ID: 1107529263

View in Genome Browser
Species Human (GRCh38)
Location 13:41266308-41266330
Sequence CAACTTAGACATTTAGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107529259_1107529263 29 Left 1107529259 13:41266256-41266278 CCCAGTCTATGGTTTTTTGTTAT 0: 1
1: 313
2: 1564
3: 3988
4: 6663
Right 1107529263 13:41266308-41266330 CAACTTAGACATTTAGAACTCGG 0: 1
1: 0
2: 0
3: 13
4: 170
1107529260_1107529263 28 Left 1107529260 13:41266257-41266279 CCAGTCTATGGTTTTTTGTTATG 0: 1
1: 155
2: 790
3: 2415
4: 4829
Right 1107529263 13:41266308-41266330 CAACTTAGACATTTAGAACTCGG 0: 1
1: 0
2: 0
3: 13
4: 170
1107529262_1107529263 1 Left 1107529262 13:41266284-41266306 CCAAGTTATTCTGACTATGCAGA 0: 1
1: 0
2: 2
3: 16
4: 157
Right 1107529263 13:41266308-41266330 CAACTTAGACATTTAGAACTCGG 0: 1
1: 0
2: 0
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107529263 Original CRISPR CAACTTAGACATTTAGAACT CGG Intergenic
902090406 1:13898404-13898426 CAACTTAGCAAGTCAGAACTTGG - Intergenic
905720263 1:40193975-40193997 CAAATTAGAATTTTAGAACATGG + Intronic
908214941 1:61942095-61942117 CAGCTTTGACCTTTAGAATTTGG - Intronic
909201438 1:72694358-72694380 CAACTTAGGATTTTAGAAGTTGG + Intergenic
910349485 1:86278980-86279002 AAACTTAGACATTTAGCACATGG + Intergenic
910593196 1:88950204-88950226 CAACTAAGACATTAAGGACCAGG + Intronic
915852451 1:159340106-159340128 CAAATAATACATTTAGAAATAGG - Intergenic
918678120 1:187315763-187315785 CAATTAAGAAATTAAGAACTGGG - Intergenic
921546863 1:216483638-216483660 CAGTTTAGACATCTAGACCTTGG - Intergenic
922411546 1:225380770-225380792 CAATTTAGCCACTTAGAGCTGGG - Intronic
924297305 1:242600779-242600801 CAACATAGAATTTTAGAAGTGGG + Intergenic
1063617715 10:7616080-7616102 CAAAATAGCCATTTAGAACCTGG + Exonic
1063991976 10:11576360-11576382 GAACTTAGACATTCAGATCACGG - Intronic
1065523212 10:26592033-26592055 CAACTGAGAGGTTTTGAACTAGG - Intergenic
1066397832 10:35043445-35043467 CAACTAAGACCTCTAGATCTGGG + Intronic
1067938500 10:50632035-50632057 CAAATTAGACATTTATGCCTGGG + Intergenic
1068708881 10:60109710-60109732 GAACTTAGACTTTTAGAAAATGG + Intronic
1069653118 10:70065839-70065861 AAACTTAGACTTTTATAACATGG - Intronic
1071126260 10:82338878-82338900 TAAGTTGGATATTTAGAACTCGG + Intronic
1071214146 10:83379110-83379132 TAACATAGATATTTAGACCTGGG + Intergenic
1072577589 10:96714440-96714462 CAACTTAGAGATTAAGAGCATGG - Intronic
1072905616 10:99450618-99450640 CAGCTTAGACTGTTAGAACTTGG + Intergenic
1074617527 10:115084405-115084427 CAATTTAAAAATGTAGAACTTGG + Intergenic
1078909555 11:15718161-15718183 GAATGTAGACCTTTAGAACTGGG + Intergenic
1079642319 11:22821485-22821507 CATCTTAAAGAATTAGAACTTGG - Exonic
1080867229 11:36206077-36206099 CAACTTAGAAATTCAAAAATTGG + Intronic
1087191864 11:95263213-95263235 AAATGTAGATATTTAGAACTGGG + Intergenic
1087389224 11:97513302-97513324 CAATTTAGACATTGAGGACCAGG - Intergenic
1087624788 11:100584188-100584210 GAACATAGACATTTAGGTCTAGG - Intergenic
1087819161 11:102691650-102691672 GAATTTGGATATTTAGAACTAGG + Exonic
1088417948 11:109610554-109610576 CAATTAAGACCTTTAGAACCAGG - Intergenic
1089056520 11:115590086-115590108 CAATCTAGACATTTTGAAGTGGG - Intergenic
1092667843 12:10824912-10824934 CAATCTTGACATTTAGAACATGG - Intergenic
1095157101 12:38870865-38870887 CCACTTTGTCATTTACAACTGGG + Intronic
1096833818 12:54335227-54335249 CTACTTAGCCATTTGGAGCTGGG + Intronic
1100167401 12:91931592-91931614 CAATTTTGAAATTTAGAACAAGG - Intergenic
1101532188 12:105583460-105583482 CAACTTTGAGAATTAGAACCAGG - Intergenic
1102003738 12:109575191-109575213 GCACTAAGACATTTAGAAGTTGG + Intronic
1102402546 12:112642583-112642605 CAACTGAAAAATTTAGAATTAGG - Intronic
1104402822 12:128490778-128490800 CAGATTTGGCATTTAGAACTTGG - Intronic
1104557543 12:129814813-129814835 CATCTTAGATGTTGAGAACTGGG - Intronic
1106744677 13:32688116-32688138 TGACTTAGAAATTTAGAACTTGG + Intronic
1107529263 13:41266308-41266330 CAACTTAGACATTTAGAACTCGG + Intergenic
1109654436 13:65370536-65370558 CAAGGTAGACATATAGAACAAGG - Intergenic
1110250355 13:73374261-73374283 CAACTTAGAAAGTTAGGAATAGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1113069555 13:106407266-106407288 CATCTTAGTCATTTAAATCTGGG + Intergenic
1115992293 14:39162681-39162703 CAGCTAAGACACTGAGAACTGGG - Intronic
1117954801 14:61114301-61114323 CAACCTCGACATTTCGAACATGG - Intergenic
1126172049 15:45703273-45703295 CAACTTACAAATTTAGAAAATGG + Intergenic
1127719999 15:61690009-61690031 CAACTTACACATTTAAAAGCTGG - Intergenic
1130374513 15:83316720-83316742 CAACTTATAAAATTAGAACCTGG - Intergenic
1135756915 16:25106440-25106462 ACATTTAGAAATTTAGAACTGGG - Intergenic
1139287001 16:65824505-65824527 CAGCTCATACATTTAGAACTAGG - Intergenic
1140029107 16:71320228-71320250 CAGCTCAGAAATTTGGAACTGGG - Intergenic
1143132758 17:4690789-4690811 CAACTTGGACATGTAGTTCTGGG - Intronic
1143150037 17:4802057-4802079 CCACTTGGTCATTTCGAACTGGG + Intergenic
1143338556 17:6191649-6191671 CAACTGAGACATTGAGGACTTGG - Intergenic
1144412506 17:15014678-15014700 CATCATAGAAACTTAGAACTTGG - Intergenic
1150670302 17:67190341-67190363 CTACTTAGATTTTTAGAACAAGG - Exonic
1151526807 17:74675662-74675684 CAACTTAGGAAGTCAGAACTGGG - Intronic
1153848895 18:9074504-9074526 CAACTGAGAAATATAGAAATTGG - Intergenic
1154106426 18:11527573-11527595 AAACTAAGACATTTGGCACTGGG + Intergenic
1155034355 18:22012554-22012576 GAACTTTGACATTTTGAGCTGGG + Intergenic
1156795696 18:41043555-41043577 CAACTGAGACTTTTAAATCTTGG + Intergenic
1158135825 18:54207065-54207087 GAGCTTGAACATTTAGAACTTGG - Intronic
1158521908 18:58178145-58178167 CAACATATATATTTAGAACTGGG + Intronic
1159379562 18:67638526-67638548 CAACTTAGATGTCTAGAAATAGG + Intergenic
1159864161 18:73684899-73684921 CAACTAAGATATTTAAAACAAGG - Intergenic
1159928210 18:74287892-74287914 AAACTTAGGCATTTAGGACCAGG - Intronic
1161464891 19:4423622-4423644 CAACTTGGACATTTTGAGATTGG + Intronic
1161753859 19:6117138-6117160 CAACTTTGAGTTTTAGAAGTGGG - Intronic
1164775496 19:30850480-30850502 GAACTTAGCCATTTAGAATTGGG + Intergenic
1164934402 19:32199909-32199931 AATCATAGACATTTGGAACTGGG - Intergenic
927060038 2:19408816-19408838 CATCATTGACATTTAGAAGTTGG + Intergenic
927227871 2:20787633-20787655 CAGCTCTGACATGTAGAACTTGG - Intronic
931416944 2:62090510-62090532 CAATTTAGACATTGAGGACCAGG - Intronic
935337863 2:102033857-102033879 CAATGTAGACATTTAGATGTTGG - Intergenic
940683643 2:156818821-156818843 CCACTTTCACATTTAGCACTGGG - Intergenic
943306657 2:186270805-186270827 TAACTTATAGATTTCGAACTTGG + Intergenic
944509446 2:200450452-200450474 CAACTGTGACATTCAGAAGTGGG - Intronic
945460387 2:210100954-210100976 CAACTTAAGCTTTTAAAACTTGG + Intronic
948345248 2:237290984-237291006 CAAATCAGACATCTAGAACAGGG - Intergenic
948561179 2:238854312-238854334 CAAATTAGACAGTGAGAATTAGG - Intronic
1170507144 20:17038755-17038777 CTACCTAGAGATTTAGGACTGGG + Intergenic
1172564533 20:35918626-35918648 TTACTCAGAAATTTAGAACTGGG - Intronic
1173129944 20:40382822-40382844 CTTGTTAGGCATTTAGAACTGGG - Intergenic
1173146637 20:40530366-40530388 AAACTGAGACATCAAGAACTTGG + Intergenic
1173163662 20:40671118-40671140 CAACTTAGACAGATGGAGCTGGG - Intergenic
1178399136 21:32268583-32268605 AAACTTTGACATTTAACACTTGG - Exonic
1182776564 22:32835615-32835637 CAACTGAGAGATTTAGACCAGGG + Intronic
1183478899 22:38052193-38052215 CAACATAGACATTTAGAGTGTGG - Intergenic
1183761591 22:39824508-39824530 AATCTTTGAGATTTAGAACTGGG - Intronic
949596449 3:5552964-5552986 CATTTTTGATATTTAGAACTGGG - Intergenic
949870673 3:8585264-8585286 AGACTCAGACATTTAGAACAGGG - Intergenic
950644319 3:14368090-14368112 CAGCTAAGACGTTTAGAGCTAGG + Intergenic
950932759 3:16807347-16807369 CAAATTTGTCATCTAGAACTTGG + Intronic
952335237 3:32398161-32398183 CACCCCAGACATTTAGAAATGGG + Intronic
953566468 3:44036294-44036316 CAACTTAAACATTCAGCAGTAGG - Intergenic
960316477 3:116184513-116184535 TAACTCAGACATTTTGACCTGGG + Intronic
960543491 3:118886371-118886393 CAAATGAGACATTTAGCAGTTGG + Intergenic
964319754 3:155482635-155482657 CAACCTAGAAATTAAGAACCTGG - Exonic
970765526 4:19544165-19544187 CAACTGAGACATGGAGAAGTGGG + Intergenic
972482801 4:39513839-39513861 CTAATTTGAGATTTAGAACTAGG - Intronic
973756033 4:54074260-54074282 TAACTTAGACACTTAAAACATGG + Intronic
973779805 4:54277581-54277603 TAAATAAGACATTTAGGACTAGG + Intronic
974813792 4:66980487-66980509 CAACTTAGACTCTTAAAACAAGG + Intergenic
975173001 4:71254619-71254641 CAAAATAGAGACTTAGAACTGGG - Intronic
975935223 4:79571231-79571253 CAACAATGACATTTAGAAATGGG + Intergenic
976384580 4:84440996-84441018 CAACTTTGACATTTAAAGATTGG + Intergenic
977552861 4:98460392-98460414 CCACTGAGACATTTAGAGCAAGG - Intergenic
977592031 4:98837474-98837496 CAAATTAGACAGTATGAACTTGG + Intergenic
980405478 4:132349656-132349678 TAACTAAGAAATTTAGACCTTGG - Intergenic
981051058 4:140309927-140309949 CAATGAAAACATTTAGAACTTGG - Intronic
983780155 4:171660434-171660456 CAACTTAAACCTTTAAAAATTGG - Intergenic
985035130 4:185831144-185831166 CAACATGGTCATCTAGAACTGGG + Intronic
986413544 5:7505667-7505689 AAACAAAGGCATTTAGAACTTGG + Intronic
986564809 5:9101363-9101385 CAACTTATAGATGTAGAAATTGG - Intronic
986824470 5:11505691-11505713 AAACTAAGATATTTAGAACTTGG - Intronic
986946780 5:13030505-13030527 AAACTTATACATTTTGAAATTGG - Intergenic
987007240 5:13723157-13723179 CAAGTTAGAGATTTAGATATTGG - Intronic
987356427 5:17067220-17067242 CAATTTAGACATTTAGGACCAGG + Intronic
988547336 5:32171164-32171186 CACCTTAAACATTTAGAGCAAGG + Intronic
988868915 5:35366656-35366678 CAGCTTACACATTTATATCTGGG - Intergenic
989263030 5:39439939-39439961 TAAATTAGACATTTGGAATTAGG - Intronic
989643959 5:43608938-43608960 CAGTTCAGACATTTAAAACTTGG - Intronic
990007969 5:50965016-50965038 CAAGTTTGAAATTTAGAACAAGG + Intergenic
991321414 5:65377322-65377344 CAACTTAGCCATGTGGAAATGGG - Intronic
991981154 5:72232183-72232205 CACCTCAGACATTCAGAAATGGG - Intronic
992355356 5:75976819-75976841 CAACTTAAAACTTTAGAAATAGG + Intergenic
992425558 5:76653363-76653385 CAACTTGGAAATCTACAACTTGG + Intronic
992976225 5:82123618-82123640 CACCTTTAACATTTAGAAGTTGG + Intronic
995257589 5:110065104-110065126 CACCTTAGACATAGAGAATTGGG + Intergenic
995552872 5:113297854-113297876 CAACTTGTAGATCTAGAACTTGG + Intronic
998885256 5:146687190-146687212 AAACTTAGACATATACATCTGGG - Intronic
999044583 5:148453284-148453306 AAACTTAGACACTTAGAATAGGG - Intronic
1001455940 5:171859653-171859675 CAACTTAGACATTTAAACAAAGG - Intergenic
1001684574 5:173583865-173583887 CAGTTTAGACATTTGGAATTTGG - Intergenic
1003928628 6:10901534-10901556 CAATATAGATATTTTGAACTGGG + Intronic
1004565605 6:16793607-16793629 CAACTTAGAATTCTATAACTAGG + Intergenic
1005245727 6:23882536-23882558 TAACTAAAACATTTAGAACAGGG + Intergenic
1012535986 6:100297833-100297855 TAACTTAGACATTGAGCACTGGG - Intergenic
1012944646 6:105452221-105452243 CTATTTAGACATTTAGAATATGG + Intergenic
1015654578 6:135502842-135502864 CAACATATGCATTTGGAACTGGG + Intergenic
1018786664 6:167113678-167113700 CATTTTAAACATTTAAAACTTGG - Intergenic
1019824513 7:3272687-3272709 CAACTTACACTTTGTGAACTTGG - Intergenic
1023754444 7:43402958-43402980 CAACTTAAACATTCAAAATTAGG + Intronic
1027470535 7:78568145-78568167 GAACTTAAACATTTAGAGTTTGG - Intronic
1030330654 7:108266683-108266705 CAGCTTCTATATTTAGAACTGGG + Intronic
1030366376 7:108651658-108651680 ACATTTAGACATTTAGAAGTTGG + Intergenic
1030667145 7:112291870-112291892 CAACTTAAACATATAAAATTAGG - Intronic
1031864649 7:127025130-127025152 CCACTTTGACATTTAAGACTTGG + Intronic
1032621697 7:133540514-133540536 CAACTTAGCAATTTAGCAATTGG - Intronic
1033132474 7:138756636-138756658 CAATTCATACATTTAAAACTGGG + Intronic
1039273064 8:35904210-35904232 CAACATACACATTTAGCACCTGG + Intergenic
1039290371 8:36088259-36088281 CAACTCCAACATTTAGAAATTGG - Intergenic
1041679900 8:60577940-60577962 CAACTTAAAAATTTAGACCTTGG - Intronic
1043517608 8:81009939-81009961 CAACTTTGAGAGTTAGACCTCGG - Intronic
1043522580 8:81062493-81062515 AAACTTAGAAAATTAGAAATGGG - Intronic
1044827957 8:96216088-96216110 CAACATATACATTTAGGAGTTGG + Intergenic
1044958269 8:97504078-97504100 GCACTTAGATACTTAGAACTAGG + Intergenic
1046000460 8:108414746-108414768 CCTCTTAGACATTTAAAACAAGG + Intronic
1046573456 8:115995587-115995609 TAACTTAGATATTGAGAGCTGGG - Intergenic
1047118573 8:121873823-121873845 CAATAAAGACAATTAGAACTGGG - Intergenic
1047546543 8:125823059-125823081 CAACTTGGAATTTGAGAACTCGG - Intergenic
1047963796 8:130030616-130030638 CAACTGAGACATGGAGAATTTGG - Intergenic
1051178934 9:14390337-14390359 AAAATTAGCCATTTAGATCTGGG - Intronic
1053875165 9:42537251-42537273 CCACTCAGACATTTAGCTCTAGG - Intergenic
1054236532 9:62564477-62564499 CCACTCAGACATTTAGCTCTAGG + Intergenic
1059393527 9:114016517-114016539 CAGCTCAGACATTTCGAGCTGGG - Intronic
1059751784 9:117254297-117254319 CTACACAAACATTTAGAACTGGG - Intronic
1059764173 9:117367769-117367791 CTTCTCAGACATATAGAACTTGG + Intronic
1059777012 9:117486180-117486202 AAATTTAGAAATTTAGAGCTGGG - Intergenic
1060733930 9:126054432-126054454 CAACTTGGACCTTCAGACCTAGG + Intergenic
1061087806 9:128409421-128409443 CAGCCTAGACATCTGGAACTGGG - Intergenic
1186409103 X:9330387-9330409 CAACTTCGACATTGACAACTGGG + Intergenic
1189645006 X:43118563-43118585 CAAATTAAACATTCAGATCTTGG - Intergenic
1196673929 X:118399480-118399502 CACCTTAGATATTTGGAACTTGG + Intronic
1196992131 X:121341721-121341743 TAACCTAGACATTGAGAATTAGG + Intergenic
1198241663 X:134793851-134793873 AACCTTACACACTTAGAACTCGG - Exonic
1199172502 X:144747234-144747256 CAATTTAGACATTGAGGACCAGG + Intergenic
1199850021 X:151719158-151719180 AAATTTAGAAATTTAGAATTAGG + Intronic
1201736827 Y:17272795-17272817 AAAATTAGACATCTAGAATTAGG + Intergenic
1201943666 Y:19486364-19486386 CAACAAAGAAATTTAAAACTTGG + Intergenic