ID: 1107548325

View in Genome Browser
Species Human (GRCh38)
Location 13:41454376-41454398
Sequence GGCGGGCGACGCTCGCGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107548312_1107548325 18 Left 1107548312 13:41454335-41454357 CCCCTCTCCTTCCCTGGCTATTA 0: 1
1: 6
2: 10
3: 80
4: 543
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83
1107548316_1107548325 7 Left 1107548316 13:41454346-41454368 CCCTGGCTATTACGATACACATC 0: 1
1: 7
2: 16
3: 32
4: 162
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83
1107548313_1107548325 17 Left 1107548313 13:41454336-41454358 CCCTCTCCTTCCCTGGCTATTAC 0: 1
1: 4
2: 21
3: 65
4: 557
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83
1107548317_1107548325 6 Left 1107548317 13:41454347-41454369 CCTGGCTATTACGATACACATCG 0: 1
1: 7
2: 24
3: 31
4: 84
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83
1107548314_1107548325 16 Left 1107548314 13:41454337-41454359 CCTCTCCTTCCCTGGCTATTACG 0: 1
1: 5
2: 52
3: 177
4: 556
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83
1107548315_1107548325 11 Left 1107548315 13:41454342-41454364 CCTTCCCTGGCTATTACGATACA 0: 1
1: 4
2: 6
3: 34
4: 154
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107548325 Original CRISPR GGCGGGCGACGCTCGCGACG CGG Intergenic