ID: 1107561445

View in Genome Browser
Species Human (GRCh38)
Location 13:41560677-41560699
Sequence TCCTCACAGCTCCTTCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107561445_1107561446 9 Left 1107561445 13:41560677-41560699 CCTGTCTGAAGGAGCTGTGAGGA No data
Right 1107561446 13:41560709-41560731 TTTATCCATGTAAAGTGTTCAGG No data
1107561445_1107561450 27 Left 1107561445 13:41560677-41560699 CCTGTCTGAAGGAGCTGTGAGGA No data
Right 1107561450 13:41560727-41560749 TCAGGAAGTGCCTGGCGCATGGG No data
1107561445_1107561449 26 Left 1107561445 13:41560677-41560699 CCTGTCTGAAGGAGCTGTGAGGA No data
Right 1107561449 13:41560726-41560748 TTCAGGAAGTGCCTGGCGCATGG No data
1107561445_1107561448 19 Left 1107561445 13:41560677-41560699 CCTGTCTGAAGGAGCTGTGAGGA No data
Right 1107561448 13:41560719-41560741 TAAAGTGTTCAGGAAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107561445 Original CRISPR TCCTCACAGCTCCTTCAGAC AGG (reversed) Intergenic
No off target data available for this crispr