ID: 1107545563

View in Genome Browser
Species Human (GRCh38)
Location 13:41430558-41430580
Sequence GTACACCCCATGTGTACATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107545563_1107545569 8 Left 1107545563 13:41430558-41430580 CCGAATGTACACATGGGGTGTAC No data
Right 1107545569 13:41430589-41430611 ACACAGGAGGGGTACACACATGG No data
1107545563_1107545565 -5 Left 1107545563 13:41430558-41430580 CCGAATGTACACATGGGGTGTAC No data
Right 1107545565 13:41430576-41430598 TGTACACCGTGTAACACAGGAGG No data
1107545563_1107545564 -8 Left 1107545563 13:41430558-41430580 CCGAATGTACACATGGGGTGTAC No data
Right 1107545564 13:41430573-41430595 GGGTGTACACCGTGTAACACAGG No data
1107545563_1107545567 -3 Left 1107545563 13:41430558-41430580 CCGAATGTACACATGGGGTGTAC No data
Right 1107545567 13:41430578-41430600 TACACCGTGTAACACAGGAGGGG No data
1107545563_1107545566 -4 Left 1107545563 13:41430558-41430580 CCGAATGTACACATGGGGTGTAC No data
Right 1107545566 13:41430577-41430599 GTACACCGTGTAACACAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107545563 Original CRISPR GTACACCCCATGTGTACATT CGG (reversed) Intergenic
No off target data available for this crispr