ID: 1107542833

View in Genome Browser
Species Human (GRCh38)
Location 13:41409060-41409082
Sequence CAATCAGCTGCTACTCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107542831_1107542833 16 Left 1107542831 13:41409021-41409043 CCAGTTTCAAAATAATCTTTTTT No data
Right 1107542833 13:41409060-41409082 CAATCAGCTGCTACTCTCCAAGG No data
1107542832_1107542833 -7 Left 1107542832 13:41409044-41409066 CCTTCTCTAAGACATTCAATCAG No data
Right 1107542833 13:41409060-41409082 CAATCAGCTGCTACTCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107542833 Original CRISPR CAATCAGCTGCTACTCTCCA AGG Intergenic
No off target data available for this crispr