ID: 1107556349

View in Genome Browser
Species Human (GRCh38)
Location 13:41519543-41519565
Sequence ATGCAAAGGCAGAACGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107556349_1107556356 15 Left 1107556349 13:41519543-41519565 CCTTCCGCGTTCTGCCTTTGCAT No data
Right 1107556356 13:41519581-41519603 GTCACCTTGACTGTAGAAGGAGG No data
1107556349_1107556358 17 Left 1107556349 13:41519543-41519565 CCTTCCGCGTTCTGCCTTTGCAT No data
Right 1107556358 13:41519583-41519605 CACCTTGACTGTAGAAGGAGGGG No data
1107556349_1107556361 22 Left 1107556349 13:41519543-41519565 CCTTCCGCGTTCTGCCTTTGCAT No data
Right 1107556361 13:41519588-41519610 TGACTGTAGAAGGAGGGGTTGGG No data
1107556349_1107556353 -8 Left 1107556349 13:41519543-41519565 CCTTCCGCGTTCTGCCTTTGCAT No data
Right 1107556353 13:41519558-41519580 CTTTGCATTGGATGTGAAGTAGG No data
1107556349_1107556362 23 Left 1107556349 13:41519543-41519565 CCTTCCGCGTTCTGCCTTTGCAT No data
Right 1107556362 13:41519589-41519611 GACTGTAGAAGGAGGGGTTGGGG No data
1107556349_1107556357 16 Left 1107556349 13:41519543-41519565 CCTTCCGCGTTCTGCCTTTGCAT No data
Right 1107556357 13:41519582-41519604 TCACCTTGACTGTAGAAGGAGGG No data
1107556349_1107556363 28 Left 1107556349 13:41519543-41519565 CCTTCCGCGTTCTGCCTTTGCAT No data
Right 1107556363 13:41519594-41519616 TAGAAGGAGGGGTTGGGGCCAGG No data
1107556349_1107556360 21 Left 1107556349 13:41519543-41519565 CCTTCCGCGTTCTGCCTTTGCAT No data
Right 1107556360 13:41519587-41519609 TTGACTGTAGAAGGAGGGGTTGG No data
1107556349_1107556355 12 Left 1107556349 13:41519543-41519565 CCTTCCGCGTTCTGCCTTTGCAT No data
Right 1107556355 13:41519578-41519600 AGGGTCACCTTGACTGTAGAAGG No data
1107556349_1107556354 -7 Left 1107556349 13:41519543-41519565 CCTTCCGCGTTCTGCCTTTGCAT No data
Right 1107556354 13:41519559-41519581 TTTGCATTGGATGTGAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107556349 Original CRISPR ATGCAAAGGCAGAACGCGGA AGG (reversed) Intergenic
No off target data available for this crispr