ID: 1107548325

View in Genome Browser
Species Human (GRCh38)
Location 13:41454376-41454398
Sequence GGCGGGCGACGCTCGCGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107548313_1107548325 17 Left 1107548313 13:41454336-41454358 CCCTCTCCTTCCCTGGCTATTAC 0: 1
1: 4
2: 21
3: 65
4: 557
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83
1107548316_1107548325 7 Left 1107548316 13:41454346-41454368 CCCTGGCTATTACGATACACATC 0: 1
1: 7
2: 16
3: 32
4: 162
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83
1107548317_1107548325 6 Left 1107548317 13:41454347-41454369 CCTGGCTATTACGATACACATCG 0: 1
1: 7
2: 24
3: 31
4: 84
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83
1107548312_1107548325 18 Left 1107548312 13:41454335-41454357 CCCCTCTCCTTCCCTGGCTATTA 0: 1
1: 6
2: 10
3: 80
4: 543
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83
1107548315_1107548325 11 Left 1107548315 13:41454342-41454364 CCTTCCCTGGCTATTACGATACA 0: 1
1: 4
2: 6
3: 34
4: 154
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83
1107548314_1107548325 16 Left 1107548314 13:41454337-41454359 CCTCTCCTTCCCTGGCTATTACG 0: 1
1: 5
2: 52
3: 177
4: 556
Right 1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG 0: 1
1: 0
2: 1
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107548325 Original CRISPR GGCGGGCGACGCTCGCGACG CGG Intergenic
900349559 1:2228186-2228208 GGCCGGCGGCGGGCGCGACGCGG + Intergenic
900357723 1:2272841-2272863 GGAGGGCGAGGCTCGGGGCGTGG - Intronic
903700819 1:25247123-25247145 GGCGGTCGCCGCCCGCGCCGTGG - Intronic
908572177 1:65421005-65421027 GGAGGGCGCCGCTCTCGCCGAGG - Intronic
1067091212 10:43266665-43266687 GGCGGGGGACGCGCGCGGGGAGG - Intronic
1069957871 10:72062774-72062796 GGCAGGCGAGGCTGACGACGGGG - Exonic
1070167769 10:73911346-73911368 CGCGGGGGACGCCCGGGACGGGG - Exonic
1071544855 10:86521560-86521582 GGCCGGCGGCGCTCGAGGCGGGG - Exonic
1073207321 10:101776009-101776031 GGCCGGCGGCGATCACGACGCGG + Intronic
1076949161 10:133668903-133668925 GGCGGGCGACGGTGGCGCGGGGG - Intronic
1076950145 10:133672202-133672224 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076953108 10:133682121-133682143 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076954092 10:133685420-133685442 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076955076 10:133741772-133741794 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076957055 10:133748392-133748414 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076959027 10:133755000-133755022 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076960016 10:133758310-133758332 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076961000 10:133761609-133761631 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1078514347 11:12009370-12009392 GGCGGGCGGGGCTCGGGGCGGGG - Intronic
1084261815 11:67984040-67984062 GGCGGGCGCCCCCCGCGATGCGG - Intergenic
1084261843 11:67984118-67984140 GGCGGGCGCCCCCCGCGATGCGG - Intergenic
1089525749 11:119095329-119095351 GGCGCGCGACGAGCGCGACTTGG + Exonic
1090202492 11:124866318-124866340 GGCGGGCGGAGCTGGCGGCGAGG + Intronic
1096506529 12:52097314-52097336 GGCGGGCGACCCCCACGATGCGG + Intergenic
1103509951 12:121467350-121467372 GGCGTGCGAGGCGCGCGGCGCGG - Intronic
1107468165 13:40667243-40667265 GGCGTGTGCCGCTCGCGAGGGGG - Intergenic
1107545237 13:41428256-41428278 GGCGGGTGCCCCCCGCGACGCGG - Intergenic
1107548046 13:41452304-41452326 GGCGGGCGCCCCCCGCGATGCGG + Intergenic
1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG + Intergenic
1109840767 13:67914606-67914628 GGCGGGCGACCCAAGCGATGCGG + Intergenic
1113417343 13:110138510-110138532 GGCGGGCGGCGCGCGCGCCCAGG + Intergenic
1122486644 14:102086703-102086725 GGCGGGGGACCCCCGCGGCGGGG + Intronic
1124088050 15:26570398-26570420 GGAGGGCGAGGCCCGCGAGGAGG - Intronic
1124500754 15:30225157-30225179 GGCGGGCGGCGCACGAGGCGCGG - Intergenic
1125541178 15:40471011-40471033 GGCGGGCGGCGGGCGCGGCGAGG - Exonic
1145884426 17:28372275-28372297 GGCGGGCGGCGCGCGGGCCGTGG + Exonic
1150168385 17:62966307-62966329 GGCGGGCGGCTCGCGCGAGGCGG - Intergenic
1160725405 19:616067-616089 GGCGGGCGGCGCACGAGGCGCGG - Exonic
1161108779 19:2456969-2456991 GGCGGGCGGCGGGCGCGGCGCGG - Exonic
1167377521 19:49119767-49119789 GGCGGGGGAGGCTCGCCAAGGGG - Intronic
932352526 2:71043768-71043790 GGCGGGCGCCGCCCGCGCTGCGG + Intergenic
933666739 2:84970944-84970966 CGCGGCCGGCGGTCGCGACGGGG - Intergenic
936093856 2:109517220-109517242 GGCGGGCGATGCTGGCAACAGGG - Intergenic
940420931 2:153478576-153478598 GGCGGGCGCCGCGAGCGGCGCGG + Exonic
940873548 2:158880004-158880026 GGCAGGCGACCCCCGCGATGCGG - Intergenic
941906164 2:170717050-170717072 GGCGGGCGGCGCCCCCGAGGCGG + Exonic
942277958 2:174336363-174336385 GGCGGACGACGTGGGCGACGTGG - Exonic
948213851 2:236214589-236214611 GGAGGCGGACGCGCGCGACGAGG - Exonic
1170578538 20:17681737-17681759 GGCGGCAGACGGGCGCGACGTGG - Intronic
1181082782 22:20425537-20425559 GGCGGGCGAGGCTGGCGGCACGG + Exonic
1182511303 22:30822347-30822369 AGCAGGCGACGCGCGGGACGAGG + Intronic
1185409515 22:50674602-50674624 GGCCGGGGCCGCTCGCGCCGGGG - Intergenic
949882341 3:8671844-8671866 GGCGGGCGCCTCCCGCGATGCGG + Intronic
957076884 3:75609623-75609645 GGCGGGCGCCCCCCGCGATGCGG - Intergenic
969793113 4:9505562-9505584 GGCGGGCGCCCCCCGCGATGCGG + Intergenic
969825904 4:9758481-9758503 GGCGGGCGTCCCCCGCGATGCGG + Intergenic
971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG + Exonic
978126992 4:105146723-105146745 GGCGCGCGGCGCTCGCGAGGAGG - Exonic
979311955 4:119213113-119213135 GGCTGGAGGCGCTCGCGAGGCGG + Intronic
985064229 4:186105267-186105289 GGCGGGCGACCGCCGCGAGGCGG - Intronic
985452616 4:190069693-190069715 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985453603 4:190072990-190073012 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985454593 4:190076283-190076305 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985455581 4:190079576-190079598 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985456565 4:190082870-190082892 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985457553 4:190086170-190086192 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985458540 4:190089463-190089485 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985459529 4:190092763-190092785 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985463780 4:190175532-190175554 GGCGGGCGACGGTGGCGCGGGGG - Intronic
993168264 5:84384182-84384204 GGCGAGCGCCGCTGGCGGCGCGG - Intronic
1004007366 6:11649359-11649381 GGCGGGCCACTCTCAAGACGGGG - Intergenic
1005915235 6:30345414-30345436 GGCGGGCGGCGGGCGGGACGCGG + Intronic
1006535676 6:34696873-34696895 GGCGGGCGACGCTTGCGCAGTGG - Intergenic
1017793662 6:157823147-157823169 GGCGGGCGTCGCGCGCGCCGCGG + Intronic
1020307752 7:6847949-6847971 GGCGGGCGCCCCCCGCGATGCGG - Intergenic
1026025373 7:66740408-66740430 GGAGGGCGACGCTGGCTCCGCGG - Intronic
1036817794 8:11914750-11914772 GGCGGGCGACCCCCACGATGCGG - Intergenic
1036906811 8:12714007-12714029 GGCGGGCGACCCCCGCGATGCGG - Intergenic
1041690064 8:60679309-60679331 GCCGGGCGGCGCTCGGGGCGCGG - Intronic
1043463952 8:80486950-80486972 CGCGGGCGGCGCTGGCGGCGGGG - Exonic
1048214083 8:132480304-132480326 GGAGGGCGGCGGCCGCGACGAGG - Exonic
1056643212 9:88388408-88388430 GGCGGGCGGCGTCCGCGGCGAGG + Exonic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1061108955 9:128553046-128553068 GGCTGGCGAAGATCCCGACGAGG - Intronic
1061128027 9:128689149-128689171 GGCCGGGGAGGCTCGCGCCGCGG - Intronic
1061293519 9:129665560-129665582 GGCGGGCGAGGCGCGCGGGGAGG + Intergenic
1061666138 9:132161958-132161980 GGCGGGCGATGCGGGCGGCGCGG + Exonic
1062022516 9:134326222-134326244 GGCGGGCGGCGATCGCGGGGCGG + Intronic
1062646823 9:137551997-137552019 GGCGGGCGCCGCGCGCGGCCAGG + Intronic
1199724758 X:150568915-150568937 GGCGGGCGAAGGTCGGGACGGGG + Intronic