ID: 1107555437

View in Genome Browser
Species Human (GRCh38)
Location 13:41513480-41513502
Sequence CTGAGGACACAGCATGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107555433_1107555437 8 Left 1107555433 13:41513449-41513471 CCAGGAGAAGGCAGAGGGGAGAG No data
Right 1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107555437 Original CRISPR CTGAGGACACAGCATGAGGA CGG Intergenic
No off target data available for this crispr