ID: 1107544868

View in Genome Browser
Species Human (GRCh38)
Location 13:41426151-41426173
Sequence ATGACTCCCCGCAACGCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107544866_1107544868 -1 Left 1107544866 13:41426129-41426151 CCAGGGGGGGAGGGGGGGTGATA No data
Right 1107544868 13:41426151-41426173 ATGACTCCCCGCAACGCCGGTGG No data
1107544853_1107544868 18 Left 1107544853 13:41426110-41426132 CCATCGTGGATCGTCGTATCCAG No data
Right 1107544868 13:41426151-41426173 ATGACTCCCCGCAACGCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107544868 Original CRISPR ATGACTCCCCGCAACGCCGG TGG Intergenic
No off target data available for this crispr