ID: 1107545565

View in Genome Browser
Species Human (GRCh38)
Location 13:41430576-41430598
Sequence TGTACACCGTGTAACACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107545559_1107545565 12 Left 1107545559 13:41430541-41430563 CCTAGGGGCATGCTCTTCCGAAT No data
Right 1107545565 13:41430576-41430598 TGTACACCGTGTAACACAGGAGG No data
1107545563_1107545565 -5 Left 1107545563 13:41430558-41430580 CCGAATGTACACATGGGGTGTAC No data
Right 1107545565 13:41430576-41430598 TGTACACCGTGTAACACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107545565 Original CRISPR TGTACACCGTGTAACACAGG AGG Intergenic
No off target data available for this crispr