ID: 1107537855

View in Genome Browser
Species Human (GRCh38)
Location 13:41353185-41353207
Sequence GCTAAAACTGCAACCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107537855_1107537857 -7 Left 1107537855 13:41353185-41353207 CCACCTCTGGTTGCAGTTTTAGC 0: 1
1: 0
2: 2
3: 16
4: 104
Right 1107537857 13:41353201-41353223 TTTTAGCAACTACCAGTAGATGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107537855 Original CRISPR GCTAAAACTGCAACCAGAGG TGG (reversed) Intronic
905606442 1:39304514-39304536 GCTGAAACTGTAACCAAAGGAGG - Intronic
906743152 1:48202228-48202250 GCTAACACTGCAGGCAGATGGGG + Intergenic
908084149 1:60612331-60612353 GATAAAACTGAAACCAGTGGAGG + Intergenic
909017506 1:70395626-70395648 TCTTGAACTGCAACTAGAGGAGG + Intergenic
909639232 1:77853418-77853440 GCAGAAACTACAACCAAAGGAGG + Intronic
910028325 1:82685741-82685763 ACTATAATAGCAACCAGAGGAGG - Intergenic
911343248 1:96665685-96665707 GATAAAACTGCAACAAGAATAGG - Intergenic
914999408 1:152574403-152574425 GTTAGAGCTGCAACCAGAGATGG + Intronic
917363255 1:174200555-174200577 GTTGAAACTGCTTCCAGAGGTGG + Intronic
920078095 1:203351603-203351625 GATAGAACTGGAACCAGAGCCGG - Intergenic
920150611 1:203903931-203903953 GCTGAAACTGTAACCAAAGGAGG - Intergenic
1063198708 10:3766999-3767021 GGCAAAACAGGAACCAGAGGGGG + Intergenic
1067692862 10:48513645-48513667 GCTACAACAGCAACCTGAGGAGG + Intronic
1068702020 10:60030535-60030557 ACTAAATATGCAACCATAGGAGG + Intronic
1075218055 10:120556001-120556023 GCTAAGACAGAAAGCAGAGGGGG - Intronic
1076226357 10:128779320-128779342 TCTAAAACAGAAACCAGAGAAGG - Intergenic
1078211222 11:9271177-9271199 GCAAAAACTGAAAACAGAGCTGG + Intergenic
1082765251 11:57162664-57162686 CCTATCACTGCAGCCAGAGGAGG + Intergenic
1088468175 11:110164451-110164473 GCCAAAACTGCAAACGAAGGAGG + Exonic
1089407338 11:118209153-118209175 GCTGAGACTGTAACCAAAGGAGG - Intronic
1090684444 11:129100199-129100221 GCTCAACTTGCAACCATAGGTGG + Intronic
1090824004 11:130370769-130370791 ACGAAAACTGCAATGAGAGGTGG + Intergenic
1091774430 12:3175212-3175234 GCTAAGCCTGCAACCAGAACTGG + Intronic
1098470434 12:70837194-70837216 GCCAAAAGTGGAACCAGATGTGG - Intronic
1101149717 12:101873535-101873557 GCTGAAACTGTAACCAAAGGAGG - Intergenic
1103213025 12:119180246-119180268 GCTAATACCACAACCAGAGGAGG + Intronic
1103379130 12:120480216-120480238 CCTCAATCTGCATCCAGAGGGGG + Intronic
1103962483 12:124617687-124617709 GCTAATTCTGCCACCAGAGTTGG - Intergenic
1104637073 12:130444588-130444610 GCTAAAAAGGCAACAAAAGGTGG + Intronic
1106430635 13:29677117-29677139 GGTAAAACTGCAAGCAAAGCAGG - Intergenic
1107537855 13:41353185-41353207 GCTAAAACTGCAACCAGAGGTGG - Intronic
1107831062 13:44374069-44374091 GCAAAAACATCACCCAGAGGGGG + Exonic
1108561491 13:51648499-51648521 GCTATAAATGCAAGCAGAGAAGG - Intronic
1111294726 13:86263884-86263906 GCTAAAATCATAACCAGAGGGGG - Intergenic
1112406017 13:99120818-99120840 GCTAAAAGTGGAACTAGAGATGG - Intergenic
1112548709 13:100398486-100398508 TATAAAACTTCAACAAGAGGAGG + Intronic
1114301882 14:21385744-21385766 GCCACCACTGCAACCTGAGGAGG - Exonic
1117107691 14:52414968-52414990 GCTGAAACTGCAGGTAGAGGTGG - Intergenic
1118183291 14:63515265-63515287 GCGAAAGCTTCAATCAGAGGAGG - Intronic
1118193377 14:63601572-63601594 GTTGAAACTGTAACCAAAGGAGG + Intronic
1118491926 14:66269447-66269469 GCTTAAACTTGAACTAGAGGGGG - Intergenic
1122488567 14:102097656-102097678 GTTAAAACTGAAACTAGAGGAGG + Intronic
1128268048 15:66284361-66284383 GCAAACACTGCAATCAGAGGAGG + Intergenic
1129905566 15:79184860-79184882 CCTACATCTGCAACCTGAGGGGG + Intergenic
1131227216 15:90634791-90634813 GCTAAAACTGTAACCAAAGGAGG + Intronic
1131447029 15:92508011-92508033 CCTATAACTGCAATCAAAGGTGG + Intergenic
1132986041 16:2768189-2768211 ACTAGAACTGGAGCCAGAGGAGG - Exonic
1134669616 16:16045103-16045125 GAAAAAACTGCAACCAGGGTTGG + Intronic
1135124021 16:19791855-19791877 GCTAAAATCATAACCAGAGGGGG + Intronic
1139697649 16:68686445-68686467 GCTGAAACTGTAACCAAAGGAGG + Intronic
1140394134 16:74612813-74612835 GCTGAAACTGTAACCAGAGGAGG - Intergenic
1148318584 17:46727882-46727904 TCTAATACTTCTACCAGAGGAGG - Intronic
1153284960 18:3449046-3449068 GCGAAAACTAGAACCAGAGGAGG + Intronic
1153738459 18:8097701-8097723 ACTTAAACTGAAACCTGAGGAGG + Intronic
1153748393 18:8204196-8204218 GCTGAAACTGCAAGCAGAAGAGG - Intronic
1154196836 18:12273101-12273123 GCTACAACTGGAACCACAGGTGG + Intronic
1157129651 18:44994842-44994864 GATAAAACTGCAAAGAAAGGAGG + Intronic
1159265958 18:66079334-66079356 GCTACAATTGCTACCAGTGGAGG - Intergenic
1160371546 18:78376286-78376308 GCTCCCACTGCAACCAGAGCTGG + Intergenic
1160728753 19:630791-630813 GGCAAAAATGCAACCTGAGGCGG - Intronic
1161755212 19:6128389-6128411 GCTAAAAAGTCAACCACAGGTGG + Intronic
1163247966 19:16109085-16109107 GAGAAAACTGAAGCCAGAGGAGG - Intergenic
1167921765 19:52788010-52788032 GCTAAATGTGCATCCAGATGTGG + Intronic
1167942038 19:52955702-52955724 GCTAAACATGCATCCAGATGTGG + Intronic
926324728 2:11774683-11774705 GATCAAACTGGAACCAGGGGTGG - Intronic
933635768 2:84707756-84707778 GCTGAAACTGGAGCCAGGGGTGG + Intronic
939981928 2:148792763-148792785 GCTAAAATTTCAACCACAGTTGG - Intergenic
941225231 2:162839401-162839423 GCTAAATCTGCACCCTTAGGTGG - Intergenic
942514114 2:176733777-176733799 GCTAACACTGCAGACATAGGTGG + Intergenic
943120443 2:183728124-183728146 TCAAAAATTGCAGCCAGAGGAGG - Intergenic
943426688 2:187746744-187746766 GCTAAAACTGACCCCAGAAGAGG + Intergenic
943652997 2:190477291-190477313 GATAGAACAGGAACCAGAGGTGG - Intronic
944242746 2:197501137-197501159 GCTGAAACTGTAACCAAAGGAGG + Exonic
947005183 2:225503227-225503249 TCCAAAAATTCAACCAGAGGAGG - Intronic
947319960 2:228906007-228906029 GCTAAGCCAGGAACCAGAGGAGG - Intronic
947524101 2:230868142-230868164 GCAAAAACTGCAACACAAGGAGG + Intronic
1173087110 20:39933141-39933163 GTCAAAACTGTAACCAAAGGAGG - Intergenic
1176100546 20:63362424-63362446 GCTCAACCTGGAACCAGAGGTGG - Intronic
1177826544 21:26090577-26090599 GCTAAAATAGAAACAAGAGGGGG + Intronic
1181322929 22:22022626-22022648 GCTCACACTGCAGCCTGAGGAGG - Intergenic
1182796045 22:32992428-32992450 GGTAGAACTGGAACCAGTGGGGG - Intronic
955778211 3:62456134-62456156 GCGGAAACTGAAACCAGAGAAGG - Intronic
959836435 3:110923840-110923862 GCAACACCTGCACCCAGAGGAGG + Intergenic
966191805 3:177278177-177278199 GCCACACCTGCAGCCAGAGGTGG - Intergenic
974261782 4:59534454-59534476 GCTAAACGAGCAACCAAAGGAGG - Intergenic
974528691 4:63079464-63079486 GAAATAACTTCAACCAGAGGAGG - Intergenic
975484368 4:74917887-74917909 GCTGAAACTGTAGCCAAAGGAGG + Intergenic
976211493 4:82676116-82676138 ACTAAATCTCCAACCAGAAGGGG - Intronic
977958421 4:103056778-103056800 GGTAGAACTGCAACCATAGATGG - Intronic
984232705 4:177118354-177118376 GCTAAAAATACAATCAGAAGGGG - Intergenic
986920472 5:12673849-12673871 GCTGAAACTGCACCCACAGCCGG + Intergenic
995753155 5:115474631-115474653 GCTACTGCTGTAACCAGAGGTGG + Intergenic
996733487 5:126737945-126737967 GCCGAAACTGTAACCAAAGGAGG - Intergenic
998124874 5:139610972-139610994 GCCAAAACTATAACCAAAGGAGG + Intronic
998388782 5:141773815-141773837 GCTAAAAGTGCAAGCTGTGGAGG - Intergenic
1001279218 5:170374427-170374449 GTCCAAGCTGCAACCAGAGGAGG - Intronic
1001343131 5:170865357-170865379 GTTAAAACTGCAAACAGGGCCGG - Intronic
1005124887 6:22435360-22435382 GCTAAACCTGCAACTAGGTGAGG - Intergenic
1006573331 6:35023586-35023608 GCTGAAACTGTAACCAAAGGAGG + Intronic
1009328924 6:62390555-62390577 GCTACACCTGCACACAGAGGTGG + Intergenic
1011167554 6:84466278-84466300 ACTAAAACAGCAACCACAGTTGG - Intergenic
1011650318 6:89500097-89500119 GATAAAAGAGCCACCAGAGGTGG - Intronic
1015794412 6:136996859-136996881 GCTATAACTGGAAGCAGATGAGG - Intergenic
1029034297 7:97502693-97502715 GCTGCCACTGAAACCAGAGGTGG + Intergenic
1029337983 7:99918822-99918844 GTTAAAACTGGAATGAGAGGAGG - Intronic
1033146383 7:138873753-138873775 TCACAGACTGCAACCAGAGGAGG + Intronic
1035783447 8:2246274-2246296 ACTAAAAATACATCCAGAGGGGG - Intergenic
1035808676 8:2473312-2473334 ACTAAAAATACATCCAGAGGGGG + Intergenic
1036780300 8:11642376-11642398 CTTAAAGCTGCAATCAGAGGCGG - Intergenic
1036924669 8:12892704-12892726 GCTCTACCTACAACCAGAGGAGG + Intergenic
1038700818 8:29847795-29847817 AATACAACTGCAACGAGAGGGGG + Intergenic
1039649647 8:39327995-39328017 GATGAAACTGCCCCCAGAGGTGG - Intergenic
1040984359 8:53277923-53277945 GCTCTACCTACAACCAGAGGAGG + Intergenic
1042280363 8:67049691-67049713 GCTGAAACTGTAACCAAAGGAGG - Intronic
1045217063 8:100158714-100158736 ACAAAGACTGCAAACAGAGGTGG + Intronic
1045399027 8:101792798-101792820 GCTAAAGCTGCATAAAGAGGAGG - Intronic
1047484915 8:125320471-125320493 GGGAAAACAGCAACCAAAGGGGG + Intronic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1056272793 9:84963095-84963117 ATTAAAACTGCAATCCGAGGAGG + Intronic
1058070920 9:100599714-100599736 GCTGAACCCGCAACCAAAGGAGG - Intergenic
1060958050 9:127658451-127658473 GGTAAACCTTCCACCAGAGGAGG + Exonic
1188154535 X:26724366-26724388 GCTAAAACTGACAGCAAAGGAGG - Intergenic
1200248365 X:154538570-154538592 GCTAAAACTCTTAGCAGAGGGGG + Intronic