGAAAGCCTAAAACTGG + Intronic
1093977910 12:25442986-25443008 GAAGTCAGATATTATAAGACTGG - Intronic
1098230984 12:68371407-68371429 GAAATCAGAGAGCCAAGGACAGG + Intergenic
1098737045 12:74118303-74118325 AAGCTCAAATAGACTAAGACAGG + Intergenic
1103220784 12:119242810-119242832 GAAATCAGATTGCCCAAGGCAGG - Intergenic
1107527399 13:41246862-41246884 GAACTCAGATAGCCTAAGACTGG - Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1110724252 13:78801344-78801366 GAACTCAGTTATCCATAGACTGG + Intergenic
1110804905 13:79742951-79742973 GCACTCAGATAGCCTACATCAGG - Intergenic
1110969344 13:81741160-81741182 GAACTCAGAAAATCTGAGACAGG - Intergenic
1114821256 14:26021851-26021873 TATCTCAGATAACCTAAGTCAGG - Intergenic
1115260706 14:31450320-31450342 AAACTCAAATATCCTAAAACAGG + Intronic
1116561814 14:46389230-46389252 GAATCCAGATAGCCTAAGCACGG - Intergenic
1120205790 14:81586067-81586089 GAACTCAGATAATCTGAGATAGG - Intergenic
1120721394 14:87893043-87893065 GGACATAGACAGCCTAAGACTGG - Intronic
1122046541 14:99028077-99028099 GGAGTCAGATAGGCTAAGACAGG - Intergenic
1125194852 15:37034358-37034380 GGACTCAAATAGCCTAAGCTGGG - Intronic
1134361545 16:13535435-13535457 TAACTCTTATAGCCTAAGCCAGG + Intergenic
1134564327 16:15237941-15237963 GAACTCAGTTGGCCCAAGCCAGG - Intergenic
1134738168 16:16518758-16518780 GAACTCAGTTGGCCCAAGCCAGG + Intergenic
1134929332 16:18193405-18193427 GAACTCAGTTGGCCCAAGCCAGG - Intergenic
1139416107 16:66812019-66812041 GAACCCAGATAGACTATCACAGG - Intronic
1141252542 16:82371323-82371345 GCACACAGAAAGCTTAAGACAGG + Intergenic
1145228095 17:21147967-21147989 GGACTCAGGGAGGCTAAGACAGG + Intronic
1146712152 17:35051382-35051404 GAGATCAGATAGCCCAAAACAGG - Intronic
1146937517 17:36821462-36821484 GGACACAGATAGACTGAGACTGG + Intergenic
1148565786 17:48632176-48632198 GAGCTCAGAGACCCTAAGGCTGG + Intronic
1150305909 17:64085169-64085191 GAACACAAACAGACTAAGACAGG - Intronic
1153585288 18:6614615-6614637 CAACTCAAATGGGCTAAGACAGG - Intergenic
1154323735 18:13375035-13375057 GACCTCAGATCGCCAAAAACCGG - Intronic
1160386280 18:78498886-78498908 AAAGTCAGAGAGCCTCAGACAGG + Intergenic
1160386289 18:78498938-78498960 AAAGTCAGAGAGCCTCAGACAGG + Intergenic
1160408223 18:78657481-78657503 GAACTCTGAGAGGCCAAGACGGG - Intergenic
930680799 2:54255280-54255302 GAGCTCAGACACCCTAGGACAGG - Exonic
933042977 2:77492503-77492525 GAACTTTGAGAGGCTAAGACAGG - Intronic
934987190 2:98896056-98896078 CAACTCAAATGGACTAAGACAGG + Intronic
935264801 2:101385096-101385118 TAACACAGATGGACTAAGACAGG + Intronic
938174842 2:129116171-129116193 GAACCCAGATACCCTATGACTGG - Intergenic
948281642 2:236751744-236751766 GAACTCAGACTGCCCAAGCCAGG - Intergenic
1172378775 20:34470056-34470078 GACCTCAGATAGCCTATGTTCGG + Exonic
1173676438 20:44839678-44839700 GAAGTCAGATAGCCTGGGCCCGG - Intergenic
1173678648 20:44860382-44860404 CAACACAGACAGACTAAGACAGG + Intergenic
1178809645 21:35869755-35869777 GACCTCAGAGAACCTAAGCCAGG + Intronic
1181454852 22:23053313-23053335 GAACACAGATAGCCTATGCTGGG - Intergenic
1184837730 22:47033878-47033900 GAAGTCAGAGTGCCTAAGAAAGG - Intronic
953746502 3:45578120-45578142 GAACTCAGTTAGTCTCAGAGAGG - Intronic
953940390 3:47089999-47090021 GAACTCTGAAAGGCCAAGACAGG + Intronic
954824554 3:53361305-53361327 CAACTCAGATGGACTAAGACAGG - Intergenic
957933575 3:86913642-86913664 GATCTGAGATAGCCTCAGATAGG + Intergenic
959929606 3:111965020-111965042 CAACTGAGAAAGCCAAAGACAGG - Intronic
960503853 3:118469764-118469786 CAACACAGACAGACTAAGACTGG - Intergenic
961687189 3:128642117-128642139 GTACTCAGACAGCCTCAGAGAGG + Intronic
967574557 3:191075726-191075748 GACCTGAGATAGAATAAGACAGG - Intergenic
967924624 3:194636427-194636449 TAGCTCAAATAGACTAAGACAGG + Intergenic
968378823 4:70582-70604 GAACTCTGAAAGGCTGAGACAGG - Intronic
970616122 4:17769913-17769935 GAGCTGAGATAGCCTCAGAGTGG + Intronic
970671099 4:18397637-18397659 GTGCTCAGATAACCTAAGATTGG + Intergenic
972267940 4:37481138-37481160 CAACTGAGTTAGCCTAAGATGGG + Intronic
972853925 4:43082705-43082727 GAACCCAGAAAATCTAAGACAGG + Intergenic
974415250 4:61598574-61598596 GAACTCAAATATCCTTAGAGTGG + Intronic
974894181 4:67918915-67918937 GAAATCACATTGCCTTAGACAGG + Intronic
976197866 4:82550676-82550698 CAACTCAGAGAGGCTAAGCCAGG + Intronic
976598568 4:86916920-86916942 GAGCTCAAACAGACTAAGACAGG - Intronic
988476836 5:31593985-31594007 CAATTCAGATAACCTAACACTGG + Intergenic
992221250 5:74575970-74575992 GTACTCAAAGAGCCTAAGCCGGG - Intergenic
992663360 5:78983436-78983458 GAACTCAGATTGCAAAAGAATGG - Intronic
996098484 5:119423559-119423581 GAACTCATATTGCATAAGTCAGG - Intergenic
996700666 5:126447365-126447387 GAAATCAGAAAGCCTAGGCCGGG + Intronic
1000391439 5:160727157-160727179 AAACTCAGAAAATCTAAGACAGG - Intronic
1001741952 5:174060615-174060637 GAACCCAGCTAGCCTATGGCTGG - Intronic
1004997114 6:21204315-21204337 GAACACAGATGGCATAAGATTGG - Intronic
1005787024 6:29254224-29254246 GAACCCAGAAAGTCTGAGACAGG - Intergenic
1008200872 6:48588174-48588196 CAACCCAGATGGACTAAGACAGG + Intergenic
1009360645 6:62807376-62807398 CAACACAAATAGACTAAGACAGG + Intergenic
1010992203 6:82492261-82492283 GATCTCAGATATCTGAAGACAGG + Intergenic
1011538460 6:88403937-88403959 GAACTCAGATAACCAAGGCCAGG + Intergenic
1013993256 6:116278878-116278900 GAACTCAGACACCCTAGAACCGG - Exonic
1016792087 6:148076719-148076741 ATCCTCAGATAGCCTGAGACGGG + Intergenic
1023177271 7:37447323-37447345 GATTTCAGATAATCTAAGACGGG - Intronic
1023797818 7:43808388-43808410 GAATTGAGTTACCCTAAGACAGG + Intergenic
1028904155 7:96134472-96134494 GAAGCCACATAGCATAAGACAGG - Intronic
1030221468 7:107103528-107103550 AAGCTCAGATAGCCTGAGGCTGG + Intronic
1030354568 7:108527804-108527826 GGACTCAGCAGGCCTAAGACAGG + Intronic
1041881037 8:62750451-62750473 GGACTCAGAAAGGCGAAGACGGG + Intronic
1044362025 8:91296905-91296927 GATCTCAGAGAGCCTCATACAGG - Intronic
1046026076 8:108725596-108725618 ATACTCAGCTATCCTAAGACAGG + Intronic
1047435690 8:124833945-124833967 CAACACAAATAGACTAAGACAGG + Intergenic
1051875498 9:21788774-21788796 GAAATCAAAGAGCCAAAGACAGG + Intergenic
1055568966 9:77597098-77597120 GAACCCAGAAAATCTAAGACAGG - Intronic
1056422090 9:86438487-86438509 GAACCCAGAAAACCTGAGACAGG - Intergenic
1057349274 9:94281453-94281475 GAACCCAGAAAACCTGAGACAGG + Intronic
1057743132 9:97729981-97730003 GAACTCAGATAGGAGAAGACAGG + Intergenic
1060549563 9:124478488-124478510 GATCACAGATAGGCAAAGACTGG - Exonic
1185811434 X:3114095-3114117 GAACCCAGAAAGTCTGAGACAGG + Intergenic
1185812216 X:3121195-3121217 GAACCCAGAAAGTCTGAGACAGG + Intergenic
1194327459 X:92537627-92537649 GAACCCAAATAGCATAACACTGG + Intronic
1194507444 X:94750278-94750300 GAACTCAGAAAATCTGAGACAGG + Intergenic
1200636174 Y:5656852-5656874 GAACCCAAATAGCATAACACTGG + Intronic
1200768581 Y:7102816-7102838 GAACTAAGAAAGCCTGAGCCAGG + Intergenic
1200987949 Y:9324118-9324140 GGAGTTAGATAGCCTAAAACGGG - Intergenic
1201017663 Y:9622557-9622579 GGAGTTAGATAGCCTAAAACGGG - Intergenic
1201269137 Y:12237413-12237435 GAACCCAGAAAGTCTGAGACAGG - Intergenic