ID: 1107563240

View in Genome Browser
Species Human (GRCh38)
Location 13:41576573-41576595
Sequence CAAGTTCAGCATATCTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107563240_1107563250 30 Left 1107563240 13:41576573-41576595 CCATTATAGATATGCTGAACTTG 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1107563250 13:41576626-41576648 AAGACCTAACAGTTATCCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 79
1107563240_1107563245 -2 Left 1107563240 13:41576573-41576595 CCATTATAGATATGCTGAACTTG 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1107563245 13:41576594-41576616 TGTGTCCTGGGGGAGAGATGTGG 0: 1
1: 0
2: 0
3: 48
4: 484
1107563240_1107563248 4 Left 1107563240 13:41576573-41576595 CCATTATAGATATGCTGAACTTG 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1107563248 13:41576600-41576622 CTGGGGGAGAGATGTGGCTAGGG 0: 1
1: 0
2: 0
3: 18
4: 321
1107563240_1107563247 3 Left 1107563240 13:41576573-41576595 CCATTATAGATATGCTGAACTTG 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1107563247 13:41576599-41576621 CCTGGGGGAGAGATGTGGCTAGG 0: 1
1: 0
2: 2
3: 26
4: 389
1107563240_1107563249 5 Left 1107563240 13:41576573-41576595 CCATTATAGATATGCTGAACTTG 0: 1
1: 0
2: 0
3: 9
4: 182
Right 1107563249 13:41576601-41576623 TGGGGGAGAGATGTGGCTAGGGG 0: 1
1: 0
2: 1
3: 43
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107563240 Original CRISPR CAAGTTCAGCATATCTATAA TGG (reversed) Intronic
903308607 1:22433579-22433601 CAAGTCCCTGATATCTATAATGG - Intergenic
904469311 1:30726171-30726193 AAAGTTCAGCATATACATTAAGG + Intergenic
905019519 1:34798921-34798943 CAAGGTCATCTTATCTATGACGG + Intronic
907045056 1:51295614-51295636 CAACTTCAGCATCTGTAAAATGG - Intronic
908096069 1:60740172-60740194 CAAGTTCAACACAGATATAAAGG - Intergenic
909960111 1:81829836-81829858 CAAGTTCAGCAACTATATAAGGG - Intronic
913243650 1:116852433-116852455 CCAGTTCAGGACATCTCTAAAGG - Intergenic
914436980 1:147669491-147669513 CCAGGTCAGCATTTCTATTAAGG - Intronic
916140740 1:161694884-161694906 AAAGGTCAGGTTATCTATAAAGG + Intergenic
919167653 1:193916310-193916332 CAAGTTCAGCTGATCTAGACTGG - Intergenic
921508009 1:215997213-215997235 CAAGTTCACTATATTTATTAGGG - Intronic
921879715 1:220241892-220241914 AAAGTTAAGCATGTCTAAAAAGG + Intronic
922168510 1:223135575-223135597 CAGTTTCTGCATATGTATAACGG + Intronic
1063395923 10:5687335-5687357 CTAGTTAAGGATATCTATATAGG - Intronic
1064636485 10:17373377-17373399 AAAGTTATGCATATTTATAAGGG - Intronic
1065479046 10:26174022-26174044 CAAAAGCAGCATATCTAGAAAGG + Exonic
1069719962 10:70543680-70543702 CCAGTTGACCATATGTATAAGGG + Intronic
1070484905 10:76920882-76920904 CAAGTTAAGCATAACTACAATGG - Intronic
1071000420 10:80825182-80825204 CAAGTTCAGCAAAGCTGTCAGGG - Intergenic
1071107396 10:82114474-82114496 CAGGCACAGCTTATCTATAAAGG - Intronic
1073876676 10:107931412-107931434 TAAATTCAGAATACCTATAATGG + Intergenic
1075986872 10:126795953-126795975 CAAGTTCAGCATAAGCATTATGG - Intergenic
1077954768 11:7004503-7004525 CAAGTTCAGCCTATATTCAAGGG - Intronic
1082766650 11:57173895-57173917 CAATTTCCTCATATCTAAAATGG - Intergenic
1085812165 11:79693953-79693975 GAAGTGCATCATATTTATAATGG + Intergenic
1087203371 11:95368208-95368230 CAAGTGCAGCATCCCTAGAAGGG + Intergenic
1087398117 11:97628500-97628522 TTAGTTCAGCATATATAGAATGG + Intergenic
1087980943 11:104613848-104613870 GAAGCTCATCTTATCTATAAAGG + Intergenic
1088077502 11:105869021-105869043 CTAGTCCAGCAGATCTGTAAAGG - Intronic
1090288541 11:125521436-125521458 CAACTTCATCATATCTAAATGGG + Intergenic
1090735068 11:129605692-129605714 AAATTTCAGAATTTCTATAAAGG + Intergenic
1091724560 12:2836668-2836690 TAACTTCACCATATCTGTAAAGG - Intronic
1094365541 12:29676060-29676082 AAAGCACACCATATCTATAAAGG + Intronic
1094620260 12:32074076-32074098 TAAATTCTGCATATCTATATTGG - Intergenic
1096465105 12:51844130-51844152 CAATTTCATCATTTCTAAAATGG - Intergenic
1097810057 12:64009152-64009174 GAAGTTCAGCATATTGAAAATGG + Intronic
1098553262 12:71788490-71788512 CAACTTCAGTATATATACAAAGG + Exonic
1102416658 12:112768527-112768549 CAAGGCCAGCATAGCTCTAAGGG - Intronic
1102814328 12:115851531-115851553 TAAGTTATGCATATCTATATGGG - Intergenic
1106027524 13:25969117-25969139 CCACTTCAGCATATCTAAATGGG + Intronic
1106073009 13:26431562-26431584 CAGGGTAAGCATATTTATAAAGG + Intergenic
1107563240 13:41576573-41576595 CAAGTTCAGCATATCTATAATGG - Intronic
1107997021 13:45871070-45871092 CCAGGTCAGGAAATCTATAATGG + Intergenic
1108152111 13:47547013-47547035 CAAGTTTAGTATATTTAGAAAGG - Intergenic
1109386906 13:61642144-61642166 CAAGATGAGCCAATCTATAAAGG - Intergenic
1110606938 13:77443614-77443636 CAAGGTCAGAATGTCAATAATGG - Intergenic
1113170063 13:107491208-107491230 CAGGTTCAGAACATTTATAAAGG + Intronic
1114620405 14:24093216-24093238 CAAACTCAGCATATCTATGATGG - Intronic
1114928700 14:27439091-27439113 CTAGTTAAGCATTTTTATAAAGG - Intergenic
1116177194 14:41486624-41486646 CAAGTTCTGCATATGTATCCTGG + Intergenic
1116185597 14:41597228-41597250 AAAGTTCAACGTATCTAGAACGG - Intergenic
1116529539 14:45951905-45951927 TCACTTCAGCATATCTAAAATGG - Intergenic
1117422414 14:55559925-55559947 CAAGTTCCTCATATGTAAAAAGG - Intronic
1118906696 14:70028647-70028669 AAAGGTCAGCACATCTAAAAAGG - Intronic
1120555397 14:85924041-85924063 CAAGTTCAGGATTGATATAATGG + Intergenic
1120801938 14:88699880-88699902 CAGATTCAACATATCTAAAATGG - Intronic
1121805292 14:96814699-96814721 CATATGCAGCATATGTATAATGG + Intronic
1125436619 15:39652440-39652462 CAAGTTCAACTTATATATATAGG + Intronic
1125876535 15:43151886-43151908 CATGTTCACCACAACTATAAAGG - Exonic
1127691438 15:61401089-61401111 CATGTTCAGTAAATCTATGATGG + Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1131518429 15:93095148-93095170 CCAGCTCAGCACAGCTATAATGG - Intergenic
1132135591 15:99335372-99335394 CAACTTCAAAATAACTATAAAGG - Intronic
1138849657 16:60611900-60611922 CAAGGTTAGCAAATCTGTAAGGG - Intergenic
1139199353 16:64956928-64956950 CAAGTGCAGTCTATCTATCAAGG - Intronic
1144456237 17:15421116-15421138 CAAGTTCAGCATATGTATCCCGG + Intergenic
1146247855 17:31306445-31306467 CAAATTCAACATATTTAAAATGG + Intronic
1147537787 17:41332236-41332258 CAATTTCAGCTTAGCTATCAGGG - Intergenic
1150627373 17:66850041-66850063 CAAGTTCAGCAGATCACAAAGGG + Intronic
1155037793 18:22039825-22039847 CAAATTCATCATATCTAAATCGG + Intergenic
1157294003 18:46428929-46428951 GAAGATAAGCATGTCTATAAAGG - Intronic
1158263496 18:55634953-55634975 CAAATTCAATATATCTAAAAAGG - Intronic
926958159 2:18324476-18324498 CAAGTTCTTCATATATAAAATGG + Intronic
927421245 2:22933229-22933251 CAAGCTCAGCATTCCAATAATGG + Intergenic
928636189 2:33249251-33249273 CAAGCTCAGCATTCCAATAATGG - Intronic
931169645 2:59789349-59789371 CAAACTCAGCATATCCAGAATGG - Intergenic
935237093 2:101148669-101148691 CAAATTCAGCATCACAATAAAGG + Intronic
936949078 2:117959049-117959071 AAAGTTCTGCAACTCTATAAGGG + Intronic
938154620 2:128923547-128923569 CAAAATCAGTATATTTATAATGG - Intergenic
938730235 2:134141696-134141718 CAAATTCCGCATATCTTTCAAGG - Intronic
939257855 2:139767768-139767790 TAACTTCAGCTTATCTTTAAAGG - Intergenic
941366229 2:164614813-164614835 CAAGTTCAGCATGTCCAAAGTGG + Intronic
942568909 2:177293770-177293792 CAAGTTTAGGATAACTATATTGG - Intronic
944274666 2:197822235-197822257 CAAATTCTGCACATCTAGAAGGG - Intronic
944722545 2:202438760-202438782 TCAGTTCACCATATATATAAGGG + Intronic
945182779 2:207108786-207108808 CCAGTTGAGGATATTTATAATGG - Intronic
947515276 2:230798300-230798322 CAAATTCAGAATATCTAAATAGG - Intronic
1169035381 20:2446707-2446729 CAAATAAAGCATATCAATAATGG + Intergenic
1175483671 20:59329437-59329459 CAACTTCAGCTTTCCTATAAAGG + Intergenic
950319147 3:12033888-12033910 AAAATGCAGTATATCTATAAAGG - Intronic
951124243 3:18964666-18964688 CAAGTTCAGACCATATATAACGG - Intergenic
951620412 3:24595417-24595439 CAAATTCGACATATCTAAAACGG - Intergenic
952671269 3:35972475-35972497 AAAGTTCAGCAAACTTATAAAGG + Intergenic
955222163 3:57032163-57032185 CAAGTTGAGCATATTTGTCATGG - Intronic
955545443 3:60023739-60023761 CTAGTTGAGCCTATCTATAAAGG - Intronic
956156058 3:66298400-66298422 CACTTTCAGCATATTTTTAATGG + Intronic
956188286 3:66583258-66583280 CAAGTTCTGAATGTCTCTAATGG + Intergenic
957564844 3:81871109-81871131 CAACTTCAGCAGTTCTAAAAAGG + Intergenic
957786879 3:84894326-84894348 CATTTTCAACACATCTATAATGG - Intergenic
957815875 3:85296463-85296485 CAAGTACAGAATATCAATATAGG - Intronic
958580588 3:96015710-96015732 GAAGTTCATCATATATATATGGG - Intergenic
959239629 3:103773118-103773140 CAACTTAATCATATCTGTAAAGG + Intergenic
959511862 3:107222422-107222444 CAAATTCATCATCTGTATAATGG + Intergenic
959586245 3:108027404-108027426 CATGTTCAACATCTCTATTAGGG + Intergenic
960856908 3:122111241-122111263 CAAATATATCATATCTATAATGG - Intronic
961112396 3:124296239-124296261 CAAACTCAGCACATCTAAAACGG + Intronic
963584690 3:147171044-147171066 GAAATTCATCATATCTGTAATGG - Intergenic
963720737 3:148859062-148859084 CAAGTTCACCATATATAAATAGG - Intronic
964518471 3:157538739-157538761 CAAGTTCTGAATATCTTTGAGGG - Intergenic
969555041 4:7901973-7901995 CAAATTAAGCATTTCTTTAATGG - Intronic
971420959 4:26473821-26473843 CAAACTCACCATATCTAAAATGG - Intergenic
972149767 4:36074992-36075014 TTAGTTCCGCAAATCTATAATGG + Intronic
974130542 4:57749379-57749401 CACCTTCAAAATATCTATAAAGG - Intergenic
974151553 4:58016556-58016578 CAAATTCACCATATCTGTACTGG + Intergenic
977288781 4:95140751-95140773 CAATGTTAGAATATCTATAATGG - Intronic
977546750 4:98391960-98391982 CAAGCTCAGCTTATCAATATGGG + Exonic
979127644 4:116996371-116996393 AAAGTTCAGCATATCATTATAGG + Intergenic
981446854 4:144849979-144850001 CAAGGTCAGTATGTCTAAAATGG - Intergenic
981906318 4:149925419-149925441 GAAGTTCAGCATATAAATTATGG - Intergenic
983370701 4:166854109-166854131 TAAGTTCAATATATCTATAATGG - Intronic
983910576 4:173234417-173234439 GAAATTCAGCATATCTAAAAGGG + Intronic
986427240 5:7646030-7646052 CAACTTCCGCACATCTATTATGG + Intronic
992589892 5:78283681-78283703 CAAATTCAGCAGATCCAAAACGG + Intronic
993181368 5:84557668-84557690 CATCTTCAGAATATCTAGAAAGG + Intergenic
995828296 5:116326117-116326139 AAGGTGTAGCATATCTATAATGG + Intronic
995958391 5:117808908-117808930 CAAATTTAGCATAGGTATAAAGG + Intergenic
999490130 5:152042092-152042114 AAATTCCAGCATATCTCTAAAGG + Intergenic
999638525 5:153647524-153647546 CAATTTCAGCACTTATATAATGG + Intronic
999729762 5:154467929-154467951 CAAATACAGCATCTCTATGAGGG - Intergenic
1000601455 5:163280486-163280508 CTAGTTCAGAATTTTTATAATGG - Intergenic
1001025105 5:168217463-168217485 TACGTTCAGCCTTTCTATAACGG + Intronic
1001342504 5:170861219-170861241 CAAGTTCAGCATTTCCATTTGGG - Intergenic
1004745240 6:18502675-18502697 CAAGTTCAGAAAATTTAAAAAGG + Intergenic
1005005331 6:21282070-21282092 TGAGTTCAGGATATTTATAAAGG - Intergenic
1008338678 6:50337447-50337469 CAAGTTCAGCTTATTAAAAATGG + Intergenic
1008348854 6:50464265-50464287 CAACTTCAGCAAAACTATAGAGG - Intergenic
1010043735 6:71417633-71417655 CAAGCTCAGCATTCCAATAATGG + Intergenic
1010669387 6:78669811-78669833 CAAGTTCATCATGTGTAAAATGG - Intergenic
1010794204 6:80100670-80100692 CAAGCTCAACATATCTTTCAGGG - Intergenic
1012292008 6:97468415-97468437 CAATTTCATCTTATCTAGAATGG - Intergenic
1012812634 6:103980453-103980475 CAAGTAGAGCATAACTACAAGGG + Intergenic
1014784363 6:125600520-125600542 TAAGCTCAGCATATCCTTAAAGG - Intergenic
1015678612 6:135779525-135779547 CAACTTCATCATCTCTTTAAAGG + Intergenic
1021895469 7:25231011-25231033 CAAGTTCAGTATGTCTGAAATGG + Intergenic
1025784363 7:64631178-64631200 AAGGTTCAGCACACCTATAAAGG + Intergenic
1026577150 7:71581776-71581798 CAAACTCAGCATTTCTAAAATGG - Intronic
1026775097 7:73226358-73226380 CAGGTTCTCCATTTCTATAATGG + Intergenic
1027015954 7:74779729-74779751 CAGGTTCTCCATTTCTATAATGG + Intronic
1027072075 7:75166208-75166230 CAGGTTCTCCATTTCTATAATGG - Intergenic
1029010403 7:97254892-97254914 TAAGTTCAACAGATCTATCATGG + Intergenic
1030419450 7:109289358-109289380 GATGTTCAACATATCAATAATGG - Intergenic
1031500378 7:122507290-122507312 GATGTTCAGAATTTCTATAAAGG + Intronic
1031729691 7:125283562-125283584 TAAGTTCTGCATATCTATACTGG + Intergenic
1038556800 8:28525721-28525743 CAGGAGCAGCATATCTTTAAAGG + Intronic
1039107069 8:34001409-34001431 CAACTGAAGCATATTTATAAGGG + Intergenic
1039283985 8:36019664-36019686 CAAATTCAACATGTCTACAATGG + Intergenic
1040547615 8:48411491-48411513 CAAATTGAGAATATCAATAAAGG + Intergenic
1041511374 8:58658784-58658806 CAGGTCCAGCATATCTGAAAGGG + Intronic
1044654285 8:94531226-94531248 CAAAATCTGCATATATATAATGG + Intronic
1044682903 8:94799997-94800019 CAAGCTTAGCATTTCAATAATGG + Intergenic
1045019503 8:98029605-98029627 CAAGTTCAGCATATTTGTCCGGG - Intronic
1045735605 8:105293105-105293127 CAAACTCAACATATCTAAAATGG - Intronic
1045895838 8:107215583-107215605 CAAGCTCTGCAGATCTCTAAGGG + Intergenic
1046455140 8:114449458-114449480 AAAGTACAGCATATAAATAAGGG + Intergenic
1048430150 8:134362649-134362671 CAATTTCTGCATCTCTAAAATGG - Intergenic
1048693648 8:136997879-136997901 CAAGTTCAGCATATTTTTGTGGG + Intergenic
1052531015 9:29683819-29683841 CAATTTCTGCATCACTATAAAGG - Intergenic
1052769880 9:32677841-32677863 CAAATGCAACATATCCATAATGG + Intergenic
1053405969 9:37876171-37876193 AAGGGTCATCATATCTATAATGG - Intronic
1053698098 9:40657411-40657433 GAATTTCAGCATCTATATAAAGG + Intergenic
1054309389 9:63456819-63456841 GAATTTCAGCATCTATATAAAGG + Intergenic
1054408183 9:64780941-64780963 GAATTTCAGCATCTATATAAAGG + Intergenic
1054441331 9:65264768-65264790 GAATTTCAGCATCTATATAAAGG + Intergenic
1054488946 9:65756721-65756743 GAATTTCAGCATCTATATAAAGG - Intergenic
1058452478 9:105110071-105110093 CAAGGTCAGCATGGCTAGAATGG + Intergenic
1058637121 9:107047921-107047943 CAAATGCAGCATGTCTGTAACGG + Intergenic
1058647141 9:107141208-107141230 CAATTTCAACATATCCAAAATGG - Intergenic
1059644151 9:116247803-116247825 CAAATTCAGCATCTCTAAAGTGG - Intronic
1061589967 9:131591882-131591904 CAAGTTCCTCATCTCTAAAAGGG - Intronic
1202780460 9_KI270717v1_random:30601-30623 GAATTTCAGCATCTATATAAAGG + Intergenic
1186073199 X:5845478-5845500 AAAGTTCAGCATATTAACAAAGG + Intronic
1187702515 X:21976628-21976650 CAAGAGCAGAACATCTATAAAGG + Intronic
1188593721 X:31871023-31871045 CCAGTTTAGAATTTCTATAAAGG - Intronic
1192688932 X:73339232-73339254 CAATCTCATAATATCTATAAAGG + Intergenic
1194116071 X:89899983-89900005 TGAGCTCAGCATAGCTATAAGGG + Intergenic
1195372423 X:104190787-104190809 GAAGTTTAGCAGATCTACAAGGG - Exonic
1195412986 X:104589129-104589151 CAAGTTTAGCATTCCAATAATGG + Intronic
1195738509 X:108038111-108038133 CACGTTCTGCATATGTATCATGG - Intergenic
1196317773 X:114249358-114249380 GAAATTCTGCATATGTATAATGG - Intergenic
1196684516 X:118498990-118499012 TAAGTTCAGCATTTTTATGAAGG + Intronic
1200468869 Y:3557108-3557130 TGAGCTCAGCATAGCTATAAGGG + Intergenic
1201266057 Y:12207889-12207911 CCATTTGAGCATATCTAGAAGGG - Intergenic