ID: 1107553686

View in Genome Browser
Species Human (GRCh38)
Location 13:41499353-41499375
Sequence GAGAAGGCACAGAACCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107553686_1107553690 13 Left 1107553686 13:41499353-41499375 CCAAGCTGGTTCTGTGCCTTCTC No data
Right 1107553690 13:41499389-41499411 TTTGACCCAGCATTAACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107553686 Original CRISPR GAGAAGGCACAGAACCAGCT TGG (reversed) Intergenic
No off target data available for this crispr