ID: 1107562415

View in Genome Browser
Species Human (GRCh38)
Location 13:41569925-41569947
Sequence TTGTCTCTCCAGCAATAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107562412_1107562415 -5 Left 1107562412 13:41569907-41569929 CCAAGTGTTTCACCTGCCTTGTC 0: 1
1: 0
2: 15
3: 304
4: 4090
Right 1107562415 13:41569925-41569947 TTGTCTCTCCAGCAATAAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107562415 Original CRISPR TTGTCTCTCCAGCAATAAGA AGG Intronic
901345401 1:8536241-8536263 CTGTTTCTCCATCAGTAAGATGG - Intronic
901355332 1:8642278-8642300 TTGTCTTTTCATCAATAAAATGG - Intronic
901420833 1:9150157-9150179 TTTCCTCTCCAGCATTGAGAGGG + Intergenic
903092328 1:20932587-20932609 TTGTATCTCAGGAAATAAGAAGG + Intronic
908502132 1:64754160-64754182 TTGTTTCTCTAGCAATCAAATGG - Intronic
908674736 1:66591119-66591141 TTCTCACTCCTGCAGTAAGATGG - Intronic
909502422 1:76349868-76349890 TTGTCTGTCCAGCAAGATGAGGG + Intronic
911503123 1:98713713-98713735 TTGTCTCTCAGGGAATACGAAGG + Intronic
911766327 1:101679975-101679997 TTGACTATCCACGAATAAGAAGG + Intergenic
912945948 1:114084264-114084286 TTCTCCCTCCAGCCCTAAGAGGG - Intergenic
913093222 1:115494049-115494071 TTGCCTCTCCAGCAACAAGTAGG - Intergenic
916078729 1:161218691-161218713 TTGTCTCTGCAGAAATCAGATGG + Exonic
916566671 1:165984944-165984966 TTGTGTCTCAGGCAATATGAAGG - Intergenic
918376475 1:183914161-183914183 CTGTCTCTCCAGGAAGGAGATGG + Intronic
919245207 1:194974047-194974069 TTCTCTATGCAGCAATAAGATGG + Intergenic
921741561 1:218691240-218691262 TTCTCTGCCCAGCAATCAGAAGG - Intergenic
922093462 1:222420340-222420362 TTGTTTATCAAGCAAGAAGATGG + Intergenic
922697987 1:227741244-227741266 TTGTCTCACCTGGAAAAAGAGGG + Intronic
923656917 1:235924816-235924838 TTATCTCTCCAGAAAGAAAAGGG - Intergenic
1065406895 10:25378158-25378180 TTGTCTAACCAGCATTCAGATGG + Intronic
1065559215 10:26945542-26945564 TTGTTTCTCTACCCATAAGAGGG - Intergenic
1070157753 10:73846555-73846577 TTGTATCTCCAGCACCCAGACGG + Intronic
1072151095 10:92684703-92684725 TTGTCTCTCAAGGAATAAGGAGG - Intergenic
1072159112 10:92749884-92749906 CTGTCTCTCCAGAACTCAGAGGG - Intergenic
1073315371 10:102577028-102577050 TGGTCTCTTCAGGAAGAAGATGG + Intronic
1074725597 10:116305416-116305438 TTGTGTCTCAAGCAATAGGGAGG + Intergenic
1074917322 10:117970084-117970106 TTGTCTCTGAAGGAAGAAGAGGG + Intergenic
1074959148 10:118423628-118423650 TAATCTCTTCAGCAATAAAATGG - Intergenic
1075168242 10:120088708-120088730 TTATGTCTCAAGGAATAAGAAGG - Intergenic
1075685959 10:124365331-124365353 TTCTCTCTCCACCAGGAAGAAGG + Intergenic
1075846534 10:125549412-125549434 CAGTCTCTCCACCTATAAGATGG - Intergenic
1077967539 11:7151287-7151309 TTATTTCTTCAGCAATTAGAAGG - Intergenic
1078017888 11:7630824-7630846 TTGTTTCTCCTTCATTAAGAAGG - Intronic
1079128381 11:17734430-17734452 TTGTCTCACCAGGGATCAGATGG + Intergenic
1079538274 11:21541168-21541190 GTGTGTCTCCAGCAACAACATGG - Intronic
1080751064 11:35150845-35150867 CTGTCTCCCCAGTTATAAGATGG + Intronic
1081168902 11:39842121-39842143 TTCTCTTTCCAGGAATAAGATGG - Intergenic
1081307594 11:41532451-41532473 TTCTCCCTCCAGAAATAGGAGGG + Intergenic
1081782862 11:45725380-45725402 TTGTCACTACAGCACAAAGAAGG - Intergenic
1083374699 11:62209982-62210004 TTGACTCTACTGCAATAAAAGGG - Intronic
1083873256 11:65505236-65505258 TTGTCTCTCCTGCCACAGGAAGG - Intergenic
1085838648 11:79983945-79983967 TTCTCTTTCCAGCCTTAAGATGG - Intergenic
1086014508 11:82150417-82150439 TATTTTTTCCAGCAATAAGATGG + Intergenic
1086258467 11:84908898-84908920 TTGTTTCTTCAGCTGTAAGATGG - Intronic
1088661441 11:112051222-112051244 TTGTCTTTCCAGATATTAGAAGG + Exonic
1089778113 11:120853346-120853368 AGATCTCTCCAGCAATAACATGG + Intronic
1091668134 12:2433855-2433877 TTGTCTCCCCAGCCATGCGAAGG - Intronic
1092763352 12:11829382-11829404 CTGTTTCTCCAGCGGTAAGATGG - Intronic
1092766503 12:11857811-11857833 CTGTCTCCCCAGTTATAAGAAGG + Intronic
1093635226 12:21458665-21458687 TTGTGTCTCCGGGAATAAGGAGG + Intronic
1093870444 12:24284715-24284737 TTGTCTCTCCAGTATAAAGGTGG + Intergenic
1095191151 12:39259832-39259854 TTGTCTCTCCAACGAGTAGAGGG - Intergenic
1095648322 12:44576484-44576506 ATGTCTCCCCAGGAATGAGATGG - Intronic
1095792766 12:46185509-46185531 TTAACTCTCCAGGAATAAGCTGG - Intronic
1096704712 12:53412142-53412164 TTGACTCTCCAGCGCCAAGAAGG - Intronic
1097238113 12:57553536-57553558 GTGTCTCTCCAGCATTACCATGG + Intronic
1098237568 12:68432266-68432288 TTGTCTCTCCAGCTAGAGCAGGG + Intergenic
1098455429 12:70667532-70667554 TTGCCTCTCCACCAACATGATGG + Intronic
1098757374 12:74383034-74383056 TTGTCTCTTCATCATTAATAAGG - Intergenic
1100997217 12:100314895-100314917 TTGTCTCACCAGCAGTTAAAGGG + Intronic
1101620580 12:106383527-106383549 TTGTGTCTCAAGGAATAAGGAGG + Intronic
1102069136 12:110003107-110003129 ATGTCTCACCATCAGTAAGAAGG - Intronic
1106915486 13:34509346-34509368 TTGTGTCTCAAGGAATAGGAAGG + Intergenic
1107562415 13:41569925-41569947 TTGTCTCTCCAGCAATAAGAAGG + Intronic
1107900141 13:45004124-45004146 TTGTCTTTCCAGCTCTAGGAAGG - Intronic
1110953388 13:81522184-81522206 TTGTCTCACCAGCAGGAAAATGG - Intergenic
1112361342 13:98721577-98721599 TTGTTTCTCCTGCAATGAAAAGG + Exonic
1112762103 13:102703043-102703065 CTGTCTCTCCATCAATTACAGGG - Intergenic
1113212154 13:107995639-107995661 TGGACTTTCCAGCAATTAGAAGG + Intergenic
1115379146 14:32714071-32714093 TTGTGTCTCAAGGAATAGGAAGG + Intronic
1116401161 14:44508970-44508992 TTGTGTCTCAAGCAATAGAAAGG - Intergenic
1116862228 14:50003707-50003729 TGGTCTCTGCAGCAGTCAGAAGG + Intronic
1117210235 14:53489839-53489861 TTTTTTCTCCAGCTATAATAAGG - Intergenic
1117637556 14:57761080-57761102 CTCTCTCTCCAGGAATAAGCTGG + Intronic
1118045254 14:61963121-61963143 TTGTGTCTCAAGGAATAGGAAGG - Intergenic
1118662612 14:68030898-68030920 TTGTGTCTCAAGGAATAGGAAGG + Intronic
1119348164 14:73943341-73943363 TTATCTATACAGCAATCAGAAGG + Intronic
1125750481 15:42024319-42024341 TTGTCTCTGCAGCAAGGGGAGGG + Intronic
1126217691 15:46175350-46175372 TAGTCTATCCAGCATGAAGAAGG - Intergenic
1128189941 15:65682822-65682844 TTGTGTCTCAAGGAATAAGAAGG + Intronic
1129536560 15:76317893-76317915 TTGTCCCTCCAGGAACCAGACGG - Intergenic
1130149885 15:81303537-81303559 TTTCCTCTGCAGCAATTAGACGG + Exonic
1130733555 15:86524474-86524496 TTGACTCTCCAGCAACAATATGG + Intronic
1133557537 16:6919634-6919656 TTATCTCTCCATCAACAAAAAGG - Intronic
1135649990 16:24197621-24197643 TTGTCCCTGCAGCACTCAGAGGG - Intronic
1140730076 16:77848463-77848485 CTGTCTCTCCAGCAAGATCATGG - Intronic
1141526558 16:84615466-84615488 TGTTCTCTCCAGCAAGTAGAAGG - Intronic
1143306503 17:5951724-5951746 TTGTTTCTCCAGCAGTAGGGAGG - Intronic
1146159242 17:30551013-30551035 TTGTCACCCAAGCAGTAAGAAGG + Intergenic
1147538251 17:41334836-41334858 TTGTCACCCAAGCAACAAGAAGG - Intergenic
1148121134 17:45212300-45212322 TTTTATTTCCAGCAATAAGGTGG - Intergenic
1148966770 17:51442388-51442410 TTGTCTCTCCCGCCCTTAGAAGG + Intergenic
1149178698 17:53906804-53906826 TTCTCTCTCCTGCATTTAGAGGG + Intergenic
1149378099 17:56065621-56065643 TTGTGTCTCAGGGAATAAGAAGG + Intergenic
1149848478 17:60021282-60021304 TTGTCACTCAAGCAACAAGAAGG - Intergenic
1149861691 17:60125242-60125264 TTGTCACTCAAGCAACAAGAAGG + Intergenic
1151028379 17:70705968-70705990 TTGTTTCTGCAGAAATAGGAGGG + Intergenic
1153406500 18:4746729-4746751 TTGTATCTCCAGGAATAGAAAGG + Intergenic
1156841096 18:41610347-41610369 TTGTCTCTCCAGTAATACAGTGG - Intergenic
1161112061 19:2476034-2476056 TTGTCTTTCCACCAATAGGAGGG + Intergenic
1162471419 19:10873990-10874012 ATGTTACTCCAGGAATAAGATGG - Intronic
1162544717 19:11321814-11321836 TTCTCTCCCCAGCAGCAAGAGGG - Intronic
1164695087 19:30237409-30237431 TTGTTTCTCTAGGAATCAGAGGG + Intronic
1168028307 19:53660044-53660066 TCGTCTCTCCAGTAAAAAGCAGG - Intergenic
925127497 2:1470044-1470066 ATTTCTCTGCAGCAATGAGATGG + Intronic
928118367 2:28564235-28564257 CTGTCTCTAAATCAATAAGAAGG + Intronic
933844727 2:86315971-86315993 TTGTGTGTCCAGCAGAAAGAAGG - Intronic
934619546 2:95795826-95795848 TTGTCTCTCCAAAAATTAGCCGG + Intergenic
934641344 2:96028731-96028753 TTGTCTCTCCAAAAATTAGCCGG - Intronic
935831359 2:107004186-107004208 TTGACTTTCCAGCCAGAAGATGG - Intergenic
936975018 2:118209980-118210002 TTGTCTCTCCACCTGTAAAATGG + Intergenic
938449847 2:131408081-131408103 GTGTCTCTCCAGCAAAAGCAGGG - Intergenic
938707399 2:133944529-133944551 TTGTCACCCTAGCAAGAAGAGGG - Intergenic
939035555 2:137126871-137126893 TTGTGTCTCCAGAAATAGGGAGG + Intronic
941043912 2:160651533-160651555 TTGTCTGTCAAGCAGTCAGATGG - Intergenic
941194933 2:162437739-162437761 TTTTCTTTCCATCAATAAGCAGG + Intronic
942337232 2:174901631-174901653 TTGTATCTCCAGCACCTAGAAGG + Intronic
942509261 2:176679124-176679146 TAGTTTCTCCAGCAAGAAAATGG + Intergenic
943534143 2:189125829-189125851 TTGTCTCTCAAACAATATGGGGG - Intronic
945804817 2:214477625-214477647 TTGTGTCTTCAGCTATAAAATGG - Intronic
946727965 2:222680646-222680668 TAGTGTCTCCGGGAATAAGAAGG + Intronic
1169231865 20:3895106-3895128 TCGTCTCTCCAAAAATAAAAAGG + Intronic
1172583592 20:36066681-36066703 TTGCCTCTCCATTAATAACAGGG + Intergenic
1175207504 20:57322623-57322645 TTGAATCTCCAGTACTAAGAAGG + Intergenic
1176946051 21:14983019-14983041 TTGTGTCTCAGGCAATAAAAAGG - Intronic
1177011903 21:15740539-15740561 TTGTGCCTCCAGGAGTAAGAGGG - Intronic
1179335108 21:40444078-40444100 TTGTCTTTCCAGCATTAATAGGG + Intronic
1179486280 21:41712604-41712626 TTGTCTCTCCAGCCAGAGGTGGG + Intergenic
1182002332 22:26930142-26930164 TTGTCTCACAAGCATTAGGATGG - Intergenic
1182426583 22:30276429-30276451 GTGTCTCTCCGAGAATAAGACGG - Intergenic
950666559 3:14499004-14499026 GTCTCTATCCAGCAATGAGATGG - Intronic
951410012 3:22352076-22352098 ATGATTCTCCAGCAATATGATGG + Intronic
952556966 3:34542760-34542782 TTGTCACTCCATCAATATGTAGG + Intergenic
956019925 3:64923408-64923430 GTCTCCCTCCAGCAAGAAGAGGG - Intergenic
956641995 3:71424185-71424207 TAGTCTCACCAGCAGCAAGAAGG + Intronic
960412821 3:117348811-117348833 TTGTGTATACAGAAATAAGAGGG + Intergenic
960863265 3:122174134-122174156 TTGTGTCTCAGGGAATAAGAAGG + Intergenic
967328952 3:188271263-188271285 TTTCTTCTCCAACAATAAGAGGG - Intronic
967654863 3:192034895-192034917 TTGTATTTCAAGCAATAAAATGG - Intergenic
967766559 3:193286677-193286699 TTGTCTCTCAAGGAATAGGGAGG - Intronic
969292834 4:6251790-6251812 TTCTGTCTCCAGAGATAAGATGG + Intergenic
969496777 4:7530764-7530786 TTGGCTGCCCAGCAAGAAGAGGG - Intronic
971675046 4:29615369-29615391 TTGTCTCTCTAGTAATGAAAGGG - Intergenic
972610107 4:40648659-40648681 TTGTATCTCCAGCACGAGGATGG + Intergenic
973075740 4:45923615-45923637 TTCTGTCTCCAGCAATGAAAGGG + Intergenic
973181823 4:47278039-47278061 TTGTCTCTCCAAATATAAGGTGG - Intronic
973235284 4:47895978-47896000 TTGTCTCTCAGGGAATAGGAAGG + Intronic
973800178 4:54470067-54470089 TTGTCTCTTCAGCATTAATCTGG + Intergenic
973972754 4:56229905-56229927 TTGTTTTTCCATCATTAAGAAGG - Intronic
975440641 4:74406526-74406548 TTTTCTCTCCAGGTAAAAGAGGG + Intergenic
976489266 4:85649362-85649384 TTGTTTCCTCAGCACTAAGATGG - Intronic
976839314 4:89412673-89412695 TTGTCTTTCCACCATTTAGAAGG - Intergenic
977686754 4:99855479-99855501 TTCTCACTCCAGCTATCAGATGG + Intronic
978813572 4:112877802-112877824 TTTTACCTCCAGCATTAAGATGG - Intronic
979555737 4:122044947-122044969 ATGACTCTCCAGCAATGAAAGGG + Intergenic
981462108 4:145025460-145025482 TTGTGTCTCAACCAATAAGGAGG + Intronic
982177703 4:152721841-152721863 TTTTCTATCCAGCAGCAAGATGG - Intronic
985221131 4:187706545-187706567 TGATCACTCCAGGAATAAGAGGG + Intergenic
985360800 4:189173358-189173380 TACTCTCTCAAGCAATAAAAGGG - Intergenic
986312186 5:6559348-6559370 TTGTCTTTCTGGCAACAAGAAGG - Intergenic
986802385 5:11275514-11275536 TAGTCTCTTCCACAATAAGAGGG + Intronic
987649486 5:20721685-20721707 TTTTCTGACCAGAAATAAGACGG + Intergenic
987691205 5:21269257-21269279 TTGTCTCTACTTCCATAAGAAGG + Intergenic
988746072 5:34139860-34139882 TTTTCTGACCAGAAATAAGACGG - Intergenic
989634236 5:43517170-43517192 TTGTGTCTCAAGGAATAGGAAGG - Intergenic
990481586 5:56216340-56216362 TTGTGTCTCAAGGAATAAGGAGG - Intronic
992074562 5:73179061-73179083 TTGTGTCTCAAGGAATAGGAAGG - Intergenic
992198092 5:74359454-74359476 TTGTTTCTCCATCTATAAAATGG - Intergenic
993603041 5:89952704-89952726 TCGTCTCTCCAGCTAGAGGAGGG + Intergenic
994383650 5:99102118-99102140 TAGTCTCTGCAGCCATAAAATGG + Intergenic
994900729 5:105765306-105765328 TTGTGTCTCCAGGAATATGGTGG + Intergenic
995001608 5:107137965-107137987 TTGTGTCTCAGGGAATAAGAAGG + Intergenic
996108493 5:119536367-119536389 TTTTCTCTCCAACAAAATGAGGG - Intronic
1000333395 5:160223775-160223797 TTGTGTCTCAGGGAATAAGAAGG - Intronic
1000843983 5:166256559-166256581 TTATCTCTGCAGCATAAAGAAGG - Intergenic
1000906838 5:166974589-166974611 TTGTTTCTCCATCTATAAAATGG + Intergenic
1001415321 5:171541536-171541558 TTGTCATTCCAGCCATGAGACGG - Intergenic
1003117374 6:3292344-3292366 TTGTCTGTCCAGGTATCAGATGG + Intronic
1005544228 6:26848085-26848107 TTTTCTGACCAGAAATAAGACGG - Intergenic
1005550061 6:26903023-26903045 TTGTCTCTACAGAAATTAGCTGG - Intergenic
1007194331 6:40047532-40047554 TAGTCTGTCCTGCAACAAGATGG + Intergenic
1008624446 6:53303977-53303999 TTGTCTAGACAGCAACAAGAGGG - Intronic
1009015013 6:57889712-57889734 TTTTCTGACCAGAAATAAGATGG - Intergenic
1009192601 6:60647657-60647679 TTGTCTCTTCCTCAAGAAGAAGG - Intergenic
1009292315 6:61897675-61897697 TTGGCTCCCCTGCCATAAGACGG + Intronic
1009819472 6:68781729-68781751 TTGTCCCTCCAGCTCTAAGCAGG - Intronic
1011663362 6:89613022-89613044 TTTTCTCCCCTGCATTAAGACGG - Intronic
1012260323 6:97081082-97081104 TTGTTTCTGCTCCAATAAGAGGG + Intronic
1012453251 6:99375867-99375889 TTGTATCTATAGCAATAAAATGG - Intronic
1014331168 6:120065546-120065568 TTTTCTCTCCCCCAATAATAGGG + Intergenic
1014509006 6:122297351-122297373 TTGTGTCTCAAGGAATAGGAAGG + Intergenic
1015671021 6:135689657-135689679 TAGCCTCTACAGCAATAAGTTGG - Intergenic
1018498784 6:164379919-164379941 TTATCTTTCCAGGAATAAAAGGG - Intergenic
1019819661 7:3233114-3233136 TTGTTTCTCCAGCATAAAGTCGG + Intergenic
1021452697 7:20797727-20797749 TTGTCTGTGCAGCAGTCAGAGGG + Intergenic
1021608140 7:22430197-22430219 TTGAATTTCAAGCAATAAGAAGG - Intronic
1023629212 7:42146931-42146953 CTGTATCTGCAGAAATAAGATGG + Intronic
1024153907 7:46600742-46600764 TTGTCTGTACAGCAGGAAGATGG - Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1029065636 7:97845142-97845164 TTGTTTCTTCAGCCATAAAATGG + Intergenic
1029895221 7:103976577-103976599 TAGTCTCTCCAGCTATATTAAGG - Intronic
1030290036 7:107863198-107863220 TTGTTTCTCAAGGAAGAAGATGG - Intergenic
1034022159 7:147656493-147656515 TTTTGTCTCAAGGAATAAGAAGG + Intronic
1035927388 8:3743078-3743100 TTGTTTATCCAGCAGTGAGATGG - Intronic
1035954615 8:4062368-4062390 CTTTTTCTCAAGCAATAAGAGGG + Intronic
1040666039 8:49634354-49634376 TTCTCTCTCCAGCACTCAGTCGG - Intergenic
1043348402 8:79327645-79327667 TTGTGGCAACAGCAATAAGAAGG + Intergenic
1043645472 8:82512141-82512163 CTCTCTCTCCACCAATAGGACGG + Intergenic
1044309016 8:90671195-90671217 TTGTAACTTCAGCAGTAAGAAGG + Intronic
1045654688 8:104374804-104374826 TTGTCTCTGCAGCCCTATGAGGG - Intronic
1046194531 8:110842575-110842597 TTGTAACTCCAGCAACCAGACGG + Intergenic
1050518271 9:6468905-6468927 TTATCTCTCCAGCAGTAGGAAGG + Intronic
1050613226 9:7374813-7374835 TTATCTCAGCAGCAATCAGATGG - Intergenic
1050778453 9:9299109-9299131 TTGTGTCTCCAGCAAATATAGGG + Intronic
1051848895 9:21486067-21486089 TTTTCTATCCAGCATTAAGCTGG + Intergenic
1052371349 9:27668538-27668560 TTGTTTCTCAGGAAATAAGAAGG + Intergenic
1057517125 9:95731243-95731265 TTGTCTCTCCTGCAAAATGGTGG + Intergenic
1058285888 9:103177508-103177530 TTGTGTATCCGGCAAGAAGAAGG + Intergenic
1058825693 9:108774330-108774352 TTGTCACTCCACCCATCAGAAGG - Intergenic
1058893233 9:109379195-109379217 TTGTCCTCCCAGCAACAAGATGG - Exonic
1059938113 9:119332029-119332051 TTGTCCCTGCAACAATAGGAAGG - Intronic
1060460438 9:123848530-123848552 TTGTGTCTCAAGGAATAAGGAGG - Intronic
1061391025 9:130317064-130317086 TTGGCTCTCTTGCAAGAAGATGG + Intronic
1186613010 X:11156848-11156870 TTGTATCTCCAGGCATATGAGGG - Intronic
1186870399 X:13765914-13765936 TTGTCACTTCAGGAATAAGGAGG + Intronic
1188308131 X:28584257-28584279 TTTTCTTTCCAGTAATATGATGG - Intergenic
1188444671 X:30243838-30243860 TTGGCTCTCCATTAATTAGAAGG - Exonic
1188569350 X:31563498-31563520 ATGTCTCTGCATCAATAATAAGG - Intronic
1191158697 X:57303583-57303605 CTGTTTCTCCAGCTATAAAATGG - Intronic
1191926514 X:66316884-66316906 TTGTCTTTCAAGGAATAAGGAGG + Intergenic
1194067439 X:89278785-89278807 TTATCTCTCTAGCAATATTAGGG - Intergenic
1198013070 X:132579423-132579445 TAGCCTCTCCAACAAAAAGAGGG + Intergenic
1198017127 X:132622401-132622423 TTCTCTCTCCAGCAATGAAAAGG - Intergenic
1199539812 X:148946439-148946461 TTGTCACGGCAGCAATAGGAAGG - Intronic
1200721598 Y:6612994-6613016 TTATCTCTCTAGCAATATTAGGG - Intergenic
1201313784 Y:12622728-12622750 TTACCTCTCCAGCAATATCAGGG - Intergenic
1201859912 Y:18585304-18585326 TTGTCCCTTCAGAAATAAGGAGG - Intronic
1201873409 Y:18735077-18735099 TTGTCCCTTCAGAAATAAGGAGG + Intronic
1202167173 Y:22002325-22002347 TTGTCCCTTCAGAAATAAGGAGG + Intergenic
1202224186 Y:22584044-22584066 TTGTCCCTTCAGAAATAAGGAGG - Intergenic
1202318928 Y:23611616-23611638 TTGTCCCTTCAGAAATAAGGAGG + Intergenic
1202551841 Y:26058441-26058463 TTGTCCCTTCAGAAATAAGGAGG - Intergenic