ID: 1107544670

View in Genome Browser
Species Human (GRCh38)
Location 13:41424605-41424627
Sequence GCTCGTTTACGACCCAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107544670_1107544677 -6 Left 1107544670 13:41424605-41424627 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1107544677 13:41424622-41424644 ACGAGCTGCCGAGGGAGGGGTGG No data
1107544670_1107544675 -10 Left 1107544670 13:41424605-41424627 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1107544675 13:41424618-41424640 GTAAACGAGCTGCCGAGGGAGGG No data
1107544670_1107544678 -1 Left 1107544670 13:41424605-41424627 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1107544678 13:41424627-41424649 CTGCCGAGGGAGGGGTGGAGTGG No data
1107544670_1107544676 -9 Left 1107544670 13:41424605-41424627 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1107544676 13:41424619-41424641 TAAACGAGCTGCCGAGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107544670 Original CRISPR GCTCGTTTACGACCCAAAAC GGG (reversed) Intergenic
No off target data available for this crispr