ID: 1107565350

View in Genome Browser
Species Human (GRCh38)
Location 13:41597784-41597806
Sequence GTCCTCCCCCATCTCAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107565346_1107565350 4 Left 1107565346 13:41597757-41597779 CCACCCTAGAAAACCTGTTCTCT 0: 1
1: 0
2: 1
3: 10
4: 214
Right 1107565350 13:41597784-41597806 GTCCTCCCCCATCTCAGTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 175
1107565344_1107565350 13 Left 1107565344 13:41597748-41597770 CCCTGGATTCCACCCTAGAAAAC 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1107565350 13:41597784-41597806 GTCCTCCCCCATCTCAGTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 175
1107565347_1107565350 1 Left 1107565347 13:41597760-41597782 CCCTAGAAAACCTGTTCTCTCTA 0: 1
1: 0
2: 2
3: 15
4: 260
Right 1107565350 13:41597784-41597806 GTCCTCCCCCATCTCAGTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 175
1107565348_1107565350 0 Left 1107565348 13:41597761-41597783 CCTAGAAAACCTGTTCTCTCTAA 0: 1
1: 1
2: 0
3: 17
4: 295
Right 1107565350 13:41597784-41597806 GTCCTCCCCCATCTCAGTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 175
1107565345_1107565350 12 Left 1107565345 13:41597749-41597771 CCTGGATTCCACCCTAGAAAACC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1107565350 13:41597784-41597806 GTCCTCCCCCATCTCAGTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 175
1107565349_1107565350 -9 Left 1107565349 13:41597770-41597792 CCTGTTCTCTCTAAGTCCTCCCC 0: 1
1: 0
2: 0
3: 18
4: 295
Right 1107565350 13:41597784-41597806 GTCCTCCCCCATCTCAGTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107565350 Original CRISPR GTCCTCCCCCATCTCAGTGA AGG Intronic
900584548 1:3426097-3426119 GTCCTCTCCCACCTCAGAGTCGG + Exonic
902579440 1:17398981-17399003 CTTCTCCCCCATCTCGGTTAGGG + Intronic
902880725 1:19370240-19370262 GTCCTCTCCCATCACAGTACAGG + Intronic
902962007 1:19970458-19970480 GCCCTGCCCCATCTCAGGGAGGG + Intergenic
903178535 1:21594199-21594221 GACCTCCCCCAGCTCTGTTATGG + Intergenic
905390351 1:37632408-37632430 GGCCTCCCCCACCTCTGGGATGG + Intronic
905647375 1:39633761-39633783 GGGTTTCCCCATCTCAGTGAAGG + Intronic
905969484 1:42130700-42130722 GTACTCCACCAGCTCACTGATGG - Intergenic
907708220 1:56851366-56851388 CCCCTCCCCCATCCCAGTGCAGG + Intergenic
907722576 1:56985834-56985856 TTCCTCCTCCAACTCACTGATGG + Intergenic
909588101 1:77313661-77313683 GTCCTCCCCTGTCTCAGTTATGG + Intronic
912450546 1:109765192-109765214 TGCCTCCCCCAACTCCGTGAAGG + Intronic
913057433 1:115175509-115175531 GTCCTGTCCCATCTGGGTGAAGG - Intergenic
916907736 1:169306903-169306925 TTGCTTTCCCATCTCAGTGACGG - Intronic
919853217 1:201687853-201687875 ATCTTCCCCCATCTGAGGGAGGG - Intronic
919869199 1:201807891-201807913 GTCCTCCCCCATCCCAGTAGTGG + Intronic
1063391198 10:5650858-5650880 GTCGTCTCCCATCTCAATCAGGG + Intronic
1064133450 10:12730341-12730363 GTGCTTCCCCATCTTAGTCATGG - Intronic
1065855753 10:29828605-29828627 GTCCTCCCCCATTTCACTTTTGG - Intergenic
1069749618 10:70736843-70736865 ATCCACCCCCATGCCAGTGATGG - Intronic
1073101491 10:101008951-101008973 CTCCTCCCCCATCTGGGTGGAGG + Intronic
1073350523 10:102816478-102816500 GTCCTCCCCTCTCTCTGTCAGGG + Intergenic
1076569977 10:131426172-131426194 GTCTGCTCCCATCTCAGTGTGGG + Intergenic
1076871184 10:133195880-133195902 CTCCACCCCCAGCTCAGCGAGGG - Intronic
1079676678 11:23236352-23236374 TTCCTCACCAGTCTCAGTGATGG + Intergenic
1083195883 11:61087160-61087182 GTCATCCTCCACATCAGTGAAGG + Intergenic
1084406485 11:68976865-68976887 GTCCTCCCACCACTCACTGATGG - Intergenic
1084602705 11:70155626-70155648 GTCATGCCCCATCTCACAGATGG - Intronic
1086514648 11:87597812-87597834 GTCCTGCCCTTTCTCTGTGAGGG + Intergenic
1088565093 11:111162969-111162991 CTCCTCCCTCTGCTCAGTGATGG - Intergenic
1089186407 11:116618529-116618551 ATGCTCCCCCATCTAAGAGAAGG + Intergenic
1089683076 11:120130309-120130331 CTCCTGACCCAGCTCAGTGATGG + Intronic
1090484137 11:127097266-127097288 GTTCTTCCTCATGTCAGTGAGGG + Intergenic
1092869090 12:12789802-12789824 GTCCGCACCCTTCCCAGTGATGG + Exonic
1098879359 12:75901274-75901296 GTCCTCACTCACCTCAGTGGAGG + Intergenic
1101722615 12:107363151-107363173 GGCCTGCCCCAACGCAGTGAGGG - Intronic
1101969760 12:109304764-109304786 GCCCTCCCACATCCCAGAGAAGG - Intronic
1102729751 12:115097910-115097932 CTCCTCCCGCATCTCTGTAAGGG - Intergenic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103394456 12:120597288-120597310 GTCCAGTCCCAGCTCAGTGAGGG - Intergenic
1103700876 12:122848195-122848217 CTCCTCCCCGGGCTCAGTGAGGG - Intronic
1103795124 12:123498109-123498131 GCATTCTCCCATCTCAGTGATGG - Intronic
1105997288 13:25685107-25685129 GGCCTCCTCCATCTCTATGAAGG + Intronic
1106358803 13:29010861-29010883 GTCCTCCACCATCTGACTGCTGG - Intronic
1107565350 13:41597784-41597806 GTCCTCCCCCATCTCAGTGAAGG + Intronic
1111826242 13:93271343-93271365 GCCCTCCCCCAAGACAGTGAAGG + Intronic
1113783928 13:112992418-112992440 CGACTTCCCCATCTCAGTGAGGG + Intronic
1113857959 13:113459206-113459228 GACCACGCCCATCTCAGTGACGG + Intronic
1116594326 14:46820375-46820397 GGCCTCCGCCAGCTCAGAGAAGG - Intergenic
1117414046 14:55477421-55477443 CCCCCTCCCCATCTCAGTGATGG + Intergenic
1117803997 14:59471017-59471039 ATCCCTTCCCATCTCAGTGAGGG - Intronic
1120358597 14:83465331-83465353 TTTCTCCTCCATCACAGTGAAGG + Intergenic
1122263373 14:100535534-100535556 GGCTGCCCCCAGCTCAGTGAGGG + Intergenic
1126522107 15:49606579-49606601 GACCTCCCACATCAGAGTGAAGG + Intronic
1128066906 15:64770823-64770845 GTTCACCCACATCTCAGGGAGGG + Intronic
1130042816 15:80419178-80419200 GTGCTGCCCCATCTCAGTTTTGG + Intronic
1132190501 15:99851979-99852001 GTTGTGCCCCATCTCACTGAGGG + Intergenic
1134190187 16:12115024-12115046 GTCATCCCCCATTTCACAGATGG - Intronic
1134192433 16:12132508-12132530 GTGCTTCCTCATCTCAGGGATGG + Intronic
1137334894 16:47538535-47538557 TACCTCCCTCATTTCAGTGAAGG - Intronic
1138456394 16:57123499-57123521 CTGCACCCCCATCCCAGTGAGGG + Intronic
1140206384 16:72937054-72937076 GGGCTCCCCCATCTCGGTTAGGG - Intronic
1140978662 16:80084969-80084991 GACCTCCCACAGCTCAGGGAAGG + Intergenic
1141028979 16:80571512-80571534 CTCCCTCCCCATCTCAGTAAAGG + Intergenic
1144834146 17:18148218-18148240 GCCTTCCCCCACCTCAGTGAGGG + Intronic
1145941936 17:28747196-28747218 CCCCTCCCCCATTTCAGTGAAGG + Exonic
1147663387 17:42129594-42129616 GCCCTCCCCCAGCTCACTGAGGG + Intronic
1147894262 17:43740193-43740215 TTCCTCCAACATATCAGTGAGGG - Intergenic
1149435796 17:56632212-56632234 CTCATCCCCCATCTCACAGAAGG + Intergenic
1149639323 17:58192889-58192911 GTCCTCGCCCAGCCCTGTGAGGG + Exonic
1151605237 17:75131459-75131481 GGTCTCCCCCTTCTCTGTGAAGG - Intronic
1203172261 17_GL000205v2_random:158933-158955 ATCCACCCCCATTACAGTGAGGG + Intergenic
1203173456 17_GL000205v2_random:173817-173839 ATCCACCCCCATTACAGTGAGGG - Intergenic
1157527356 18:48394096-48394118 ATTCTACCCCATCTCAGTGTAGG - Intronic
1157562095 18:48655528-48655550 GTCCACACCCTTCTCAGTGCAGG - Intronic
1161306993 19:3573810-3573832 GGCCTCCCCCAGCTCAGCGCAGG - Intronic
1161444649 19:4311360-4311382 GCCCTCCCCCAACCCACTGATGG + Intronic
1165107758 19:33483850-33483872 GACCTGCCCCATCTTAGGGAAGG + Intronic
1168282494 19:55312870-55312892 GGCCTCCCCCATCTCCCTGCCGG - Exonic
925043179 2:749752-749774 GTGCTCGCCCACATCAGTGAGGG + Intergenic
925299493 2:2800408-2800430 TTCCTGCCACATCACAGTGAGGG - Intergenic
926160158 2:10482123-10482145 ATCCTCCCTCATATGAGTGATGG - Intergenic
926749911 2:16190459-16190481 GTCTTCTCCCTTTTCAGTGAGGG + Intergenic
927060303 2:19412448-19412470 GTGCTCCCCCAGCTTGGTGAGGG + Intergenic
927267236 2:21163628-21163650 GTTCTCAGCCATGTCAGTGATGG - Intergenic
930054412 2:47240874-47240896 GTCCTCTCCCATCACCCTGAAGG - Intergenic
933305188 2:80588711-80588733 GCCCTCCCCCATCTCCTTTAGGG - Intronic
933772876 2:85754979-85755001 GTCGTCCCCCGGCGCAGTGAGGG - Intronic
936346616 2:111680331-111680353 GTCCACTCCCATCTCACTGGTGG + Intergenic
936618449 2:114072028-114072050 GTCCTCTCCCATCTGAAAGAGGG + Intergenic
937745209 2:125404043-125404065 GTCTTCCCTCGTCTCAGTGGAGG - Intergenic
939247665 2:139646018-139646040 GCTCTCCCCCATCACAGTCATGG - Intergenic
940739308 2:157488993-157489015 GCCCTCCCCCAGCTCTGTGCAGG - Intergenic
941978764 2:171433183-171433205 TGCCTCCCACATCTCAGTGCAGG - Intronic
942239645 2:173948514-173948536 GTCGCCCCCCTTATCAGTGAGGG - Intronic
946399290 2:219460248-219460270 TTCTTCCCCCACCTCTGTGAAGG + Intronic
1169135159 20:3192785-3192807 GTCCTCCCCCAGCTCATTTGCGG - Intronic
1172106820 20:32522041-32522063 GTCCTTCTCCATCTCTGTGATGG + Intronic
1175731444 20:61357050-61357072 GGCACCCCGCATCTCAGTGAGGG - Intronic
1176328248 21:5520772-5520794 ATCCACCCCCATTACAGTGAGGG + Intergenic
1176329443 21:5535459-5535481 ATCCACCCCCATTACAGTGAGGG - Intergenic
1176398314 21:6285492-6285514 ATCCACCCCCATTACAGTGAGGG + Intergenic
1176399509 21:6300179-6300201 ATCCACCCCCATTACAGTGAGGG - Intergenic
1176437648 21:6688925-6688947 ATCCACCCCCATTACAGTGAGGG + Intergenic
1176438843 21:6703612-6703634 ATCCACCCCCATTACAGTGAGGG - Intergenic
1176461910 21:7015995-7016017 ATCCACCCCCATTACAGTGAGGG + Intergenic
1176463105 21:7030681-7030703 ATCCACCCCCATTACAGTGAGGG - Intergenic
1176485471 21:7397773-7397795 ATCCACCCCCATTACAGTGAGGG + Intergenic
1176486666 21:7412460-7412482 ATCCACCCCCATTACAGTGAGGG - Intergenic
1179452818 21:41477277-41477299 GTCTTGCCCCATCTCAGGCATGG - Intronic
1180623608 22:17179142-17179164 GTCCTCACCCAACTCAAGGATGG - Exonic
1181854265 22:25770950-25770972 CTCCTCATCCACCTCAGTGATGG - Exonic
1184238542 22:43199614-43199636 GTCCTCCCCCACCTCCATGGTGG - Exonic
1184256947 22:43292690-43292712 GTCCTCTCCCAGTTCAGTGCAGG - Intronic
1184471192 22:44697390-44697412 CTTCTCGCCCATCTCAGGGAAGG + Intronic
1184497453 22:44850216-44850238 GACCTTCCCCATCTCAGAAAGGG - Intronic
1184537825 22:45099625-45099647 GGCCTCCCCCAGCACAGAGAAGG - Intergenic
1185245086 22:49769276-49769298 GTGCTCCCCCTTCTGAGGGATGG - Intergenic
949642456 3:6053601-6053623 TTCCTCCCCATTGTCAGTGATGG - Intergenic
950506480 3:13397846-13397868 GTAATCCCTAATCTCAGTGAAGG - Intronic
951313927 3:21164950-21164972 TTCCTCCCCCATTACTGTGAAGG + Intergenic
952481205 3:33763623-33763645 CTCCTCCCCCAACACTGTGATGG - Intergenic
953259637 3:41325021-41325043 GTCCTCCCCCATCTTCCTGCTGG - Intronic
953914047 3:46906649-46906671 GTCCTCCCAGATCCCAGGGAGGG - Intergenic
954672178 3:52297088-52297110 GTCCTCCCTCACCTCAGTCTGGG - Intergenic
954993660 3:54862623-54862645 TTCCTCAGCCATCTCAGAGATGG + Intronic
961783035 3:129332523-129332545 GTCCTCCCAGAACTAAGTGAGGG + Intergenic
961829872 3:129617995-129618017 CTCGGCCCCCATCTCACTGAGGG - Intergenic
965441494 3:168720742-168720764 GTCCCCTCCCATCTCTGTGATGG + Intergenic
969380643 4:6794796-6794818 GACCTTCCCCATGTCAGTCAAGG - Intronic
969468803 4:7374333-7374355 CTCCTCCCCCATGTGAGAGAGGG + Intronic
969910188 4:10437476-10437498 CTCCTCTCCTGTCTCAGTGATGG + Intergenic
971405378 4:26317799-26317821 GCCCTCCCCCATCTCAGGAAAGG - Intronic
971596770 4:28539493-28539515 ATCCTAATCCATCTCAGTGAAGG + Intergenic
977068740 4:92354200-92354222 GTCCTCGCCCCACTCATTGATGG - Intronic
977918676 4:102620705-102620727 TTCCTCCCAGATCTCAGTGCTGG + Intergenic
980105900 4:128588199-128588221 GTGCTCCCCCATTTCAAGGAAGG - Intergenic
983453419 4:167933924-167933946 GTCCTCCACCAGCTCAGTGAAGG - Intergenic
984743936 4:183195437-183195459 TTCCTCCTCTTTCTCAGTGAAGG + Intronic
985492273 5:186893-186915 TTCCTCCCCCACCTCAGTACTGG + Exonic
987631374 5:20477604-20477626 GGACTCTCCCATCCCAGTGATGG + Intronic
989645096 5:43622309-43622331 GGCCTTCCCCATCTGAGTAAAGG - Intronic
992271522 5:75069161-75069183 CTCCTCTCACATCTCAGAGATGG - Intronic
994223787 5:97228585-97228607 TTCTTCCCCCAGCTCAGTCAAGG - Intergenic
995247067 5:109946458-109946480 GTCCTCACACAACTCTGTGATGG + Intergenic
996349629 5:122523968-122523990 GTCCTCTCCCTGCTCAGTCATGG - Intergenic
996587885 5:125111214-125111236 GTTTTCCCCCATTTCAGTGCAGG + Intergenic
998334889 5:141362350-141362372 GTTCTCCCCAATTACAGTGAGGG + Exonic
998596275 5:143533822-143533844 GTGCTACCTCATCTTAGTGAAGG + Intergenic
999379264 5:151108866-151108888 GTTCTGCCCCAGCTCACTGAGGG + Intronic
999878375 5:155833945-155833967 GTCCTTCCACAACTCAGTGTAGG - Intergenic
1001197446 5:169686298-169686320 GGCTGGCCCCATCTCAGTGATGG + Intronic
1002856567 6:1043270-1043292 GTCCTCCAGCATCTCAGCAAGGG - Intergenic
1006941731 6:37756198-37756220 CTCCTCCCCACCCTCAGTGAAGG + Intergenic
1007302288 6:40876403-40876425 GGCAGCCCCCACCTCAGTGAAGG + Intergenic
1008893671 6:56526391-56526413 CTCCTCCACCTTCTGAGTGATGG + Exonic
1011080690 6:83487329-83487351 GGCTTGCCCCATCTTAGTGAAGG + Intergenic
1013378868 6:109546223-109546245 TTCCTACCCCATCTTAGGGAGGG - Intronic
1013746957 6:113357250-113357272 GTCCTGCCCCACCTCTGAGAAGG - Intergenic
1020085009 7:5305454-5305476 GTCCACCCCCATCTAGGTGAGGG + Exonic
1021958328 7:25848877-25848899 TTCCTCCCACATTTCTGTGAAGG - Intergenic
1022585130 7:31601714-31601736 CTCGTCCCTCTTCTCAGTGACGG - Intronic
1023115999 7:36863081-36863103 GACCTGCCCCCTCTCAATGAGGG - Intronic
1023992052 7:45134332-45134354 GCCCTCTCCCACCTCAGTGTTGG - Intergenic
1024554046 7:50588016-50588038 GTCCTCCTCCATATCCGTGATGG - Intergenic
1025209281 7:57011658-57011680 ATCCACCCCCATCTAGGTGAGGG - Intergenic
1025662664 7:63565196-63565218 ATCCACCCCCATCTAGGTGAGGG + Intergenic
1029707408 7:102283099-102283121 GGCCTCCCCCGTGACAGTGACGG + Intronic
1033805895 7:144953907-144953929 TTGCTCCCACATCTCAGTGTAGG + Intergenic
1035233467 7:157480884-157480906 GTCCTGCCCCAGCTCAGGGAGGG + Intergenic
1036739032 8:11345424-11345446 GTCCTCGCCCTCCTCAGTCAAGG - Intergenic
1037175482 8:15941997-15942019 ATCCTCCCCCATGTAAGGGAGGG + Intergenic
1037259887 8:16996455-16996477 GTCCTCACCCATCTCCTTTAGGG - Intronic
1038350278 8:26770155-26770177 TTCCTCCCCGTTCTCACTGAGGG + Intronic
1039233933 8:35480849-35480871 ATTCTTCCTCATCTCAGTGAAGG - Intronic
1041363214 8:57073244-57073266 CACCTCCCCCATCTCAGGTAGGG - Intergenic
1042014495 8:64292995-64293017 TTCCTCCTCTATCTCAGGGAAGG + Intergenic
1042606678 8:70553111-70553133 GTCCCTCCCCATCCCAGTGAGGG + Intergenic
1048270697 8:133025913-133025935 TTCCTTCCCCATCCCAGTGCAGG + Intronic
1051270170 9:15347874-15347896 GGCCTCACCCAATTCAGTGAAGG + Intergenic
1056042235 9:82680340-82680362 GTCCTCTCCCACCTCAGGGAGGG + Intergenic
1056886616 9:90449304-90449326 CTCCAACCACATCTCAGTGAGGG + Intergenic
1057075551 9:92136450-92136472 GTCTTGGCCCATCTCTGTGACGG + Intergenic
1059277353 9:113107879-113107901 GTCCTTCCTCTTCTCAGTGCAGG - Intergenic
1059278898 9:113116672-113116694 GTCCTTCCTCTTCTCAGTGCAGG + Intergenic
1061882026 9:133573421-133573443 CTCCTCTCCCATCTCCCTGAGGG - Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1062280328 9:135749020-135749042 GTGCTCCCCCTTCCCAGAGACGG + Intronic
1203432652 Un_GL000195v1:104867-104889 ATCCACCCCCATTACAGTGAGGG + Intergenic
1203433856 Un_GL000195v1:119697-119719 ATCCACCCCCATTACAGTGAGGG - Intergenic
1186840996 X:13484568-13484590 GTCCTGACCCATCTCAGCAAGGG + Intergenic
1189404935 X:40712975-40712997 GTCATCTCCCATCACAGTCAAGG + Exonic
1193938979 X:87657386-87657408 CTCCTCCACCATCTCTGTCAGGG - Intronic
1195450361 X:105004912-105004934 TTCCTCCCCCACCTCACTGAGGG - Intronic