ID: 1107571442

View in Genome Browser
Species Human (GRCh38)
Location 13:41663306-41663328
Sequence ATGGAAAAGAGGAATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1417
Summary {0: 1, 1: 0, 2: 15, 3: 134, 4: 1267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107571442 Original CRISPR ATGGAAAAGAGGAATGAGGG TGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900576585 1:3385555-3385577 GTGGAAAAGAGCAATGAAGCAGG + Intronic
900686370 1:3950690-3950712 ATGCAAAAGGGGAATGGGGTGGG + Intergenic
900821673 1:4894456-4894478 AAGGAAAGGAGGAAGAAGGGAGG + Intergenic
900862962 1:5246096-5246118 ATGGAAGGAAGGAAGGAGGGAGG - Intergenic
900863132 1:5246676-5246698 AAGGAAGACAGGAAGGAGGGAGG - Intergenic
900882908 1:5394690-5394712 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
901075566 1:6552801-6552823 AAGGAAGAAAGGAAGGAGGGAGG - Intronic
901176618 1:7305292-7305314 CTGAAAAAGAGGAATAAAGGTGG - Intronic
901276451 1:7995180-7995202 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
901419755 1:9143012-9143034 ATGGAAGACAGGAGGGAGGGAGG - Intergenic
901584046 1:10272088-10272110 GTGGAAAAGAGGACAGATGGAGG + Intronic
901861187 1:12075618-12075640 ATGGCAAAGGGGAATCAGGGTGG - Intronic
902620417 1:17647525-17647547 ATGAATAAAAGGAAGGAGGGAGG - Intronic
902759003 1:18568679-18568701 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
903051023 1:20601199-20601221 ATGGAAGAGACCAATGAGAGAGG - Intronic
903170836 1:21552141-21552163 AAGGAGAAAAGGAAGGAGGGAGG - Intronic
903293763 1:22330859-22330881 AAGAAAAATAGGAATGAGGGAGG + Intergenic
903293777 1:22330919-22330941 AAGGAAGAGAGAAAGGAGGGAGG + Intergenic
904125534 1:28235933-28235955 ACTGGAAAGAGGAATGATGGAGG - Intergenic
904440133 1:30524618-30524640 AGGGAAGGGAGGAAGGAGGGAGG + Intergenic
904888195 1:33757714-33757736 ATGGAGATAAGGAATGAAGGAGG - Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905313563 1:37066842-37066864 AGGAAAGAGGGGAATGAGGGAGG - Intergenic
905352115 1:37355076-37355098 AGAGAAAGGAGGAAGGAGGGAGG + Intergenic
905352121 1:37355096-37355118 AGGGAAAAGAGGAAGGAGGGAGG + Intergenic
905352127 1:37355116-37355138 AGGGAAAGAAGGAAGGAGGGAGG + Intergenic
905396488 1:37669842-37669864 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
905766815 1:40608288-40608310 TTGGAAAACAGGAACTAGGGAGG + Intergenic
905829176 1:41050525-41050547 ATGGAAAACAGAAAGTAGGGAGG + Intronic
906001704 1:42431917-42431939 AAAGAAAAGAGGGAGGAGGGAGG + Intronic
906016677 1:42588037-42588059 ATGTAAAACAGGAATTAGTGAGG + Intronic
906173006 1:43743848-43743870 ATGTAATATAGGAATGGGGGGGG - Intronic
906264865 1:44420995-44421017 ATGGCAATGTGGAAAGAGGGAGG + Intronic
906500847 1:46341044-46341066 ACGGAAAAGACGAGAGAGGGAGG - Intronic
907378793 1:54067545-54067567 AAGGAAAAGAGGAAAGGGGAAGG - Intronic
907835731 1:58106858-58106880 AAGGGAAGGAGGAAGGAGGGAGG - Intronic
907881518 1:58553449-58553471 ATAGACAAGAGGAACGAGGCTGG - Intergenic
908333692 1:63097939-63097961 AAGGAAAAGAAGGATGGGGGAGG + Intergenic
908467062 1:64406738-64406760 ATGGAAAAGGCTAGTGAGGGAGG + Intergenic
908776105 1:67641586-67641608 ATAGAAATGAGGAGTGGGGGAGG + Intergenic
909062986 1:70900701-70900723 AGGCAGAAGAGGAATGAGAGAGG + Intronic
909692119 1:78420895-78420917 AAGGAAAGAAGGAAGGAGGGAGG - Intronic
910017985 1:82550878-82550900 AAGGAAAGAAGGAAGGAGGGGGG + Intergenic
910473216 1:87577788-87577810 ATGGAAAAGTGGAATTGGTGGGG - Intergenic
910734855 1:90442399-90442421 AGAGAAAAAAGGAAAGAGGGAGG + Intergenic
910832435 1:91474275-91474297 GTGCAAAAGAGGAATGAGAAGGG - Intergenic
910889545 1:92002954-92002976 ATGGAACAGAGGGATGGAGGGGG - Intronic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911127020 1:94350281-94350303 AAGTAAAAGAGGAATGATGAAGG + Intergenic
911261338 1:95689992-95690014 CTGGAAATGAGTAATGTGGGAGG - Intergenic
911601908 1:99856387-99856409 AAGGAAAGAAGGAAGGAGGGAGG - Intronic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912328038 1:108787407-108787429 GTGGAAAAGAGGGATAAGGAAGG - Intronic
912415685 1:109507130-109507152 ATGGGAATGAGGAAGGAGTGAGG - Exonic
912560101 1:110545005-110545027 AGGGAAAAGAGGAAGAAGGGGGG - Intergenic
912699201 1:111863954-111863976 ATTGAAATGAGGAGTGAGGTGGG + Intronic
913031555 1:114909457-114909479 AGGGAAAGAAGGAAGGAGGGAGG - Intronic
913369660 1:118083943-118083965 AGGGAAAAGAGGAAGAGGGGAGG + Intronic
913979947 1:143498815-143498837 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
914074296 1:144324299-144324321 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
914104880 1:144642147-144642169 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
914209124 1:145562240-145562262 TGGGAAAAGAGGAACTAGGGAGG - Intergenic
914369053 1:147006253-147006275 TAGGAAAAGAGGAACTAGGGAGG + Intergenic
914786995 1:150842538-150842560 AGGGAAAAAAGGAAGGAGGGAGG + Intronic
915463279 1:156082055-156082077 AGGGAAAAGAGGAGAGAGGAGGG + Intergenic
915894252 1:159799087-159799109 ATGGAGAGAGGGAATGAGGGTGG + Intergenic
916046676 1:161005275-161005297 AGGGGAAGGAGGAAGGAGGGAGG - Intronic
916193080 1:162197937-162197959 ATGCAAAGGAGGTATGAGGAGGG + Intronic
917171213 1:172176881-172176903 ATAGAAAAGAGGTTGGAGGGAGG + Intronic
917219313 1:172710985-172711007 AAGGAAAGGAGGAAGGAAGGAGG - Intergenic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
917505274 1:175621717-175621739 AAGGCAGAGAGGAAGGAGGGAGG - Intronic
917621103 1:176796870-176796892 AAGGAAGAAAGGAAGGAGGGAGG - Intronic
917656026 1:177126530-177126552 ATGGAAAACAGGAAAAAGGAAGG + Intronic
917660822 1:177175276-177175298 ATGGAAAAGCGGGGTGGGGGGGG + Intronic
918102049 1:181384926-181384948 TTGGTAAAGAGGAAAGAGGCAGG - Intergenic
918341392 1:183570613-183570635 ATGGAAACCAGGACTGAGAGAGG + Intronic
918361577 1:183764321-183764343 TGGGAAAACAGGAATCAGGGAGG + Intronic
918362158 1:183770632-183770654 TGGGAAAACAGGAATTAGGGAGG + Intronic
918372753 1:183877654-183877676 ACACAAAAGAGGAATGAAGGGGG - Intronic
918899149 1:190390205-190390227 ATATAAAAAAGGAAAGAGGGTGG + Intronic
919280889 1:195486518-195486540 CAGGAAAACAGGAATTAGGGAGG + Intergenic
919347999 1:196411038-196411060 AGGGAATAGAGGAGGGAGGGAGG - Intronic
919730245 1:200909025-200909047 ATGGAAAAGTGGAAAGGTGGAGG + Intronic
919780834 1:201219823-201219845 ATGGAATGGAGGGATGGGGGAGG + Intronic
920057408 1:203202586-203202608 ATGGGAATGAGGAATGAGCAGGG - Intergenic
920222805 1:204416658-204416680 AAAGAAAAGAAGAAAGAGGGAGG + Intergenic
920371215 1:205480641-205480663 ACGGGAAAGAGGGATGAGGCTGG + Intergenic
920501435 1:206487851-206487873 ATAGCACAGAGGAAAGAGGGAGG - Intronic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
921078964 1:211723767-211723789 CTGGAAAAGAGAAAGGAGGGTGG - Intergenic
921632439 1:217452023-217452045 ATGGAAAAGAGCACTGCGGCTGG + Intronic
921812746 1:219533116-219533138 ATGGCAAAGGGCAATGAAGGGGG - Intergenic
921819115 1:219596437-219596459 CTGGAAAAGAGGAGTGAGAAGGG + Intergenic
921936213 1:220799503-220799525 CAGGAAAAGAGAAATGAGTGGGG + Intronic
922356735 1:224783396-224783418 TGGGAAAACAGGAATTAGGGAGG + Intergenic
922485077 1:225967930-225967952 AGGGAAACGAAGAATGTGGGGGG - Intergenic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
923588470 1:235296831-235296853 AAGGAAGGGAGGAAGGAGGGAGG + Intronic
923726177 1:236507283-236507305 TTGGCAGAGAGGAATGAAGGTGG + Intergenic
923846354 1:237736967-237736989 AAGGAAATGAAGAAAGAGGGAGG + Intronic
923862055 1:237901217-237901239 ATGGAAAAGGAGAATATGGGAGG - Intergenic
924202600 1:241675167-241675189 AAGGAAAGAAGGAAGGAGGGTGG - Intronic
924279057 1:242417787-242417809 ATGGGATAGAGCAAGGAGGGAGG + Intronic
924298729 1:242614911-242614933 AAGGAAAGTAGGAAGGAGGGAGG - Intergenic
924443948 1:244111105-244111127 AGAGAAAAGAGGAGGGAGGGAGG + Intergenic
924461466 1:244263359-244263381 AAGGAAGAGAGGGAGGAGGGAGG + Intergenic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063104160 10:2978136-2978158 AAGGAAGTGAGGAAGGAGGGAGG + Intergenic
1063156286 10:3382167-3382189 AAGGAAGAAAGGAAGGAGGGAGG + Intergenic
1063197803 10:3759487-3759509 CAGGAAAGGAGGAAAGAGGGAGG + Intergenic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063349142 10:5338249-5338271 AAGGAAGAAAGGAAGGAGGGAGG - Intergenic
1063525277 10:6778969-6778991 ATGGAAGAAAGGAAGGAGAGAGG + Intergenic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1063737928 10:8782323-8782345 AAGGAAAAGAAAAATGAAGGAGG + Intergenic
1063867856 10:10386360-10386382 AGGGAAAGGAGCAATGAGAGAGG - Intergenic
1064121557 10:12623468-12623490 AAGGAAGGGAGGAAGGAGGGAGG - Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064577471 10:16760825-16760847 ATGGAGAAGAGGGTGGAGGGAGG - Intronic
1065223359 10:23518531-23518553 AAGGAAAATAGGAAAGAAGGAGG - Intergenic
1065348026 10:24767637-24767659 AAGGAAAAGAGAAGGGAGGGAGG - Intergenic
1065424659 10:25587060-25587082 GTGGAAAACAGGAATTAGGGAGG + Intronic
1065813165 10:29461003-29461025 GTGGGAAACAGGAATTAGGGAGG - Intronic
1065933439 10:30499783-30499805 AGGGAAGAGAGGAAGGAGAGAGG + Intergenic
1065958414 10:30713530-30713552 TGGGAAAACAGGAATGAAGGAGG + Intergenic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1066497878 10:35959878-35959900 AAGGGAAAAAGGAAAGAGGGAGG - Intergenic
1066502414 10:36006996-36007018 ATTGAAAAGAGGAGTGAAGTGGG + Intergenic
1066574312 10:36808967-36808989 TTGGAAAAGGGCAATGAGGCAGG - Intergenic
1066637284 10:37517296-37517318 ATGGAACAAAAGAATGAGGGAGG + Intergenic
1066954142 10:42149497-42149519 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1067859224 10:49827496-49827518 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1068534749 10:58229701-58229723 ATGAAAAAGAGGAAAGAAAGAGG + Intronic
1069095445 10:64253868-64253890 ATGGAAAAGAAAAAAGAGAGAGG - Intergenic
1069176822 10:65300651-65300673 AAGAACAAGAGGAATGATGGTGG + Intergenic
1069204947 10:65669754-65669776 ATAGAAAATAGGGAAGAGGGAGG + Intergenic
1069951470 10:72021462-72021484 TAGGAAAACAGGAATTAGGGAGG + Intergenic
1070198501 10:74180845-74180867 ATAGAAAAGAGAAATGGGGCTGG - Intronic
1070258141 10:74827442-74827464 ATGGGAAAGAGGTATCTGGGTGG + Intronic
1070350993 10:75592122-75592144 GTGGCAAAGAGGAATGAGCTGGG + Intronic
1070587383 10:77776759-77776781 TGGGAAAACAGGAATGAGGCAGG + Intergenic
1070702406 10:78613379-78613401 ATGAAAGGAAGGAATGAGGGAGG + Intergenic
1070726933 10:78798616-78798638 CTGGAATATAGGAAGGAGGGAGG - Intergenic
1071191960 10:83111106-83111128 ATGGAAAACAGAAAAAAGGGGGG + Intergenic
1071257691 10:83887424-83887446 AGTGATAAAAGGAATGAGGGTGG + Intergenic
1071346474 10:84698688-84698710 ATGCAGAAGAGGCAGGAGGGAGG + Intergenic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071822320 10:89291148-89291170 AAGGAAAAAAGGAATGAAGGAGG - Intronic
1071887588 10:89967838-89967860 AGGAAAAAGAGGAAAGAAGGAGG - Intergenic
1071930403 10:90463235-90463257 TTGTAAAAGAGGAACAAGGGAGG + Intergenic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1072278966 10:93848775-93848797 AAAGAAAACAGGAATTAGGGAGG - Intergenic
1072284421 10:93899393-93899415 AAGGAAAAGAGGAATTGGGTTGG - Intronic
1072497833 10:95980153-95980175 ATCGAAAAGAAGAGGGAGGGAGG + Intronic
1072593261 10:96846957-96846979 ATAGAAAAGAGAAATCAGGCTGG + Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072794813 10:98346610-98346632 AGGGAAAAGAGGAATGATCTGGG + Intergenic
1073048671 10:100654421-100654443 AGGGAGAGGAGGAAGGAGGGAGG - Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073735010 10:106335921-106335943 ATGGACAGGAGGCAGGAGGGCGG + Intergenic
1073761451 10:106632902-106632924 ATGGAGGAGATGAATGAGTGAGG + Intronic
1073834801 10:107429046-107429068 ATGGAAAAGAGGAGTCCTGGAGG - Intergenic
1073970143 10:109038502-109038524 AAGGAAAAGAGAAAATAGGGAGG - Intergenic
1073977385 10:109116848-109116870 TGGGAAAACAGGAATTAGGGAGG + Intergenic
1074066410 10:110018578-110018600 ATGGGAAAGAAGAACAAGGGTGG + Intronic
1074099425 10:110342653-110342675 AGGGAACAAAGGAATGAAGGAGG - Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074404548 10:113169650-113169672 AAGGAAAGAAGGAATGAGGTTGG + Intergenic
1074495614 10:113977837-113977859 ATGGGAAAGAGGAGTGAGGTGGG - Intergenic
1074609140 10:115004461-115004483 ATGGAAGGGAGGAAGGAGGGAGG - Intergenic
1074679988 10:115895790-115895812 GTGCAGAAGAGGAATCAGGGAGG + Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075153154 10:119953443-119953465 AGGGAAAGAAGGAAGGAGGGAGG - Intergenic
1075153171 10:119953495-119953517 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
1075162050 10:120032941-120032963 CTGGAAAATAGGAATTAGGGAGG + Intergenic
1075391154 10:122093233-122093255 ATTGAAAAGTGGAGGGAGGGAGG + Intronic
1075562450 10:123478169-123478191 ATGGAAAAGAGGAACGAGTTAGG + Intergenic
1075591497 10:123694659-123694681 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1075656312 10:124163391-124163413 AGGGAAGAGAGGAAGCAGGGAGG + Intergenic
1075951154 10:126478897-126478919 ATGCAAAACAGGAATGAAGCGGG + Intronic
1075954446 10:126510036-126510058 ATGGAGCAGAGGACAGAGGGAGG - Intronic
1076252363 10:128994644-128994666 GAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1076348002 10:129793854-129793876 AAGGAAAAGAGGAAGGAAGAGGG - Intergenic
1077563783 11:3283286-3283308 AGGGAAAAAAGGAGGGAGGGGGG - Intergenic
1077569673 11:3329103-3329125 AGGGAAAAAAGGAGGGAGGGGGG - Intergenic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1078175539 11:8967055-8967077 AGGGAAAAGGGGAATGGGAGAGG + Intergenic
1078359385 11:10656794-10656816 GTGGAAGAGAGGAAAGATGGCGG - Intronic
1078726789 11:13939208-13939230 TTGGAAAAGTGGTATTAGGGTGG + Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078973738 11:16446947-16446969 AAGGAAAAAAGGAAAGAAGGAGG - Intronic
1078973744 11:16446982-16447004 AAGGAAAGGAGGAGGGAGGGAGG - Intronic
1079134947 11:17771129-17771151 ATGGAAAAGAGCAAAGAGCCTGG + Intronic
1079305598 11:19318683-19318705 ATGGGAATGAGTAATGATGGGGG + Intergenic
1079868715 11:25768099-25768121 AAGGAAAAGAGGGAGGATGGAGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080050242 11:27851969-27851991 AAGGAAGGGAGGAAGGAGGGAGG - Intergenic
1080292391 11:30685377-30685399 ATGACAAAGATGAATGGGGGTGG + Intergenic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1081575219 11:44314927-44314949 AAGGAAAAAAGGACAGAGGGAGG - Intergenic
1081943396 11:46964939-46964961 TGGGAAAACAGGAATTAGGGAGG + Intronic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1083997545 11:66279586-66279608 ATGGGAAATGGGATTGAGGGAGG - Intronic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1084977233 11:72808494-72808516 CTGGAAAAGAGAAATGGGTGTGG - Intergenic
1085036390 11:73302729-73302751 ATTGAACAAATGAATGAGGGAGG - Intergenic
1085090841 11:73712307-73712329 ATGGAAAATAAGTATGAAGGTGG - Intronic
1085282649 11:75341053-75341075 ATGGAAAAGAGGGATGAAAGAGG + Intronic
1086110711 11:83194907-83194929 ATGGAAAAAAGGAAAGAAAGCGG - Intronic
1086148422 11:83580921-83580943 AAGGAAGGGAGGAATGAGGGAGG - Intronic
1086213896 11:84353944-84353966 ATGGAGGAGAGGAATGAGAGTGG - Intronic
1086482531 11:87258358-87258380 ATGTATAAGAGGAAAGAGGCTGG - Intronic
1086546424 11:87972966-87972988 AAGGAAGAGAGGAAAGGGGGAGG - Intergenic
1086726298 11:90188954-90188976 ATGACAAAGAGGAATTAAGGTGG + Intronic
1086972210 11:93094869-93094891 AGGGAAAAAAGGAAGAAGGGAGG - Intergenic
1086980771 11:93195890-93195912 AGGGAAATCAGGAATGAGGGTGG - Intronic
1087022726 11:93619419-93619441 AAGGAAAATAGGAATGAGCTTGG + Intergenic
1087380497 11:97399024-97399046 AGAGAAAAGAGGAAAGAGTGGGG - Intergenic
1087610776 11:100431898-100431920 AAGCAAAAGTGGGATGAGGGAGG + Intergenic
1088105397 11:106201377-106201399 ATGTAAGAGAGGTATGAAGGGGG + Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088829257 11:113521390-113521412 AAGGAAAGGAGGAAAGAGTGAGG - Intergenic
1088841010 11:113627493-113627515 AGGAAAAGGAGGAAGGAGGGAGG + Intergenic
1089124307 11:116165586-116165608 ATGAAAAAGAGGAAATATGGAGG - Intergenic
1089313888 11:117577551-117577573 AAGGAAAGAAGGAAGGAGGGAGG - Intronic
1089590802 11:119539508-119539530 CAGGAAAACAGGAATTAGGGAGG - Intergenic
1089652009 11:119920613-119920635 CAGGAGAAGAGGAATTAGGGTGG + Intergenic
1090088949 11:123677089-123677111 TTAGAAAATAGCAATGAGGGTGG + Intergenic
1090099528 11:123779431-123779453 CAGGAAAACAGGAATTAGGGAGG + Intergenic
1090217664 11:124984216-124984238 CTGGAAAAGTGGCATGAGGGAGG + Intronic
1090264711 11:125346754-125346776 AAGGAAGGGAGGAAGGAGGGAGG + Intronic
1090387317 11:126364634-126364656 ATGGAAGCCAGGAGTGAGGGAGG - Intronic
1090389881 11:126381832-126381854 ATGGAAGCCAGGAGTGAGGGAGG - Intronic
1090556204 11:127879092-127879114 GTAGAAGAGAGGAAGGAGGGAGG - Intergenic
1090621682 11:128566321-128566343 AAGGAAAAGAGAATTGATGGAGG + Intronic
1090630772 11:128645373-128645395 AGAGAAAAAAGGAAGGAGGGAGG + Intergenic
1090969246 11:131625521-131625543 ACTGAAAAGATGAAGGAGGGAGG + Intronic
1090996221 11:131868306-131868328 AGGAAAAAGAGGTAGGAGGGAGG - Intronic
1091008484 11:131976108-131976130 AAGGAAGGAAGGAATGAGGGAGG - Intronic
1091316380 11:134616835-134616857 ATGGAAATTAGGAATTTGGGGGG + Intergenic
1091335134 11:134760969-134760991 ATGGAAAGAAGGAAGGAGGGAGG - Intergenic
1091337223 11:134781514-134781536 GTGGAAAAGAGGAAAGAAGAGGG - Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1092113301 12:5980132-5980154 AAGGAAGAAAGGAGTGAGGGAGG + Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092627440 12:10342143-10342165 TGGGAAAATAGGAATTAGGGAGG - Intergenic
1092678337 12:10947452-10947474 ATGGAAAACAGAAAAAAGGGGGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1092920814 12:13230349-13230371 AAGGAAAAAAGGAGGGAGGGAGG - Intergenic
1093426822 12:19037112-19037134 CTGGAAAACAGGAATTAGGAAGG + Intergenic
1094077260 12:26491033-26491055 ATGCATAAGAGGAAGGATGGAGG + Intronic
1094183455 12:27616114-27616136 AGGGAAAAGAGGAGGGAGGAAGG - Intronic
1094433737 12:30398454-30398476 TTGGAAAACAGGAACTAGGGAGG + Intergenic
1094440577 12:30471384-30471406 TTAGAAAAGAGGAATTAGGCCGG - Intergenic
1094570511 12:31637409-31637431 AAGAAAGAGAGGAAGGAGGGAGG - Intergenic
1095251848 12:39988644-39988666 AGGGAGAAAAGGAAGGAGGGAGG + Intronic
1095252232 12:39992129-39992151 GTAGAAGAGAGGAGTGAGGGAGG + Intronic
1095298840 12:40558766-40558788 AAGGCAAAGAAGAATGAGGTAGG - Intronic
1095354775 12:41258832-41258854 AGGGAAAAAGGGAATGATGGAGG + Intronic
1095399846 12:41801411-41801433 ATGAAAGAGAAGAATGATGGAGG + Intergenic
1095631186 12:44379152-44379174 AGGGAAGAAAGGAAGGAGGGAGG + Intronic
1095736438 12:45561661-45561683 AAGGAAGAGAGGAGGGAGGGAGG - Intergenic
1095803890 12:46297028-46297050 ACTAAAAAGAGGAAGGAGGGTGG + Intergenic
1096072724 12:48784262-48784284 AAGGAAAAAAGGAGGGAGGGAGG + Intronic
1096887672 12:54733880-54733902 ATTGAAAACAGGAATGATGCTGG + Intergenic
1097333437 12:58356647-58356669 ATGAAAAAAATGAATGAGGCTGG + Intergenic
1097348170 12:58518363-58518385 AGGGAAAACAGGAATTAGGGAGG - Intergenic
1097440253 12:59599180-59599202 ATAGAAAGAAGGAAAGAGGGAGG + Intronic
1097513284 12:60570202-60570224 GGGGAAAAGAGCAATGTGGGAGG - Intergenic
1097825645 12:64172448-64172470 AAGGAAAAGAGGAGGGAGGAGGG + Intergenic
1098167785 12:67715812-67715834 ATGGCAAAGAGGGAAGAGGGAGG + Intergenic
1098216069 12:68221278-68221300 AAGGAAAGGAGGAATGGGGTGGG + Intronic
1098229338 12:68357111-68357133 ATGGAACAGATGAATGAAGTAGG - Intergenic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1099065992 12:77980003-77980025 TGGGAAAACAGGAATGAGGGAGG + Intronic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099224156 12:79949230-79949252 AGGGAAAAGGGGAGTGAAGGAGG - Intergenic
1099300146 12:80883049-80883071 AAGGAAAGAAGGAAGGAGGGAGG - Intronic
1099576675 12:84392039-84392061 ATGAAAAAGGGGAAGGAGAGGGG - Intergenic
1099899687 12:88692551-88692573 AAGGAAGAAAGGAAGGAGGGAGG + Intergenic
1099959192 12:89380439-89380461 ATGGGAAGGAGGGAAGAGGGAGG - Intergenic
1100162946 12:91882276-91882298 TTGCAAAAATGGAATGAGGGTGG - Intergenic
1100174298 12:92011939-92011961 AAGGAAAAAAGGAAGGAGGGAGG + Intronic
1100229523 12:92593122-92593144 GTGGAAAGGAGGAAAGAGAGAGG + Intergenic
1100587128 12:95990726-95990748 AAGAAAAAGAGGAGTGGGGGTGG + Intronic
1100728898 12:97441756-97441778 ATGGAGGAGAGGAGAGAGGGAGG + Intergenic
1101280301 12:103247606-103247628 AAGGAAAAGAAGAATTGGGGTGG - Intronic
1101348227 12:103905457-103905479 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1101348274 12:103905587-103905609 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1101863638 12:108503196-108503218 CAGGAAAACAGGAATTAGGGAGG + Intergenic
1102544193 12:113642755-113642777 AGGGAAAGAAGGAAGGAGGGAGG - Intergenic
1102834308 12:116039853-116039875 ATGGAACTGAGGAAAGAGGTCGG + Intronic
1102992077 12:117322594-117322616 AAGGAAGAAAGGAAGGAGGGAGG - Intronic
1103098237 12:118149116-118149138 ATGGAAAAGGGGGACGAGGAAGG - Intergenic
1103164318 12:118757141-118757163 ATGGAAAAAAGGTGGGAGGGAGG + Intergenic
1103366800 12:120389668-120389690 AAGGGAGAGAGGAAGGAGGGAGG + Intergenic
1103366814 12:120389712-120389734 AAGGGAGAGAGGAAGGAGGGAGG + Intergenic
1103592587 12:122002857-122002879 AGGGAAAAGGGGAATGGGTGAGG - Intronic
1103821438 12:123702065-123702087 AGGGAACAGAGGAAAGAGGTTGG - Intronic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1103840960 12:123863923-123863945 ATGTAAGAGAAGAATGAGGTAGG + Intronic
1103862738 12:124027384-124027406 AAGGAAAAGGGAAATGAAGGAGG - Intronic
1104109091 12:125688918-125688940 AAGGGAAGGAGGAATGAGCGTGG + Intergenic
1104125401 12:125841301-125841323 CTGGTAAACAGGAATGAGAGAGG + Intergenic
1104126085 12:125847545-125847567 CAGGAAAACAGGAATTAGGGAGG - Intergenic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104668887 12:130667100-130667122 GAGAAAAAAAGGAATGAGGGAGG + Intronic
1104676012 12:130713040-130713062 AGGGAGAGGAGGAATGAGGGAGG + Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1106192825 13:27468957-27468979 TTGGAAAACAGGAACTAGGGAGG + Intergenic
1106790595 13:33151833-33151855 ATGCAAAAGGGGAGTGAGAGTGG + Intronic
1106900718 13:34352261-34352283 GTGAAAAAGAGGGATGAGGAAGG - Intergenic
1107432411 13:40351882-40351904 ATGGAAGAAAGCAATAAGGGAGG - Intergenic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1107788757 13:43979885-43979907 ATGTAAAAGGGAAAAGAGGGGGG + Intergenic
1108082468 13:46750913-46750935 GTGGAAAGGATGAAGGAGGGTGG - Intronic
1108194206 13:47975445-47975467 ATAGAAAAGTGGAATTAGGCTGG - Intronic
1108260019 13:48646810-48646832 TTGGAAAATAGGCATGAGGAAGG - Intergenic
1108443209 13:50477527-50477549 ATGGAAATGAGGAAAGGGGAAGG + Intronic
1108523817 13:51268283-51268305 ATGGAAAGGAGTAATGAGAACGG + Intronic
1108563144 13:51666510-51666532 GTGGAGAAGAGGATGGAGGGAGG + Intronic
1108700093 13:52936407-52936429 AAGGAAAAGAGAAATGAAGCAGG + Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1109428846 13:62205320-62205342 TAGGAAAACAGGAATTAGGGAGG + Intergenic
1109429015 13:62207686-62207708 TGGGAAAACAGGAATAAGGGAGG - Intergenic
1109642850 13:65213024-65213046 CAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111201885 13:84948906-84948928 ATGGGAAACAGGAAACAGGGAGG - Intergenic
1111608083 13:90566266-90566288 CAGGAAAACAGGAATTAGGGAGG - Intergenic
1111770709 13:92592395-92592417 ATGGAAGAGAGGAAAGCAGGAGG - Intronic
1111792021 13:92869541-92869563 AAGGAAAGGAGGGAGGAGGGAGG + Intronic
1112010940 13:95293380-95293402 ATGGAAAAGCTGTGTGAGGGTGG - Intronic
1112386079 13:98940842-98940864 ATAGATAAGAGGGATGATGGAGG - Intronic
1112441223 13:99426387-99426409 AGGGAGTGGAGGAATGAGGGGGG - Intergenic
1112795025 13:103047546-103047568 AGGGAAAAAAGGAAGGATGGGGG - Intronic
1112803938 13:103141354-103141376 AGAGAAAAGAGGAAGGAAGGCGG - Intergenic
1113024183 13:105922175-105922197 ATGGAAAGAGGGAAAGAGGGAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113650108 13:112028499-112028521 ATGGCCCAGAGGAAGGAGGGAGG + Intergenic
1113673971 13:112195793-112195815 AAGGAAGAGGGGAAGGAGGGGGG - Intergenic
1113873306 13:113578243-113578265 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
1113935176 13:113990110-113990132 AGGGCAAAGAGGAAGGAAGGAGG - Intronic
1114158891 14:20140271-20140293 AAGGAAGAGAGCAAAGAGGGAGG + Intergenic
1114257298 14:21014304-21014326 AGGAAAAAGAGGAAGGAAGGTGG + Intergenic
1114353515 14:21881427-21881449 AAGGAAAAAAGGAAAGAGGAGGG - Intergenic
1114393422 14:22334785-22334807 CAGGAAAGGAGAAATGAGGGAGG + Intergenic
1114675844 14:24439953-24439975 ATGGGAAAGAGGACTGGGAGAGG + Exonic
1114985524 14:28223065-28223087 ATGAAAAGGAGGAATAAAGGAGG - Intergenic
1115361885 14:32512632-32512654 CTGGAAAAGGGCAATGAGGGTGG + Intronic
1115440575 14:33430245-33430267 GAGGAAAAGAAGAATGGGGGAGG - Intronic
1115675425 14:35668146-35668168 AGGGAAAGGAGGAAAGAAGGGGG + Intronic
1115788225 14:36850161-36850183 ATGGGAAAGGGGAAGGAGTGAGG + Intronic
1116859449 14:49981980-49982002 ATGGAAAAGAGAAACGAGATTGG - Exonic
1117190389 14:53284678-53284700 AAGGACAAAAGTAATGAGGGTGG + Intergenic
1117335328 14:54752486-54752508 AGGGAACAGAGTATTGAGGGAGG + Intronic
1117670384 14:58100197-58100219 AAGGAAAAGAGAAATGTTGGTGG + Intronic
1117698373 14:58389213-58389235 AAGGAAGAAAGGAAGGAGGGAGG + Intergenic
1117799052 14:59425038-59425060 AGGAAAAAAAGGAATGAAGGTGG - Intergenic
1117799281 14:59426877-59426899 ATTGAAATGAGGAAAGAGGGTGG - Intergenic
1117957133 14:61131362-61131384 ATGGAAGGAAGGAAGGAGGGAGG - Intergenic
1118014696 14:61647790-61647812 ACTGAAAATTGGAATGAGGGTGG + Intronic
1118233764 14:63979910-63979932 AAGAAAAATAGAAATGAGGGGGG + Intronic
1118975031 14:70669161-70669183 ATAAAAAAGAGTAAAGAGGGGGG + Intronic
1119089316 14:71765832-71765854 AGGGAGGAAAGGAATGAGGGAGG - Intergenic
1119211759 14:72837194-72837216 AGTGCAAAGAAGAATGAGGGTGG + Intronic
1119456469 14:74760326-74760348 AAGGGAGAGAGGAAGGAGGGAGG - Intergenic
1120204107 14:81569193-81569215 CTGGAAGAAAGGAATGAGTGAGG + Intergenic
1120694386 14:87628229-87628251 AAGGAAAAGGGAAATGAGTGGGG - Intergenic
1120825555 14:88951628-88951650 ATATAAAACAGGAATTAGGGAGG + Intergenic
1121004677 14:90482454-90482476 ATGAGAAAGAGGAAAGTGGGAGG - Intergenic
1121366652 14:93318329-93318351 ATTGGGAAGAGGCATGAGGGGGG + Intronic
1121476075 14:94204524-94204546 TTGAAAAAGAGGAATGAAGTAGG - Intronic
1121500303 14:94430539-94430561 CAGGAAAACAGGAATTAGGGAGG + Intergenic
1121550100 14:94792841-94792863 AAGAGAAAGAGGAAGGAGGGAGG + Intergenic
1121624585 14:95374869-95374891 AAGGAAGAAAGGAAAGAGGGAGG - Intergenic
1121624613 14:95374973-95374995 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624644 14:95375076-95375098 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624661 14:95375141-95375163 AAGGAAGAGAGGAAGGAGGGAGG - Intergenic
1121624673 14:95375190-95375212 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624683 14:95375225-95375247 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624699 14:95375280-95375302 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121624711 14:95375315-95375337 AAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1121800315 14:96769092-96769114 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
1121828411 14:97029258-97029280 AGGGAAAGAAGGAAGGAGGGAGG - Intergenic
1121882590 14:97514332-97514354 AAGGAAAAAAGGAAGGAAGGAGG - Intergenic
1121935437 14:98014093-98014115 AAGGAAGAAAGGAAGGAGGGAGG - Intergenic
1121957907 14:98230858-98230880 ATGGAAGAGTGGAAGGAAGGTGG + Intergenic
1121976942 14:98413602-98413624 GTGGAAAAGACAAATGAGGGGGG + Intergenic
1122002144 14:98667231-98667253 AAGGAAGAAAGGAAGGAGGGAGG - Intergenic
1122056513 14:99101904-99101926 GTGGAAAAGAGGAATGTCAGTGG + Intergenic
1122280183 14:100617567-100617589 AGGGAAAAGGGGAGTGGGGGAGG + Intergenic
1202927746 14_KI270725v1_random:6795-6817 AAGTAAAAGAGGAACGAGGGTGG + Intergenic
1202939850 14_KI270725v1_random:136513-136535 ATGGGAGAGAAGAAGGAGGGTGG - Intergenic
1123393274 15:19899364-19899386 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1123722562 15:23072347-23072369 ATGGATTAGAGAAATGAGAGGGG + Intergenic
1124400413 15:29343013-29343035 CTGGTAAAAAGGAATGGGGGGGG + Intronic
1124920632 15:34022889-34022911 ATAGAAAAGAACAATGAGGCCGG + Intronic
1124937346 15:34185788-34185810 CAGGAAAACAGGAATTAGGGAGG + Intronic
1124953652 15:34345815-34345837 AGGGAAAAGTGGGGTGAGGGTGG - Intronic
1125344717 15:38707481-38707503 GTGGAAAAGTGAAATGAGGGAGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125566277 15:40681247-40681269 AAAGAAAAGAGAAAGGAGGGAGG - Intergenic
1125767523 15:42145495-42145517 AGAGACAAGAAGAATGAGGGAGG - Intronic
1125818573 15:42607998-42608020 ATGGAAAAGAGACCTGCGGGGGG - Intronic
1126154438 15:45552335-45552357 ATGGAAAAGAGAAGTAAGGCAGG - Intergenic
1126698416 15:51345171-51345193 CAGGAAGAGAGGAATGAGAGAGG - Intronic
1126804977 15:52339090-52339112 ATGGGAATGAGGGAGGAGGGTGG - Intronic
1127267530 15:57374110-57374132 AAGAAAAAGAGAAAGGAGGGAGG - Intergenic
1127301167 15:57655205-57655227 GTGGAAAAGGGGATGGAGGGTGG + Intronic
1127537549 15:59904199-59904221 AAGGAAAAGAGGACAAAGGGAGG + Intergenic
1127674730 15:61228610-61228632 AAGGTAAAGCGGAAGGAGGGTGG + Intronic
1128224857 15:65994513-65994535 GTGGGAAAGAGGAGTGAGAGAGG + Intronic
1128355689 15:66925001-66925023 ATGGAAAAGAGGCGTGTGGGAGG + Intergenic
1128698198 15:69784659-69784681 AAGGAAAGGAGGAATGAGAGAGG - Intergenic
1128793451 15:70449279-70449301 ATGGATAGAAGGAAGGAGGGAGG + Intergenic
1129675011 15:77627817-77627839 ATGGATATGAGCAATCAGGGAGG - Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1129929855 15:79401738-79401760 ATGGAAAAGAGAAACGAGGGTGG + Intronic
1130286667 15:82561068-82561090 AGCTATAAGAGGAATGAGGGTGG + Intronic
1130664259 15:85855956-85855978 AAGCAAGAGAGGAAAGAGGGAGG - Intergenic
1130667288 15:85880345-85880367 AAGGAAATGAGGAAGGAAGGAGG + Intergenic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1130961161 15:88659496-88659518 ACGGAAAAGGGGACTGAGAGGGG - Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1130972919 15:88748467-88748489 ATAGAAAAGAGGAAAGAATGAGG - Intergenic
1131253135 15:90844069-90844091 ATGGGAAGGAGGGAGGAGGGAGG - Intergenic
1131269542 15:90938557-90938579 ATGCAAGAGAGGAAGGCGGGTGG + Intronic
1131651929 15:94409714-94409736 ATGGAGAAGAGGGAAGAGAGAGG - Intronic
1131736616 15:95339398-95339420 ATGGAAAAGAGGGAGGGGGAAGG + Intergenic
1131937771 15:97525742-97525764 ATGGAAAAAAGGAAAGAAGAAGG + Intergenic
1132017951 15:98335725-98335747 TAGGAAAACAGGAATTAGGGAGG - Intergenic
1132193640 15:99892415-99892437 ATGGAAGAGAGGAAAGCAGGAGG + Intergenic
1132706672 16:1246918-1246940 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1132958528 16:2609556-2609578 ACGGCAGTGAGGAATGAGGGTGG - Intergenic
1132971140 16:2689652-2689674 ACGGCAGTGAGGAATGAGGGTGG - Intronic
1133366721 16:5216142-5216164 ATGGGCAGGAGGAATGTGGGAGG + Intergenic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133407485 16:5536782-5536804 GGGGAAAACAGGAATTAGGGAGG + Intergenic
1133415847 16:5606441-5606463 AAGGGAGGGAGGAATGAGGGTGG - Intergenic
1133647171 16:7775235-7775257 AAGGAAGAAAGGAAGGAGGGAGG + Intergenic
1133647192 16:7775318-7775340 AAGGAAGAAAGGAAGGAGGGAGG + Intergenic
1133656722 16:7872090-7872112 AAGGAAAAAGGGAAGGAGGGAGG - Intergenic
1134071952 16:11265758-11265780 TTGCGAAAGAGGAATGAGGAAGG + Intronic
1134092264 16:11397895-11397917 ATGGAAGATAGGAAGGAGGATGG + Intronic
1134350400 16:13432205-13432227 ACAGATAAGAGGAATGAGGGTGG - Intergenic
1134394951 16:13854208-13854230 AAGAAAAAGAGGGATGGGGGAGG + Intergenic
1134417407 16:14056312-14056334 AAGGAAAGGAGGAAAGAAGGAGG - Intergenic
1134691161 16:16191788-16191810 AAGGAGGAGAGGAAGGAGGGAGG - Intronic
1134799677 16:17071936-17071958 AGGGAAAAAAGGAAGGAGGGAGG - Intergenic
1134881322 16:17747359-17747381 AAGGAAGAGAGGAAGGAAGGAGG + Intergenic
1134887641 16:17807992-17808014 GGGGAAAATAGGAATTAGGGAGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135805933 16:25542652-25542674 AGGGAAAAGAGGAGTCAGTGAGG - Intergenic
1135927147 16:26705445-26705467 TGGGAAAACAGGAATTAGGGAGG + Intergenic
1135934723 16:26770176-26770198 AGGAAAATGAGGAATGAAGGAGG + Intergenic
1135939565 16:26809637-26809659 AGGGAAAGAAGGAAGGAGGGAGG + Intergenic
1135945397 16:26860549-26860571 TGGGAAAACAGGAATGAGGGAGG + Intergenic
1135945415 16:26860625-26860647 GTGGTCAACAGGAATGAGGGAGG + Intergenic
1136771626 16:32846141-32846163 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1136957675 16:34803922-34803944 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1137298516 16:47122026-47122048 AGGGAAAAGAGGAGAGAGTGAGG - Intronic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137960561 16:52877946-52877968 ATAGAAATGAGGGATGAGGGTGG - Intergenic
1138143561 16:54588686-54588708 AGGGAAAGGAGGAGGGAGGGAGG - Intergenic
1138327657 16:56189735-56189757 ACAGAAAAGAAGAATGAGAGGGG + Intergenic
1138623660 16:58232002-58232024 ATGGTTATGAGGAATGAGGTTGG + Intronic
1138721871 16:59091584-59091606 AAGGAAAAGAGGTATCAGTGGGG - Intergenic
1138730932 16:59194195-59194217 ATGGTAGAGAGGAATGAAAGAGG + Intergenic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139256110 16:65544378-65544400 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1139341339 16:66270010-66270032 ACGGAAAGCAGGAAGGAGGGAGG + Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140019720 16:71226837-71226859 GTAGAAAACAGGAATTAGGGAGG - Intronic
1140461690 16:75145384-75145406 ATGGACAGGAGGCAGGAGGGCGG + Intergenic
1140541508 16:75760364-75760386 AAGGAAGAGAGGAAGGAGGGAGG - Intronic
1140878814 16:79178611-79178633 ATGTAAAACAGGAATCAGGCTGG - Intronic
1141115778 16:81307826-81307848 ATTGAAAACAAGAATGATGGTGG + Intergenic
1141412292 16:83843799-83843821 AAGGAAAGGAGGAAGGAGGGAGG + Intergenic
1141774569 16:86114236-86114258 AGGGAAAAGAGGAAGGGTGGAGG + Intergenic
1141804218 16:86332152-86332174 ATGGCAAAGAGGGATTAAGGTGG - Intergenic
1141806353 16:86344289-86344311 AGGGAAAAGAAGACAGAGGGGGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142071323 16:88092485-88092507 AAGGGAGAGAGGAAGGAGGGAGG + Intronic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1203074052 16_KI270728v1_random:1108252-1108274 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1142621636 17:1169100-1169122 AGGGGAAAGAGGAGGGAGGGAGG + Intronic
1142928336 17:3260386-3260408 AAGGAAGAAAGGAAGGAGGGAGG - Intergenic
1143021234 17:3918077-3918099 AGGGAAGGGAGGAAGGAGGGAGG + Intergenic
1143021308 17:3918272-3918294 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1143022853 17:3925646-3925668 ATGGAACAGTGGAGTGAAGGAGG - Intronic
1143220721 17:5259289-5259311 ATGGAAGAGAGTAAAGCGGGTGG - Intergenic
1143280875 17:5753230-5753252 AGAGAAAAGAGGAAAGAGGAAGG - Intergenic
1143372809 17:6450797-6450819 AGGGAAAGGAGGGATGAGAGTGG - Exonic
1143604565 17:7974976-7974998 TGGGAAAACAGGAATTAGGGAGG + Intergenic
1143627780 17:8121171-8121193 ATGGAGAGCAGGACTGAGGGTGG + Exonic
1144035930 17:11366075-11366097 AGGGAAAAGTGGTGTGAGGGAGG + Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144083573 17:11786406-11786428 ATGGAAAGGAGAGATGAGGTTGG + Intronic
1144163094 17:12581055-12581077 ACAGAAAAGAGGAGAGAGGGCGG - Intergenic
1144180565 17:12747618-12747640 AGAGAGAAGAGGAATGAAGGAGG + Intronic
1144374505 17:14626101-14626123 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
1145298251 17:21611929-21611951 ATGCATAGGAGGAAAGAGGGTGG - Intergenic
1145415089 17:22708283-22708305 ATGCAAAGGAGGGATGGGGGAGG - Intergenic
1145765635 17:27456674-27456696 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1145780749 17:27561336-27561358 AAGGAAAGAAGAAATGAGGGGGG - Intronic
1145968334 17:28937676-28937698 AGGGAAAAAAGGAAGCAGGGAGG + Intronic
1146564595 17:33901476-33901498 ATGAAAAAGAGGAATAAGGGAGG - Intronic
1146918964 17:36697127-36697149 AGAGAAAAGGGGAAGGAGGGAGG + Intergenic
1147003130 17:37379389-37379411 TTGGAAAAGAGGAAGGGGGCAGG + Intronic
1147495849 17:40914446-40914468 ATAGAAAACAGGAGTGAGTGTGG + Intergenic
1147527066 17:41235800-41235822 AGGGAAAAGAGGGAGCAGGGAGG + Intronic
1147751234 17:42735022-42735044 AAGGAAGAAAGGAAGGAGGGCGG + Intronic
1148261026 17:46183627-46183649 AGGGAAAGAAGGAAGGAGGGAGG + Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148570514 17:48664470-48664492 AGGGAAAGGAGGAGTGGGGGTGG + Intergenic
1149079249 17:52633605-52633627 AAGGAAAAGGGGAAAGAAGGAGG - Intergenic
1149270982 17:54976936-54976958 TGGGAAAACAGGAATTAGGGAGG - Intronic
1149653278 17:58292425-58292447 AAGGAAAAGAGAAAAGTGGGAGG - Intergenic
1149891084 17:60391531-60391553 ATGGCAATGAAGGATGAGGGGGG + Intronic
1150293088 17:63993066-63993088 AAGGAAAGAAGGAAAGAGGGAGG + Intergenic
1150293159 17:63993258-63993280 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1150293177 17:63993311-63993333 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151007501 17:70454989-70455011 ATGGAGGAAAGGAAGGAGGGAGG + Intergenic
1151144903 17:72031504-72031526 TTGGCAATGAGGGATGAGGGGGG - Intergenic
1151157908 17:72139747-72139769 AATGAAAAGAGGAAGGAAGGAGG + Intergenic
1151258772 17:72900454-72900476 AAGAGAAAGAGGAATGAAGGGGG + Intronic
1151517691 17:74606859-74606881 AAGGAAAGGAGGCCTGAGGGAGG - Intergenic
1151719670 17:75847942-75847964 AGGGGAAAGAGAAATGAGCGTGG + Intronic
1152009385 17:77701838-77701860 ATGAAAGGGAGGAATGAGGATGG - Intergenic
1153269975 18:3310748-3310770 GTGGAAAAGAGGAGTGAGGGAGG + Intergenic
1153577226 18:6534636-6534658 ATGGGAGAGGGAAATGAGGGTGG - Intronic
1153696984 18:7653466-7653488 ATGGGAAAGAGGGCAGAGGGTGG - Intronic
1153785596 18:8531368-8531390 ATGGAAAACAGGAAAAAGGCAGG + Intergenic
1153954269 18:10082957-10082979 TGGGAAAACAGGAATTAGGGAGG + Intergenic
1154518294 18:15197723-15197745 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1155712943 18:28905124-28905146 AAGGAAAGGAGGAAGGATGGAGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155896009 18:31327405-31327427 ATAGAAAAGGGGTATGAGAGAGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156259581 18:35432469-35432491 AAGGAAAAATAGAATGAGGGAGG + Intergenic
1156419494 18:36935306-36935328 AAGGAGAAGAGGAAAAAGGGAGG - Intronic
1156661990 18:39357254-39357276 ATGGCAAAGGGGAATATGGGGGG - Intergenic
1156889838 18:42178229-42178251 AAGGAAGGAAGGAATGAGGGAGG + Intergenic
1156988585 18:43379110-43379132 ATGGTAAACAGGAATTAGGAAGG - Intergenic
1157119276 18:44893706-44893728 AAGGAAAAAAGAAAAGAGGGAGG + Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157502117 18:48198623-48198645 ATGGAAGAGAGGTCAGAGGGAGG - Intronic
1157602887 18:48905124-48905146 ATGGAAAGAAGGAAGGAAGGAGG + Intergenic
1157941568 18:51934438-51934460 ATGGATAAGAGGGAGGTGGGAGG + Intergenic
1158265764 18:55659331-55659353 AGGGAAAGGGGAAATGAGGGAGG - Intronic
1158301802 18:56060918-56060940 TGGGAAAACAGGAATTAGGGAGG - Intergenic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1159009972 18:63049815-63049837 CTTGAATTGAGGAATGAGGGCGG - Intergenic
1159023563 18:63162820-63162842 ATGGAAAGAAGGAAGGAAGGAGG - Intronic
1159310243 18:66698412-66698434 AGGGAAAAAAGGAGGGAGGGAGG + Intergenic
1159399164 18:67907862-67907884 ATGAAAAGGAGGAAAGAGGTAGG + Intergenic
1159448943 18:68575747-68575769 GTGAAAAAGAGGAATAATGGAGG - Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159502998 18:69298083-69298105 AGGGAAAGGAAGAATGGGGGAGG - Intergenic
1159725124 18:71947964-71947986 AAGGAAAAGAGGAAGGAAGAGGG + Intergenic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1160558679 18:79742326-79742348 ATGGGAGAGAGGCCTGAGGGTGG + Intronic
1160607776 18:80065418-80065440 ACAGAAAAAAGGAATGAGGAAGG + Intronic
1161130337 19:2584793-2584815 AAGGAAAGAAGGAAGGAGGGAGG + Intronic
1161130392 19:2584953-2584975 AAGGAAAGAAGGAAGGAGGGAGG + Intronic
1161130410 19:2585005-2585027 AAGGAAAGAAGGAAGGAGGGAGG + Intronic
1161267609 19:3371948-3371970 AAGGAAAGAAGGAAGGAGGGAGG - Intronic
1161357310 19:3826191-3826213 AGGGGAAAGAGGAATGAGCAGGG - Intronic
1161797292 19:6394377-6394399 TAGGAATATAGGAATGAGGGAGG + Intergenic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1162154405 19:8667171-8667193 AAAGAAAACAGGAAAGAGGGAGG + Intergenic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162872709 19:13598502-13598524 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
1162998979 19:14354089-14354111 AGAGAAAGGAGGAAGGAGGGAGG + Intergenic
1163093227 19:15035864-15035886 AAGGAAGAAAGGAAGGAGGGAGG + Intergenic
1163133453 19:15291447-15291469 ATGGAAAAAAGAAATGTAGGTGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1164419464 19:28075924-28075946 ATGGAAGAGGAGGATGAGGGAGG + Intergenic
1164441875 19:28285049-28285071 AGGGCAGAGAGGAAGGAGGGTGG + Intergenic
1164569677 19:29364096-29364118 AAGGAAGAGAGGAAGGAGGGAGG + Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164771984 19:30816403-30816425 AGGGAAGAAAGGAGTGAGGGAGG - Intergenic
1164788058 19:30952376-30952398 AAGGAAGAAAGGAAGGAGGGAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166115328 19:40650016-40650038 AAAGAAAAGAGAAAGGAGGGAGG + Intergenic
1166867175 19:45846721-45846743 CTGGAAAGCAGGACTGAGGGAGG + Intronic
1167189491 19:47974589-47974611 ATGGAAAGGAGGGAGGAGAGAGG - Intronic
1167286586 19:48601832-48601854 AGGGAAGAGAGGAGAGAGGGAGG + Intronic
1167626411 19:50592725-50592747 AAGGAAAAGAAGAAAGAAGGAGG - Intergenic
1167737450 19:51304546-51304568 ATGTAAAACAGGAATTAGGGAGG + Intergenic
1167821720 19:51934396-51934418 ATGGAGGAGAGGAAAGGGGGTGG - Intronic
1168144677 19:54414407-54414429 AGGGAAAAGAGGAATGCTGGTGG - Intergenic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168501443 19:56896695-56896717 GCTGAAAAGAGGAATGAGAGGGG + Intergenic
1202680197 1_KI270712v1_random:2656-2678 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1202709198 1_KI270714v1_random:7640-7662 TGGGAAAAGAGGAACTAGGGAGG + Intergenic
925101906 2:1254156-1254178 ATGGAAAGGAGGAATTGGAGTGG + Intronic
925400144 2:3566815-3566837 AAGGAAGAGAGGAGTGCGGGAGG - Intergenic
925790997 2:7488475-7488497 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791007 2:7488510-7488532 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791028 2:7488580-7488602 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791039 2:7488615-7488637 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791052 2:7488661-7488683 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791062 2:7488696-7488718 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791072 2:7488731-7488753 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791083 2:7488766-7488788 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791106 2:7488847-7488869 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791117 2:7488882-7488904 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791127 2:7488917-7488939 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791137 2:7488952-7488974 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791147 2:7488987-7489009 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791168 2:7489060-7489082 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791178 2:7489095-7489117 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791189 2:7489130-7489152 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925791203 2:7489176-7489198 AAGGAAGGGAGGAAGGAGGGAGG + Intergenic
925803947 2:7630023-7630045 ATGTAAAATAGAAATGGGGGAGG + Intergenic
925858250 2:8151022-8151044 ATGGAAAAGAGAGTTGTGGGAGG + Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926161888 2:10495119-10495141 AAGGAAGGGAGGAAGGAGGGCGG - Intergenic
926244555 2:11113423-11113445 AAGGAAGAAAGGAAGGAGGGAGG - Intergenic
926244562 2:11113451-11113473 AAGGAAGAAAGGAAGGAGGGAGG - Intergenic
926438706 2:12864016-12864038 TGGGAAAACAGGAATTAGGGAGG - Intergenic
926715400 2:15920109-15920131 AAGGAAGAGAGGGAGGAGGGGGG - Intergenic
926745602 2:16154543-16154565 ATGGAAATGGGGACAGAGGGTGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927319975 2:21732297-21732319 ATAGAAATGAGCCATGAGGGGGG + Intergenic
927400058 2:22700683-22700705 AAGGAAGAGAGGAAGGAGAGCGG - Intergenic
927416263 2:22883817-22883839 ATGGAAAAAAGGGAAGAGGAGGG + Intergenic
928098050 2:28417536-28417558 AGGGAAAAGAAGAATGAGACGGG - Intergenic
928142851 2:28745610-28745632 ATGAAAAATAGGAATAACGGTGG + Intergenic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928697332 2:33862485-33862507 TGGGAAAACAGGAATTAGGGAGG + Intergenic
928835686 2:35541694-35541716 AAGGAAGAGAGGAAGGAAGGAGG - Intergenic
929432241 2:41897129-41897151 TTGGAAAAGGGAAATGAGAGTGG - Intergenic
930168593 2:48228904-48228926 ATGGTAAAGATGGTTGAGGGTGG - Intergenic
930238084 2:48906853-48906875 AGGCAAGGGAGGAATGAGGGTGG + Intergenic
930270569 2:49251564-49251586 AGGGAAAAGAGAAGGGAGGGAGG - Intergenic
930640522 2:53850069-53850091 AGGGAAAAAGGGAAGGAGGGAGG + Intergenic
930886253 2:56330513-56330535 ATGGAAGAAAGGAAAGAGGGAGG - Intronic
931077684 2:58734950-58734972 AAGGAACAAAGGAAGGAGGGAGG - Intergenic
931693245 2:64852962-64852984 AAGAAAAAGAGGAAGGAGAGGGG + Intergenic
931705866 2:64945557-64945579 AAGGAAAAAAGGGAAGAGGGAGG - Intergenic
932209733 2:69916736-69916758 ATGGCAAAGAGGAATGATTGAGG + Intronic
932429593 2:71666127-71666149 ATGGGAAAAGGGAATGAAGGGGG - Intronic
932458419 2:71864921-71864943 AAGGAAGAAAGGAAAGAGGGAGG - Intergenic
932735068 2:74248612-74248634 ATGGAGAACAGGATTTAGGGAGG - Intronic
932751182 2:74372689-74372711 ATGCAAAAGAGAAATGAATGGGG - Intronic
932822596 2:74914276-74914298 AAGGAAGAAAGGAAGGAGGGAGG + Intergenic
932852808 2:75202452-75202474 AGTGAAAAGAGGAACGAAGGGGG - Intergenic
932894486 2:75625972-75625994 ATGGAAAAGAGGCAAGAGTGGGG - Intergenic
932993623 2:76820026-76820048 AAGGAAAAGAGAACTGGGGGTGG - Intronic
933019510 2:77173768-77173790 ATGGAACAGGGGAATGTGTGGGG - Intronic
933150755 2:78911982-78912004 AGGGAAAGAAGGAAGGAGGGAGG + Intergenic
933255087 2:80071686-80071708 AGGGGAGAGAGGACTGAGGGAGG + Intronic
933314845 2:80703695-80703717 CTGGAAGAGAGGAAGGAGGTTGG + Intergenic
933812218 2:86039962-86039984 CTGGACAAGGGGAATGAGTGTGG - Intronic
934042587 2:88141007-88141029 AAAGAAAAGAGGGAGGAGGGAGG - Intergenic
934047337 2:88183612-88183634 ATGGAAAGGAGGAAGGAGAGAGG - Intronic
934130735 2:88946395-88946417 TGGGAAAACAGGAATTAGGGAGG - Intergenic
934140174 2:89039319-89039341 TGGGAAAACAGGAATTAGGGAGG - Intergenic
934140764 2:89045102-89045124 GTGGAAAACAGGAATTAGAGAGG - Intergenic
934146405 2:89098958-89098980 GTTGAAAACAGGAATTAGGGAGG - Intergenic
934222862 2:90101617-90101639 GTTGAAAACAGGAATTAGGGAGG + Intergenic
934228472 2:90155440-90155462 GTGGAAAACAGGAATTAGAGAGG + Intergenic
934229063 2:90161218-90161240 TGGGAAAACAGGAATTAGGGAGG + Intergenic
934726097 2:96620308-96620330 ATGGAAAAGAGAGATTAGTGTGG - Intronic
934764768 2:96874520-96874542 AGGGCAAAGAGGAAGTAGGGAGG - Intergenic
934903098 2:98176515-98176537 AAGGAAAGAAGGAAGGAGGGAGG - Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935583628 2:104781805-104781827 ATTGAAAAGAAGAAAGAGGTTGG + Intergenic
935616422 2:105087784-105087806 AAGGAAAAAAGGCAGGAGGGAGG - Intronic
936333984 2:111573078-111573100 AGGGAAGAAAGGAAGGAGGGAGG + Intergenic
936448880 2:112618529-112618551 AGGGAAAGGAGGAATGAAGAAGG + Intergenic
936486394 2:112929433-112929455 AGGGAAATGAGAAATGAGAGGGG + Intergenic
936509431 2:113133195-113133217 ATGGGAAGGTGGAATGAGGGAGG - Exonic
936776164 2:115975904-115975926 ATAGAACAGAGAAATGTGGGAGG + Intergenic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
937082796 2:119152404-119152426 ATGGAAAAGAGGAATTTTGGGGG - Intergenic
937236800 2:120436118-120436140 ATGGAACAGACGATGGAGGGAGG - Intergenic
937635637 2:124152654-124152676 AAGGTAGAGAGGAATGAGGAGGG + Intronic
937783260 2:125864723-125864745 TGGGAAAACAGGAATGAGGGAGG + Intergenic
937845902 2:126578648-126578670 TTGGAAAATGGGACTGAGGGTGG + Intergenic
938003911 2:127771774-127771796 TTGGAAAGAAGGAAGGAGGGAGG + Intronic
938466870 2:131530386-131530408 ATGGAGAAGGGGGTTGAGGGAGG + Intronic
938518206 2:132037953-132037975 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
938550335 2:132374778-132374800 AGGGAAAACAGGAATTAGGGAGG + Intergenic
938670384 2:133580976-133580998 AAGGGAAAGAGGAAGGAGGTTGG - Intergenic
938880980 2:135588064-135588086 AAAGAAAAGAGGAAGGAGGGAGG - Intronic
939168454 2:138665384-138665406 ATGGAAAAGAAGTAGGAAGGAGG + Intergenic
939396923 2:141642619-141642641 ATAGAAAGGAGAAATCAGGGAGG + Intronic
939429467 2:142084276-142084298 ATGAAAAAGAAGAGTGAGGCTGG - Intronic
940179739 2:150918672-150918694 AAGGAAAAGGGGAAAGACGGAGG + Intergenic
940493049 2:154389830-154389852 AGGGAAAACAGGAATTAGTGAGG + Intronic
940577061 2:155522264-155522286 GTGGAAAATAGAAATGAGTGGGG + Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941573533 2:167201274-167201296 AAGGAAAGAAGGAAGGAGGGAGG + Intronic
941647604 2:168057954-168057976 AAGGAAAAATTGAATGAGGGAGG - Intronic
941810398 2:169749538-169749560 ATGGAAAGGAGGATGGAGTGCGG + Exonic
942183014 2:173398410-173398432 ATGGTAAAGTGGAATGCAGGGGG + Intergenic
942502422 2:176605668-176605690 AAGGAAGAAAGGAATGAGGTAGG - Intergenic
942522094 2:176815478-176815500 AAGGAAAGGAGGAAGAAGGGAGG + Intergenic
943787537 2:191895258-191895280 AAGGAAAAGACGAAGGAAGGAGG + Intergenic
943793612 2:191964553-191964575 ATGGAAATGAGCAAAGAGTGAGG - Intronic
944849693 2:203705797-203705819 ATGGAAAGAAAGAAAGAGGGAGG - Intergenic
945032202 2:205676139-205676161 TTGGACTAGAGGAAAGAGGGAGG + Intergenic
945428544 2:209737238-209737260 ATGGACAACAGGAACTAGGGGGG + Intergenic
945985393 2:216349640-216349662 ATGGAAAAGAGGCCTCAGGGGGG + Intronic
946111671 2:217425127-217425149 ATGAAAAAGGGGAATGAGCCAGG - Intronic
946118963 2:217492135-217492157 TTGGAAAAGACGAATGGTGGAGG - Intronic
946507847 2:220320737-220320759 ATGGAAACGGGGAAGGAGGGAGG + Intergenic
946756258 2:222950878-222950900 AGGGAAAGGAGGAAGGAAGGAGG - Intergenic
946809882 2:223512474-223512496 AGAGAAAAGATGAATGAAGGAGG + Intergenic
946907733 2:224432312-224432334 AAGGAAAAGAGGAGGAAGGGAGG - Intergenic
946938095 2:224742700-224742722 TGGGAAAACAGGAATTAGGGAGG - Intergenic
946939065 2:224752107-224752129 TGGGAAAACAGGAATTAGGGAGG + Intergenic
947011252 2:225569422-225569444 AGAGAAAGGAGGAGTGAGGGGGG + Intronic
947088270 2:226479735-226479757 AAGGAAAAGTGGAAGGACGGTGG - Intergenic
947150001 2:227105821-227105843 AAGGAAATGAGGACTGAGAGAGG - Intronic
947233886 2:227920031-227920053 ATGGAAAAGTGGGGTGTGGGAGG + Intronic
947455750 2:230252423-230252445 ATGCAAGAGGGAAATGAGGGAGG + Intronic
947515174 2:230797506-230797528 ATAGAAATGAGGAAGCAGGGGGG + Intronic
947693542 2:232162451-232162473 GTGGTAAAGAGGAATAGGGGAGG - Intronic
947766648 2:232642086-232642108 ATGAAAAAGACAAATGAGGCCGG + Intronic
948243866 2:236461981-236462003 AGGAAAGAGAGGAGTGAGGGTGG + Intronic
948262242 2:236613015-236613037 ATGGAGCAGAGGGAGGAGGGCGG - Intergenic
948303071 2:236923011-236923033 ATAGAAGAGAGGAAGGAGGAAGG - Intergenic
948316553 2:237031808-237031830 TGGGGAAAGAGGAAGGAGGGAGG + Intergenic
948441382 2:237992626-237992648 AAGGAAATGAGGCATGAGGTAGG + Intronic
948724235 2:239921989-239922011 AAGGAAAGAAGGAAGGAGGGAGG - Intronic
1169009847 20:2241368-2241390 AAGAAAAAGAGGGAGGAGGGAGG - Intergenic
1170624629 20:18021805-18021827 AGGGGAAAGAGGAAGCAGGGAGG + Intronic
1170970585 20:21112658-21112680 TTGTAAAAGAGGCCTGAGGGAGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171288205 20:23960919-23960941 CAGGAAAACAGGAATGAGGGAGG + Intergenic
1171299832 20:24050498-24050520 GTGGAAGAGAGGAATGAATGAGG - Intergenic
1171426566 20:25052187-25052209 ATGGAAAGGAGGAAGGAAGTGGG + Intronic
1171770704 20:29320254-29320276 AGGGAAAAAGGGAAGGAGGGAGG + Intergenic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172536912 20:35681004-35681026 AAGGAAAAGAGGAAGGAGAAGGG - Intronic
1172736345 20:37128709-37128731 GCGGAAAAGAGGTATGAGGAAGG - Intronic
1172787805 20:37480640-37480662 AAGGAAAGAAGGAAAGAGGGAGG - Intergenic
1172793294 20:37520857-37520879 ATGGAAAACCGAAATTAGGGAGG - Intronic
1173032557 20:39375851-39375873 AAGGAAAGGAGGAAAGAAGGAGG - Intergenic
1173161188 20:40653627-40653649 AGGGAAATGAGAAATGAGGCAGG + Intergenic
1173698403 20:45043844-45043866 AGGGGAAAGTGGAAGGAGGGAGG - Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1173959025 20:47057085-47057107 AAGGAAGAAAGGAAGGAGGGAGG + Intronic
1174662537 20:52226702-52226724 CTAGAAAAGAGAAATGAGGGTGG - Intergenic
1174701227 20:52611199-52611221 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
1174733663 20:52942981-52943003 CTGGAAAAGTGGAATGTGTGAGG - Intergenic
1174796391 20:53526070-53526092 AAGGAAAGAAGGAATGAGGATGG - Intergenic
1175130032 20:56782125-56782147 AGGGAAAGAAGGAAGGAGGGAGG + Intergenic
1175382672 20:58574629-58574651 ATGGAGGAAGGGAATGAGGGAGG - Intergenic
1175390355 20:58623196-58623218 ATGGAAGGAAGGAAAGAGGGAGG + Intergenic
1175817830 20:61892891-61892913 ATGGAAAGGTAGAAAGAGGGAGG + Intronic
1175907355 20:62387396-62387418 ACGGAAGAGAGGCATGTGGGGGG - Intronic
1175907386 20:62387506-62387528 ATGGAAAAGAGTAACGTCGGGGG - Intronic
1176047385 20:63099928-63099950 AGGAAAAAAAGGAAGGAGGGAGG + Intergenic
1176583339 21:8550572-8550594 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1176589770 21:8635456-8635478 AAGTAAAAGAGGAACGAGGGTGG + Intergenic
1177521412 21:22232704-22232726 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1177767540 21:25475402-25475424 GTGAAAAAGAGGAATGAGCTTGG - Intergenic
1177967512 21:27746473-27746495 TAGGAAAACAGGAATTAGGGAGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178038747 21:28615316-28615338 GGGGAAAAGGGGAAGGAGGGAGG - Intergenic
1178146847 21:29750257-29750279 AAGGAATAAAGGAATGAGGGAGG - Intronic
1179188542 21:39104102-39104124 ATGGAAAGAAGGAAGGAAGGAGG + Intergenic
1179388968 21:40970031-40970053 AAGGAAAGGAGGAAAGAGGGAGG + Intergenic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1180168152 21:46040653-46040675 ATGGAAAAGAGGGATCTCGGAGG - Intergenic
1180266149 22:10527502-10527524 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1180272604 22:10612471-10612493 AAGTAAAAGAGGAACGAGGGTGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181333583 22:22113468-22113490 GTGGAAAAGAGGAAGAAGGCAGG - Intergenic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181788586 22:25245503-25245525 CTGGAAGGGAGGAATGGGGGTGG - Intergenic
1181791236 22:25268447-25268469 AAGGAAAAGAGGAATGAGACAGG + Intergenic
1181820275 22:25470192-25470214 CTGGAAGGGAGGAATGGGGGTGG - Intergenic
1181917397 22:26292169-26292191 AAGGAAAGAAGGAAGGAGGGAGG + Intronic
1182458215 22:30466085-30466107 ATGGACAGGAGAAATAAGGGAGG + Intronic
1182753035 22:32657108-32657130 AAAGAAAAGAGAAGTGAGGGTGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183063218 22:35347855-35347877 AAGGAACAGAGGAAGGATGGAGG - Exonic
1183326027 22:37194870-37194892 ATAGAAAAGAGAAAGGAGAGAGG + Intronic
1183756989 22:39776850-39776872 ATGAAAAAGAGGTAGCAGGGTGG - Intronic
1183913499 22:41097352-41097374 ATGGATAATAGGGAGGAGGGAGG + Intronic
1184178538 22:42803886-42803908 AAAAAAAAGAGGAAGGAGGGAGG - Intronic
1184297832 22:43537036-43537058 ATGGAAAAGGTGGAGGAGGGCGG - Intronic
1184566834 22:45297097-45297119 AAGGAGATGAGGCATGAGGGTGG + Intergenic
1184665425 22:45986555-45986577 ATGGAGCAGAGGAAAGGGGGAGG + Intergenic
1184997091 22:48215205-48215227 AGGAAAAAGAGGAATAAAGGAGG + Intergenic
949137519 3:586246-586268 AAGTAAAAGAGGAACGAGGGTGG - Intergenic
949161400 3:887212-887234 AAGGAAGAAAGGAATGAGGGAGG - Intergenic
949180330 3:1122372-1122394 AAGGAAGGGAGGAATGAAGGAGG + Intronic
949215479 3:1562140-1562162 ATGGAAAAGAACCATGGGGGTGG - Intergenic
949284836 3:2389558-2389580 AAAGGAAAGAGGAATGAAGGAGG - Intronic
949305500 3:2635973-2635995 TGGGAAAACAGGAATTAGGGAGG - Intronic
949430856 3:3974074-3974096 ATAGCACAAAGGAATGAGGGAGG - Intronic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
950226281 3:11237348-11237370 ATGGAAAAGAGGATGGAGTGGGG + Intronic
950254619 3:11494235-11494257 CAGGAAAACAGGAATTAGGGAGG + Intronic
950273386 3:11638261-11638283 AGGGAACGGAGGAAGGAGGGAGG + Intronic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950626442 3:14250889-14250911 GCGGAAAAGAGGGATGAGGAAGG + Intergenic
950670197 3:14521324-14521346 ATGGAAAAAAGAAAAGAGGCAGG - Intronic
950779401 3:15378390-15378412 ATGCTAATGAGCAATGAGGGCGG + Intergenic
950907566 3:16552997-16553019 AAGGACAGAAGGAATGAGGGAGG + Intergenic
951150079 3:19278384-19278406 AAGGAAAAAAGGAAGGAGGGAGG + Intronic
951744023 3:25956681-25956703 ATGGACAGAAGGAATGAAGGAGG + Intergenic
951853698 3:27170921-27170943 ATGGAGAGGAGAAATGAGAGAGG - Intronic
951906683 3:27713903-27713925 AGGGAAAAAAGGAAGAAGGGGGG - Intergenic
952071183 3:29637920-29637942 TTGGCAAAGAGGAAAGAAGGTGG - Intronic
952142679 3:30497603-30497625 ATGGAAATGAGAAAGAAGGGTGG + Intergenic
952590132 3:34942578-34942600 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
952620993 3:35342374-35342396 ATGGAAAAAAGGAAGAAGTGGGG + Intergenic
952621008 3:35342432-35342454 ATGGAAAGAAGGAAAGATGGAGG + Intergenic
952786194 3:37157560-37157582 GGGGAAAAGAGGAAGGAGGGAGG + Intronic
953273928 3:41476068-41476090 AGGGAAAGGAGGAGGGAGGGAGG + Intronic
953757671 3:45661145-45661167 ATGGAGTAGGGGAATGTGGGTGG - Intronic
954091686 3:48289395-48289417 GTGGAAAGGTGGATTGAGGGAGG + Intronic
954703954 3:52468653-52468675 ATGGAAAAGGGCAAGGAGAGGGG - Intronic
954850150 3:53593270-53593292 AATGATAAAAGGAATGAGGGAGG + Intronic
954930453 3:54276664-54276686 AGGGAAAAGAGGAATTAGGGAGG + Intronic
955406559 3:58629393-58629415 ATGGGCAGGAGGAATGGGGGTGG + Intergenic
955573598 3:60333936-60333958 TAGGAAAACAGGAATTAGGGAGG - Intronic
955651683 3:61201591-61201613 ATGGAATAGAGGGATGTGGAGGG - Intronic
955899767 3:63740070-63740092 AGGGAAAAGAGTTATGAAGGGGG + Intergenic
955933723 3:64082574-64082596 AGGGAAAAGAAGGAAGAGGGAGG - Intergenic
956054461 3:65283917-65283939 GTGGTAAAGAGGAAGGAGGCAGG - Intergenic
956403414 3:68903901-68903923 ATGGAAAGGAGGAAAGAGGGAGG - Intronic
956486025 3:69722724-69722746 AAGGAAAAAAGGAAGGAAGGAGG + Intergenic
956783701 3:72624791-72624813 GGGGAAAACAGGAAGGAGGGAGG + Intergenic
956955968 3:74340408-74340430 ATGGAAAAAAAGAGTGAGAGAGG + Intronic
957197905 3:77094140-77094162 ATGGAAGTGGGGAATGAAGGGGG - Intronic
957506036 3:81122345-81122367 AAGTAAAAGTGGAAGGAGGGAGG - Intergenic
957829484 3:85497306-85497328 ATGGAAAAGAAAAAAGAGTGAGG - Intronic
957944377 3:87043931-87043953 GTGGAAAAGAGGGATGAGAAAGG + Intergenic
957979461 3:87489966-87489988 AAGGAAAAGAGGAATTAATGTGG + Intergenic
958695057 3:97516899-97516921 ATGAAATAAATGAATGAGGGGGG - Intronic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959457163 3:106576878-106576900 TGGGAAAAGAGGCATTAGGGAGG - Intergenic
960461190 3:117937894-117937916 GTAGAAAAGTGGTATGAGGGTGG - Intergenic
960619900 3:119627659-119627681 CTGAAAAAGAGGAAAGAAGGAGG - Intronic
960775132 3:121241698-121241720 AAGGAAGAGAAGAAAGAGGGTGG + Intronic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961378593 3:126482858-126482880 ATGGCAGAGGGGAATGGGGGAGG - Intronic
961747030 3:129070639-129070661 TGGGAAAACAGGAATTAGGGAGG + Intergenic
961912226 3:130329884-130329906 CTGGAAAGAAGGAAAGAGGGGGG + Intergenic
961920488 3:130420150-130420172 AAGGAAGAGAGGAAAGAAGGAGG + Intronic
962125895 3:132617398-132617420 ATTGAAAAGATGAAGGAAGGAGG - Intronic
962336631 3:134537671-134537693 ATGGAAAAGGAGACAGAGGGAGG - Intronic
962635924 3:137331388-137331410 ATGGAAAAGAAGAGTGAGCCAGG - Intergenic
963599006 3:147361135-147361157 GAGGAAAGGAGGAAGGAGGGGGG - Intergenic
963609000 3:147441698-147441720 AGAGAAAAGAGGAATCAGAGAGG - Intronic
964028306 3:152105038-152105060 ATGGAAAAGAGGAAGGAAAAGGG - Intergenic
964144440 3:153441948-153441970 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964164027 3:153680010-153680032 CAGGAAAACAGGAATTAGGGAGG - Intergenic
964268079 3:154922400-154922422 AAGGAAGAGAGCAAGGAGGGAGG + Intergenic
964749565 3:160041844-160041866 TAGGAAAATAGGAATTAGGGAGG + Intergenic
964779127 3:160315687-160315709 ATGGCAAAGGGAAAAGAGGGTGG - Intronic
965015982 3:163157021-163157043 TAGGAAAACAGGAATTAGGGAGG - Intergenic
965237899 3:166151017-166151039 AGTGAAATGAGGAATGTGGGAGG - Intergenic
965329155 3:167348379-167348401 AAAGAAAAGAAGAAGGAGGGAGG + Intronic
965632374 3:170746420-170746442 CAGGAAAACAGGAATTAGGGAGG - Intronic
965743794 3:171904087-171904109 AAGGAAAAGAGAGATGGGGGAGG + Intronic
965962814 3:174448729-174448751 TGGGAAAACAGGAATTAGGGAGG + Intronic
966064224 3:175797252-175797274 AGGGAAGATAGGCATGAGGGTGG + Intronic
966110589 3:176396471-176396493 CAGGAAAATAGGAATTAGGGAGG - Intergenic
966253072 3:177888331-177888353 ATTTAAAAGAGAAATGAGTGGGG - Intergenic
966259379 3:177956789-177956811 ATGGACAACAGGCATGAGTGAGG - Intergenic
966299982 3:178467837-178467859 ATGGAAAAGAGAAAGGGGGCAGG + Intronic
966630136 3:182063509-182063531 AAGGAACAGAGGAAGGAGGGAGG + Intergenic
967162151 3:186748337-186748359 CAGGAAAACAGGAATTAGGGAGG + Intergenic
967185401 3:186940346-186940368 AAAGAGAAGTGGAATGAGGGAGG - Intronic
967194732 3:187016526-187016548 AAGGGAAAGAGTAATGCGGGAGG + Intronic
967277374 3:187789905-187789927 AAGGAAGAGGGGAAGGAGGGAGG + Intergenic
967323009 3:188212661-188212683 AAGGGACAGAGGAATGAAGGGGG - Intronic
967444406 3:189548637-189548659 GGGGAAAATAGGAATTAGGGAGG + Intergenic
967445826 3:189565327-189565349 AAGGAAGAAAGGAAGGAGGGAGG - Intergenic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967523723 3:190467660-190467682 ATGGAAAAGATGTTTGAGAGGGG - Intergenic
967563571 3:190946608-190946630 TTGAAAGAGAGGCATGAGGGAGG + Intergenic
967656854 3:192060836-192060858 AAGGAAAAAAGGAGAGAGGGAGG + Intergenic
968481115 4:833489-833511 GGGGAAAGGAGGAAGGAGGGAGG + Intergenic
968687057 4:1967872-1967894 TGGGAAAACAGGAATTAGGGAGG + Intronic
968876535 4:3270586-3270608 AAGGACAAGAGGAAGGAGTGAGG - Intronic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969403457 4:6972670-6972692 GCGGAAAAGAGGGATGAGGAAGG + Intronic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
970061903 4:12042877-12042899 ATGCAAAAGAAGATTAAGGGAGG + Intergenic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970484554 4:16511486-16511508 AAGGAACAGATGAATGAAGGAGG - Intronic
970624792 4:17864576-17864598 CTGGAAAAGAGAAAAAAGGGTGG + Intronic
970674100 4:18429189-18429211 GTGGAAAAAAGGTATGAGGTTGG + Intergenic
970689738 4:18608832-18608854 AAAGAAAAAAGGAAAGAGGGTGG - Intergenic
970803944 4:20007728-20007750 AGGGAAAGGAGGAATGAGAAGGG + Intergenic
970832048 4:20351523-20351545 GTGGTAGAGAGGAATCAGGGTGG - Intronic
970837044 4:20421817-20421839 ATGGAGAAAGGGAAGGAGGGAGG - Intronic
970899175 4:21138825-21138847 ATGGAAAGGAGTCATGAGGCAGG + Intronic
970914952 4:21321874-21321896 AAGGAAGAAAGGAAGGAGGGAGG + Intronic
970914982 4:21321994-21322016 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
971246628 4:24935031-24935053 ATGGATTAGAGGAAAGAAGGAGG + Intronic
971408258 4:26342520-26342542 ATGGGAGAAAGGAATGAGGAGGG - Intronic
971843174 4:31881039-31881061 AGGGAAGAAAGGAAGGAGGGAGG - Intergenic
971992382 4:33916081-33916103 ATGCTAATGAGCAATGAGGGCGG - Intergenic
972185337 4:36521213-36521235 AAGCAAAAGAGAAATCAGGGAGG - Intergenic
972264929 4:37451081-37451103 TAGGAAAACAGGAATTAGGGAGG + Intergenic
972266446 4:37464580-37464602 ATGGAAAGAAAGAATGAGGGAGG + Intronic
972286409 4:37652617-37652639 ATGGGAAAGAGGGATGAAAGAGG + Intronic
972466836 4:39365941-39365963 AAGGAAGAGAGGAAGGATGGTGG - Intronic
972648952 4:40997122-40997144 TGGGAAAACAGGAATTAGGGAGG - Intronic
973024574 4:45251349-45251371 ATGGAAAACAGGAAATATGGTGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
973655622 4:53044624-53044646 AAGGAAAAAAGGAGGGAGGGAGG - Intronic
973739270 4:53903352-53903374 AAGGAAGAAAGGAAGGAGGGAGG + Intronic
973804749 4:54514896-54514918 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
973920757 4:55682538-55682560 TGGGAAAACAGGAATTAGGGAGG - Intergenic
974020444 4:56687990-56688012 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
974020481 4:56688113-56688135 AAGGAAAAAAGGAGGGAGGGAGG + Intergenic
974224455 4:59020343-59020365 AAGCAAAAGAGCAATGTGGGAGG - Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
974837452 4:67268115-67268137 ATGGAAACAAAGAAAGAGGGAGG - Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975029626 4:69599562-69599584 ATGGAAGAAAGGAAGGAGGAAGG + Intronic
975108728 4:70599592-70599614 ATGGAAGAGAGGAATGTGGTGGG - Exonic
975226317 4:71876557-71876579 AAGGAAAGGAGGAAGGAAGGAGG - Intergenic
975245673 4:72118004-72118026 AAGGAAAAAAGGAAGGAAGGGGG + Intronic
975470392 4:74759369-74759391 TTGGAAAAGGGTAATGTGGGAGG - Intronic
976035452 4:80814112-80814134 TTGGGAAAGAGTAATGATGGAGG - Intronic
976732989 4:88283399-88283421 ATGAAAAAGAGCAATGAGACCGG - Intronic
976805156 4:89037806-89037828 GAGGAAGAGAGGAAAGAGGGAGG - Intronic
977077862 4:92480804-92480826 AAGGAAAAGAGGACTGAAGTAGG - Intronic
977079377 4:92504379-92504401 TTGGAAAATAGGATTCAGGGTGG + Intronic
977088629 4:92639634-92639656 ATGAAATGGGGGAATGAGGGGGG + Intronic
977155451 4:93567249-93567271 ATTGTAAATAGGAATGTGGGGGG - Intronic
977183845 4:93911611-93911633 GAGGAATAGAGGAAAGAGGGAGG - Intergenic
977200785 4:94112910-94112932 ATGGAAAAGAGGGAGGGGGAGGG + Intergenic
977289444 4:95147934-95147956 TGGGAAAAGAGTAATGACGGAGG - Intronic
978196470 4:105978271-105978293 ATGGAAGAAAGGAAGGAGGAAGG + Intronic
978420827 4:108531127-108531149 ATGAGGCAGAGGAATGAGGGAGG + Intergenic
978535340 4:109756309-109756331 AAGGAAAAGAGGAGGGAGGGAGG + Intronic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978733799 4:112062482-112062504 AAGGAAAGAAGGAAAGAGGGAGG + Intergenic
979348546 4:119619004-119619026 ATTGAAAAGAGAAAAGAGGATGG - Intronic
979538442 4:121851396-121851418 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
979672332 4:123373119-123373141 AAGAAAAAGAGAAAGGAGGGAGG + Intergenic
980394784 4:132197602-132197624 ATGGAAATGAGGAATGGGGCTGG + Intergenic
980411312 4:132423150-132423172 GGGTAAAAGAGGAATGAGGTAGG + Intergenic
980907059 4:138958540-138958562 TTGGAACAGAGGATTCAGGGAGG + Intergenic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
981637963 4:146902152-146902174 AGGGAAAAGAGGAAGGGGGATGG - Intronic
982102064 4:151977706-151977728 AGGGGAAACAGGAATTAGGGAGG + Intergenic
982347646 4:154378470-154378492 AAGGAAAGAAGGAAGGAGGGAGG + Intronic
982354748 4:154453663-154453685 ATGGAAAGAAGGAAGGAAGGAGG - Intronic
982419296 4:155176138-155176160 AGGGAAAACAGGAATTAGAGAGG - Intergenic
982840734 4:160182477-160182499 ATGCAAAAGTGGAAAGAGGCAGG - Intergenic
982936328 4:161481835-161481857 AAGGAAAAGAGGAAATAGAGGGG - Intronic
983057203 4:163112171-163112193 ATGGAAAAAATGATTGGGGGGGG + Intronic
983160705 4:164410714-164410736 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
983255901 4:165400300-165400322 ATGGATGAGATGACTGAGGGAGG + Intronic
983292758 4:165826755-165826777 ATGGAAAATAGGAAGGAGGTGGG - Intergenic
983317862 4:166155060-166155082 ATTGAAAAGAGGAAGAAGAGTGG + Intergenic
983374088 4:166901042-166901064 ATGGAAAAAAGGAATGTCTGGGG - Intronic
983435965 4:167715797-167715819 AAGGAAGAAAGGAAGGAGGGAGG + Intergenic
983484408 4:168317416-168317438 ATGGAAAAGAGAAAAAAGGAGGG + Intronic
983580649 4:169306400-169306422 TTGGAAGAGGGGAAGGAGGGAGG + Intergenic
983615424 4:169699071-169699093 ATGGCAAGGAGGAATCAAGGTGG - Intronic
983834519 4:172371803-172371825 ATCAAAAAGAGGAAGGAGAGGGG - Intronic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
984241079 4:177219847-177219869 CAGGAATACAGGAATGAGGGAGG + Intergenic
984676544 4:182554946-182554968 AAGGAAAAGAGGAGGTAGGGAGG + Intronic
985208465 4:187566393-187566415 ATTGAAAGGAGGAAAGAAGGGGG - Intergenic
985283159 4:188306903-188306925 ATGGAAAACAGGAATTCGGGTGG + Intergenic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985545981 5:509444-509466 ATGGAAGGAAGGAAGGAGGGAGG + Intronic
985731145 5:1549727-1549749 ATGGAAATGAGGAGAGATGGCGG - Intergenic
985842524 5:2319232-2319254 TTGCAATAGAGGCATGAGGGGGG + Intergenic
985851610 5:2392548-2392570 ATGGAAGAGAAGAAAGAAGGAGG - Intergenic
985851626 5:2392626-2392648 AAGAGAAAGAGGAAGGAGGGAGG - Intergenic
985851637 5:2392674-2392696 AAAGAAGAGAGGAAGGAGGGAGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
985993767 5:3584889-3584911 ATGGGAGAAAGGAAGGAGGGAGG + Intergenic
985993816 5:3585083-3585105 AGGGACAAGAGGAAGGAAGGAGG + Intergenic
986071258 5:4286961-4286983 ATGGAAAACAGGAAAGAAGAGGG - Intergenic
986587238 5:9331093-9331115 TTGGAAAAGACGAATAAGTGTGG + Intronic
986656724 5:10020186-10020208 TTGTAAAATAGGAATGAGGATGG + Intergenic
987213848 5:15712712-15712734 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
987932178 5:24415385-24415407 ATGGACAGGAGGCAGGAGGGTGG - Intergenic
988158500 5:27487142-27487164 ATGGAGGATAGGAAGGAGGGTGG + Intergenic
988275810 5:29079983-29080005 AAGGAAAAGAGAGAGGAGGGAGG + Intergenic
988566263 5:32321863-32321885 TGGGAAAACAGGAATTAGGGAGG + Intergenic
988805648 5:34738076-34738098 ATGGAATTGAGGAATGAGATGGG + Intronic
989122863 5:38021621-38021643 AGGGAAGGAAGGAATGAGGGAGG - Intergenic
989238316 5:39175138-39175160 AGGGAAAAGGGGCATGAGGTAGG + Intronic
989325190 5:40184909-40184931 AAGAAAAAAAGGAAGGAGGGAGG + Intergenic
989489628 5:42035015-42035037 ATGGGAAGGAGGAATAAGAGAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990041676 5:51384230-51384252 ATAGCAAAGAGGAAGGGGGGGGG + Intronic
990198616 5:53346429-53346451 CAGGAAAAGAGAAATGAGGCTGG + Intergenic
990334568 5:54759513-54759535 GAGGAAAGGAGGAAGGAGGGTGG - Intergenic
990513036 5:56506378-56506400 ATGGTAAAAAGGAATCAGGAAGG - Intergenic
990782387 5:59379968-59379990 AGGGGAAAGGGGAATAAGGGAGG - Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
991348878 5:65700371-65700393 ATGAAAAAGAAGAATGAGCCGGG + Intronic
991433590 5:66573381-66573403 AAGGAGGAGAGGAAGGAGGGAGG + Intergenic
991433595 5:66573397-66573419 AGGGAGGAGAGGAAGGAGGGAGG + Intergenic
991773661 5:70062834-70062856 AAGGAAGAAAGGAAGGAGGGAGG + Intronic
991852955 5:70938258-70938280 AAGGAAGAAAGGAAGGAGGGAGG + Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992507861 5:77405890-77405912 ATAGAAAAGAGAGATGAGGCTGG + Intronic
992669219 5:79042185-79042207 ATGCAAAAGGGAAATGTGGGAGG - Intronic
993412491 5:87591186-87591208 TTGGAAAAGAGGTATGTGGATGG - Intergenic
993714668 5:91264148-91264170 ACTGAAAAGAGGTATTAGGGAGG + Intergenic
993722981 5:91340088-91340110 ATGGAAAAAAGGCATCAGAGAGG - Intergenic
993779096 5:92043204-92043226 AGGGACAAGTGGAATGAAGGAGG - Intergenic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
994957194 5:106546975-106546997 AGGGAAAAAGGGAAGGAGGGAGG + Intergenic
995031969 5:107491307-107491329 AAGGAAGGGAGGAAGGAGGGAGG - Intronic
995592066 5:113709589-113709611 AAGGAAAAGAGAAATGTGTGTGG - Intergenic
995802928 5:116019325-116019347 ATGGACAATATGTATGAGGGAGG - Intronic
996452884 5:123646892-123646914 ATGGAAAAAAATAATGAGGGAGG - Intergenic
996512676 5:124334700-124334722 AAGGAAGAAAGGAAGGAGGGAGG + Intergenic
996545989 5:124679380-124679402 AAGGAAAGAAGGAAGGAGGGAGG - Intronic
996847908 5:127921038-127921060 AAGGAAAGGAGGAAGGAGGAAGG + Intergenic
996915782 5:128710931-128710953 AAGGTAAATAGGAATTAGGGAGG - Intronic
997046489 5:130325362-130325384 TGGGAAAACAGGAATTAGGGAGG - Intergenic
997576320 5:134980349-134980371 AAGGAAGAGAGGAGGGAGGGAGG - Intronic
997774586 5:136589998-136590020 CTTGAAAAGAGCAATGAGGTTGG - Intergenic
998002326 5:138635034-138635056 AAGGAAGAAAGGAAGGAGGGAGG + Intronic
998014794 5:138723532-138723554 ATGGAGAAGATGAAAGAGAGGGG + Intronic
998365631 5:141629009-141629031 ATGTAACAGAGGAATGGGGAAGG + Intronic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
998461544 5:142313811-142313833 ATGGAAAAGAGGAAGGGGGGGGG + Exonic
998794640 5:145805196-145805218 ATGGAAATAAGGGATGAGGAGGG - Intronic
998811059 5:145966270-145966292 ATGGCAAAGAGGGATGACAGTGG + Intronic
999213980 5:149916132-149916154 ATAAAAAAGAGAAATGAGGCCGG - Intronic
999280533 5:150362417-150362439 ATGGAAAGGAGGCAGGAGAGGGG + Intronic
999482320 5:151960031-151960053 GTGAAAAAGAGGGATGAGGGAGG + Intergenic
999691415 5:154149057-154149079 AAGGAAAGGAGGAAGGAAGGAGG + Intronic
999751710 5:154632351-154632373 AGGGAAAGAAGGAAGGAGGGAGG - Intergenic
999872330 5:155765419-155765441 AAGGGAAAGAGGGAGGAGGGAGG + Intergenic
1000268949 5:159664726-159664748 GTGGAAAAGGAGCATGAGGGAGG - Intergenic
1000373733 5:160560605-160560627 AGGGGAAACAGGACTGAGGGTGG - Intergenic
1000997611 5:167974379-167974401 AAGGAAAGAAGGAAGGAGGGAGG + Intronic
1001121658 5:168985820-168985842 AAGGAAAGGAGGGATGATGGCGG + Intronic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1001337784 5:170814787-170814809 ATGAAAGGGAGAAATGAGGGTGG + Intergenic
1001546002 5:172570869-172570891 ATGGAAAAAAGGAAGGAGGGAGG + Intergenic
1001575237 5:172758901-172758923 CTAGAAGAGACGAATGAGGGAGG + Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1001773578 5:174312707-174312729 ATGGAAAAGAGAAAGAAGGGTGG - Intergenic
1001824640 5:174735321-174735343 ATGGAAAAGAGAAGAGAAGGGGG - Intergenic
1002828523 6:796187-796209 ATGGAAAACTGAAATGAAGGAGG - Intergenic
1002846405 6:949025-949047 ATAGAAAAGAAGGAGGAGGGAGG + Intergenic
1002908229 6:1468230-1468252 AGGGAAAAGAGAAATGAAAGGGG + Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003043400 6:2710565-2710587 ATGTAAAACAGGAATTAGGGAGG - Intronic
1003068281 6:2921340-2921362 ATGGAAAACAGGAACTCGGGAGG + Intergenic
1003172544 6:3731623-3731645 ACGGAAAAGAGGAACGTTGGTGG - Intronic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003311340 6:4972116-4972138 AGGGAAGCGTGGAATGAGGGAGG + Intergenic
1003785340 6:9479414-9479436 TGGGAAAACAGGAATTAGGGAGG - Intergenic
1003961167 6:11210792-11210814 ATAGAAAAGAGAAGTGAGGAAGG + Intronic
1003973440 6:11321162-11321184 AGGGAAAGAAGGAAGGAGGGAGG + Intronic
1003973446 6:11321182-11321204 AGGGAAAGAAGGAAGGAGGGAGG + Intronic
1003973452 6:11321202-11321224 AGGGAAAGAAGGAAGGAGGGAGG + Intronic
1004129011 6:12901434-12901456 GAGGAAAGGAGGAAAGAGGGAGG + Intronic
1004131177 6:12921538-12921560 AGGGAAAGGAGGAAGGAGGAAGG + Intronic
1004485636 6:16063704-16063726 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1004567566 6:16813074-16813096 CAGGAAAACAGGAATTAGGGAGG - Intergenic
1004573505 6:16870622-16870644 ATGCAAATAAAGAATGAGGGAGG - Intergenic
1004626856 6:17385064-17385086 AAGGAAGGGAGGAAAGAGGGAGG + Intergenic
1004812658 6:19276605-19276627 ATCGAAAAGAGGAAGGAGAGGGG + Intergenic
1004963319 6:20818004-20818026 TTGGTAAAGAGGACTGATGGGGG - Intronic
1005035165 6:21549278-21549300 AGGGAAGACAGGAATTAGGGAGG + Intergenic
1005087623 6:22022962-22022984 ATGGAAAAGAGGAGGGGGAGGGG - Intergenic
1005283784 6:24302785-24302807 ATGGAAAAAAGAACTGTGGGAGG - Intronic
1005310694 6:24556199-24556221 ATGGAAGAAAGGAAGGAAGGAGG - Intronic
1005886140 6:30099169-30099191 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1005900908 6:30215400-30215422 AGGGAGAAGTGGCATGAGGGAGG - Intergenic
1005901889 6:30223653-30223675 TGGGAAAACAGGAATTAGGGAGG + Intergenic
1005982577 6:30847732-30847754 AAGGAAATGAGGAATGTAGGTGG + Intergenic
1006048119 6:31317185-31317207 ATGGAAAAGAGGCCTCAGAGAGG + Intronic
1006245547 6:32731365-32731387 ATGGAAAAAAGGAAGGGTGGCGG - Intergenic
1006284098 6:33080189-33080211 ATGGAAAAGAGAAAGAAGGAAGG + Intronic
1006517642 6:34553665-34553687 CTGGAGAAGAGGAAAGAGAGAGG + Intronic
1007025733 6:38571484-38571506 ATTGACACCAGGAATGAGGGGGG + Intronic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007425752 6:41744838-41744860 TGGGAAGAGAGGAAGGAGGGAGG - Intronic
1007581463 6:42962727-42962749 AAGAGAAAGAGGAATCAGGGAGG - Intronic
1009044441 6:58221072-58221094 TTGGTAAAGAGAAATTAGGGAGG - Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009220266 6:60975316-60975338 TTGGTAAAGAGAAATTAGGGAGG - Intergenic
1009220273 6:60975354-60975376 ATGGAAAACAGAAATTAGGAAGG - Intergenic
1009315954 6:62222203-62222225 ATGGAAAAAGAGAGTGAGGGAGG + Intronic
1009328186 6:62380365-62380387 AGGGGAAAGAGGGATGATGGGGG + Intergenic
1009397210 6:63213411-63213433 TGGGAAAACAGGAATTAGGGAGG - Intergenic
1009519692 6:64665714-64665736 ATGGAAAAAAGAAAAGCGGGAGG - Intronic
1009530546 6:64808028-64808050 AGGGAAAGGAGGAAGGAAGGAGG - Intronic
1009566551 6:65318248-65318270 CTGGAAAAGAGGAGTGAGAAGGG - Intronic
1009781217 6:68273411-68273433 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1010351463 6:74879898-74879920 AAGTAAAAGAGGAATGAAAGAGG + Intergenic
1010744371 6:79544119-79544141 ACAGAAAAGAGGGATGAGGAAGG - Intergenic
1010989896 6:82468952-82468974 AGGGAAAACAGGAATTAGGAAGG - Intergenic
1011490047 6:87882314-87882336 TGGGAAAACAGGAATTAGGGAGG + Intergenic
1011714055 6:90085683-90085705 AAGGGTAACAGGAATGAGGGAGG + Intronic
1011823432 6:91279038-91279060 ATGGAAGAGAAGAAGGAGAGAGG - Intergenic
1011854282 6:91669403-91669425 ATGGAAACGTGTAATCAGGGTGG - Intergenic
1011891169 6:92162012-92162034 AAGGAAGGAAGGAATGAGGGAGG + Intergenic
1011937122 6:92793928-92793950 CTGGAAAAGAGCAAAGATGGAGG - Intergenic
1012306237 6:97661546-97661568 AAGGAAAAGAAGACTGAGAGAGG - Intergenic
1012368782 6:98477454-98477476 TAGGAAAACAGGAATTAGGGAGG - Intergenic
1012633446 6:101503353-101503375 ATAGAAAGGAGGAAGAAGGGGGG + Intronic
1012662680 6:101922148-101922170 ATGGAAGGAAGGAGTGAGGGAGG - Intronic
1013068379 6:106705455-106705477 TGGGAAAACAGGAATGAGGGAGG + Intergenic
1013256615 6:108394045-108394067 AAGGAAAGGAGGAGGGAGGGAGG - Intronic
1013646902 6:112152818-112152840 TTAGAAAAGAGGAAGGAGGCAGG - Intronic
1013653381 6:112219440-112219462 GTGGAAAAGAGGATTCAGTGTGG - Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014561865 6:122900939-122900961 AAGGAAAGAAGGAGTGAGGGAGG - Intergenic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015085563 6:129287060-129287082 AAGGAAGGGAGGAAAGAGGGAGG + Intronic
1015326981 6:131934176-131934198 ATGTACAAGAGGAAGGAGGTGGG + Intergenic
1015357562 6:132297010-132297032 ATGGAAAGGAAAAAGGAGGGAGG + Exonic
1015385896 6:132623035-132623057 AAGGAAAAAAGGAAGGAAGGAGG - Intronic
1015645214 6:135379941-135379963 AGGGAGAAGGGGAAGGAGGGAGG - Intronic
1016009080 6:139119909-139119931 TGGGAAAACAGGAATTAGGGAGG - Intergenic
1016184415 6:141181512-141181534 ATCGAAAAGGGGAAGGAGAGGGG + Intergenic
1016201060 6:141409060-141409082 TTGGAGAACAGGAATTAGGGAGG - Intergenic
1016242742 6:141951531-141951553 CAGGAAAACAGGAATTAGGGAGG - Intergenic
1016317718 6:142808554-142808576 ATGGAAGAGAGAGATGGGGGAGG + Intronic
1016438195 6:144059145-144059167 ATGGAATGCAGGAATGAAGGAGG - Intronic
1016516416 6:144897383-144897405 ATGTAAAACAGGAATTAAGGAGG + Intergenic
1016897335 6:149066339-149066361 AGAGAAAAGATGAAAGAGGGAGG + Intronic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017144796 6:151225007-151225029 AAAGAAAAGAGAAAGGAGGGAGG - Intergenic
1017530345 6:155284148-155284170 ATGGCAAAGAAGTATGAAGGTGG + Intronic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1018089903 6:160337210-160337232 TTAGGAAAGAGGCATGAGGGAGG + Intergenic
1018158821 6:161016770-161016792 CTGGAAAAGAGTAATGCTGGAGG - Intronic
1018203033 6:161412710-161412732 ATAGAATGGAGGAATGAGTGAGG - Intronic
1018223047 6:161600788-161600810 AGAGAAAAGGGGAATCAGGGAGG - Intronic
1018335044 6:162777872-162777894 AAGGAAAGAAGGAAGGAGGGTGG - Intronic
1018542889 6:164902128-164902150 ATGGCAAAGTGGAAAGAGGGTGG + Intergenic
1018665513 6:166132900-166132922 AAGGAAAGGAGGAGGGAGGGAGG + Intergenic
1019180443 6:170184309-170184331 GTGGAAAATGGAAATGAGGGAGG - Intergenic
1019273910 7:166101-166123 AAGGAAAGAAGGAAGGAGGGAGG - Intergenic
1019327620 7:446062-446084 AAGGAAAGGAAGAAGGAGGGAGG + Intergenic
1020724701 7:11797358-11797380 AAGGAAAGAAGGAAAGAGGGAGG - Intronic
1020893252 7:13906107-13906129 AGAGAAAAGAGGCAGGAGGGAGG - Intronic
1021373946 7:19883793-19883815 ATAGAAAAGAAGAATGAGATTGG - Intergenic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1021950502 7:25769546-25769568 ATGGAAAGAAAGAAGGAGGGAGG + Intergenic
1021957466 7:25840344-25840366 CTGGAGAAGAGGTGTGAGGGAGG - Intergenic
1022218731 7:28291058-28291080 ATGGAAAGAAGAAATGAGGCTGG - Intergenic
1022235392 7:28455756-28455778 GTGTAAAGGAGGAATGAGAGAGG + Intronic
1022318518 7:29266274-29266296 ATGAAGAAGAGGGAGGAGGGAGG - Intronic
1022337318 7:29433900-29433922 AGGGAAGAAAGGAAGGAGGGAGG + Intronic
1022379017 7:29842474-29842496 CTGGCAAACAGGAACGAGGGAGG - Intronic
1022512369 7:30947845-30947867 ATGGCAAAAAGGATTGAAGGAGG - Intronic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1023111876 7:36821596-36821618 AAGGAAAGAAGGAAGGAGGGAGG + Intergenic
1023340938 7:39218770-39218792 AGGGATAAGAGGAAAGAGAGAGG + Intronic
1023525655 7:41100097-41100119 GGGGAAAACAGGAATTAGGGAGG - Intergenic
1023873481 7:44274958-44274980 ACAGAAAAGAGGAGTGAGGCAGG + Intronic
1023880954 7:44321135-44321157 AGGGAAGAGAGGAATGGAGGAGG - Intronic
1024001502 7:45192649-45192671 TGGGAAAAGAGGAATTAGCGAGG + Intergenic
1024071003 7:45785159-45785181 AAGGAAAAAAGGAAGGAAGGAGG - Intergenic
1024270160 7:47635850-47635872 AAGGAGAAGAGGAGTGAAGGAGG + Intergenic
1024402089 7:48936012-48936034 ATGGAAACAAGGAAGGAGAGGGG + Intergenic
1024471347 7:49770943-49770965 AAGGAAGAAAGGAAAGAGGGAGG + Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1025065415 7:55850679-55850701 AGGGAAAAGAGGAAGGAGATAGG - Intronic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025830600 7:65045888-65045910 AAGGAAAGGAAGAAGGAGGGTGG - Intergenic
1025840385 7:65141208-65141230 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1025878329 7:65508956-65508978 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1025882672 7:65554756-65554778 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1025890771 7:65647847-65647869 ATGGGAGAGAAGAAGGAGGGCGG + Exonic
1025917755 7:65879674-65879696 AAGGAAAGGAAGAAGGAGGGTGG - Intronic
1026061640 7:67031738-67031760 CTAGAAATGAGGAATGAGTGGGG + Intronic
1026207272 7:68268988-68269010 AAGGAAAGAAGGAAAGAGGGAGG - Intergenic
1026506106 7:70985481-70985503 TGGGAAAATAGGAATTAGGGAGG - Intergenic
1026589155 7:71680729-71680751 AAGGAAGAAAGGAAGGAGGGAGG - Intronic
1026632402 7:72048781-72048803 AAGGAAAAAAGGAAGGAGGAAGG - Intronic
1026674466 7:72417299-72417321 ATGGAAAGGTGGAGTGGGGGAGG - Intronic
1026716710 7:72795696-72795718 CTAGAAATGAGGAATGAGTGGGG - Intronic
1026865058 7:73818544-73818566 AAGGAAGAAAGGAAGGAGGGAGG - Intronic
1027475915 7:78631269-78631291 ATGGGATAAAGGAGTGAGGGAGG - Intronic
1027694625 7:81394805-81394827 ATGGAAAAAAAGAGAGAGGGAGG + Intergenic
1028450558 7:90977420-90977442 CGGGGAAAGAGGAATTAGGGAGG + Intronic
1028516115 7:91679910-91679932 ATGGAAAAGGGTAAATAGGGAGG + Intergenic
1028636775 7:92997966-92997988 AGGGAAGGGAGGAAGGAGGGAGG - Intergenic
1028996634 7:97107502-97107524 TGGGAAAACAGGAATTAGGGAGG + Intergenic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029189364 7:98760871-98760893 ATGGAAAAGATGAGAGAGGCAGG + Intergenic
1029408035 7:100389615-100389637 AAGGAAAGAAGGAAGGAGGGAGG + Intronic
1029630473 7:101747228-101747250 GCGGAAAAGAGGGATGAGGAAGG - Intergenic
1029633846 7:101770712-101770734 AAGGAAGAAAGGAAGGAGGGAGG - Intergenic
1030371066 7:108699839-108699861 ATGGAAGAGAGTAATGAAGTTGG - Intergenic
1030781370 7:113604273-113604295 ATGGGGCAGAGGCATGAGGGAGG + Intergenic
1031310884 7:120195621-120195643 TAGGAAAAGAGTAAAGAGGGAGG - Intergenic
1031483334 7:122303451-122303473 AAGGAAAGGAGGAGCGAGGGAGG + Intronic
1031917743 7:127578917-127578939 GGGGAAAAGGGGGATGAGGGGGG + Intergenic
1032217497 7:129968970-129968992 ATGGAAAAGAGAGAGGAGGCCGG + Intergenic
1033683407 7:143618720-143618742 GGGGAAAAGAGGGATGAGGAAGG + Intergenic
1033701206 7:143838918-143838940 GGGGAAAAGAGGGATGAGGAAGG - Intergenic
1033804207 7:144936446-144936468 ATGAGGAAGAGGAATGTGGGTGG - Intergenic
1034717578 7:153257464-153257486 ATGGATAAAGGGAATGGGGGTGG + Intergenic
1034778365 7:153853101-153853123 AAGGAAAAGAGGAATCACAGAGG + Intergenic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1035143293 7:156786132-156786154 AGGGAAAGAAGGAATGAGGCCGG + Intronic
1035274417 7:157738904-157738926 ATGGAAAAGAGTCAGGAGAGAGG + Intronic
1035632321 8:1117468-1117490 TTAGAAATGAGGACTGAGGGTGG + Intergenic
1035775564 8:2185065-2185087 AGGGAAAAGAGGGAAGAGGCAGG + Intergenic
1035913416 8:3594121-3594143 ATGGAAAAGAGTGAAGAGTGAGG - Intronic
1036190687 8:6667624-6667646 ATGGAAAGAAGGAAGAAGGGAGG + Intergenic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036962944 8:13265756-13265778 AAGGAAGGAAGGAATGAGGGAGG - Intronic
1037226880 8:16603043-16603065 ATGGCAAAGAGGAATTAAGGTGG + Intergenic
1037527939 8:19745887-19745909 TCGGAAAACAGGAATTAGGGAGG + Intronic
1037558355 8:20049063-20049085 CAGGAAAACAGGAATGGGGGTGG - Intergenic
1037739644 8:21597992-21598014 ATGGGAGAGAGGCAGGAGGGAGG + Intergenic
1038232483 8:25714995-25715017 AAGGAAATAAGGAGTGAGGGAGG - Intergenic
1038383572 8:27119765-27119787 TGGGAAAACAGGAATTAGGGAGG - Intergenic
1038476948 8:27875251-27875273 AGGGAAGAAAGGAAGGAGGGAGG - Intronic
1038644698 8:29351876-29351898 ATGCAAAAGAGAAATGGGGATGG - Intergenic
1038663418 8:29516846-29516868 ATGGATAGGAGGAAGGAAGGAGG + Intergenic
1038820933 8:30951252-30951274 AGGGAAGGGAGGAAGGAGGGAGG - Intergenic
1038914476 8:32005131-32005153 ATGGAAGAGAGGAAGGAAGGAGG + Intronic
1039104028 8:33970915-33970937 ATGGACAGGAGGCATGAGGGTGG - Intergenic
1039160932 8:34618865-34618887 AAGGAAAAAAGAAAGGAGGGAGG + Intergenic
1039187258 8:34931136-34931158 AAGGAAAGGAGGAAGGAGGGAGG + Intergenic
1039203969 8:35129012-35129034 ATGGGAAAGAGGAAAGAGCTTGG + Intergenic
1039568202 8:38565823-38565845 AGAGAAACGAGGAAGGAGGGAGG - Intergenic
1039600530 8:38833243-38833265 GCGGAAAAGAGGGATGAGGAAGG + Intronic
1039601487 8:38842085-38842107 AGGGTAAGGAGGAATGGGGGCGG - Intronic
1039727788 8:40238490-40238512 AGGGAGAGAAGGAATGAGGGAGG - Intergenic
1040384288 8:46903185-46903207 AGAGAAAAGAGGGAGGAGGGTGG + Intergenic
1040576303 8:48654382-48654404 ATGGAAGAGAGGAAGAAGGAAGG - Intergenic
1040853486 8:51925444-51925466 AGGGAAAACAGAAATTAGGGAGG + Intergenic
1041543074 8:59009034-59009056 AAGGAAAAATGGAAAGAGGGAGG - Intronic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1041871001 8:62634335-62634357 TGGGAAAACAGGAATTAGGGAGG - Intronic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1042284539 8:67093624-67093646 GTGGAAAAGAGTACTGAGGTAGG + Exonic
1042554270 8:70021107-70021129 AGGGGAAAGAGGATTGAGGCTGG - Intergenic
1042770721 8:72378529-72378551 CTGAAAAAGAGGAGTGAGAGTGG - Intergenic
1042843919 8:73151352-73151374 AAAGAAAATAGGAAGGAGGGAGG - Intergenic
1042927683 8:73983238-73983260 ATGGCACAGAGGAATGGCGGTGG - Intergenic
1042927879 8:73985139-73985161 ATAGCAAAGTGGCATGAGGGAGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043083495 8:75797045-75797067 AGAGAAAGGAGGAATGAGGTAGG - Intergenic
1043243489 8:77967407-77967429 ATGGAAAAGAGGTGGGAGGAGGG + Intergenic
1043438195 8:80254383-80254405 ATAGAGGAGAAGAATGAGGGTGG + Intergenic
1043560944 8:81492368-81492390 AAAGTAAAGAGGAATGAGAGAGG + Intergenic
1044324445 8:90843959-90843981 ATAGAATAGAGGAAAGATGGAGG - Intronic
1044381514 8:91539618-91539640 GGGGAAAAGAGAGATGAGGGAGG - Intergenic
1044390624 8:91646147-91646169 TTGGAAGAAAGGAAGGAGGGAGG + Intergenic
1044714270 8:95086561-95086583 AGAGACAAGAGGAAGGAGGGAGG - Intronic
1044740850 8:95324663-95324685 ATTGTAAAGGGGAAAGAGGGAGG - Intergenic
1045012585 8:97971010-97971032 GGGGAAAACAGGAATTAGGGAGG + Intronic
1045054671 8:98358693-98358715 ATGGTTTAGGGGAATGAGGGGGG + Intergenic
1045495428 8:102704036-102704058 TGGGAAAACAGGAATTAGGGAGG - Intergenic
1045744913 8:105406966-105406988 ATAGAACAGTGGAATGAGGAAGG + Intronic
1045778970 8:105841245-105841267 AAGGAGAAGGGGAATGAAGGAGG - Intergenic
1045866692 8:106874254-106874276 ATTAAAAAGAGGAAGGAAGGGGG + Intergenic
1046153957 8:110263295-110263317 ATGGAAGAAAGGAAGGAGGGAGG - Intergenic
1047061550 8:121232427-121232449 ATGGAATAGAAGAATGGTGGTGG - Intergenic
1047458725 8:125041241-125041263 CTGGCAAAGGGGAGTGAGGGAGG + Intronic
1047650686 8:126916978-126917000 AAGGAAAAGAGGAAAAAAGGAGG - Intergenic
1047809754 8:128395832-128395854 AAGGAAAATAGGAAAGAGAGAGG - Intergenic
1047832299 8:128648059-128648081 ATGGAAGGGAGGAAAAAGGGAGG - Intergenic
1048146096 8:131845259-131845281 AAGGAAAAAAGTAAGGAGGGAGG - Intergenic
1048171668 8:132112600-132112622 AAGGGAAAGAGAAATGAAGGAGG - Intergenic
1048235954 8:132691001-132691023 ATGGAAAAGAGGCAGGGAGGAGG - Intronic
1048267822 8:133003216-133003238 AAGGAAATAAGGAAGGAGGGAGG + Intronic
1048357034 8:133661982-133662004 ATGGGAAAAAAGAACGAGGGTGG + Intergenic
1048476383 8:134745518-134745540 AGGGAAAAGAGGAGTTAGTGAGG + Intergenic
1048593376 8:135842200-135842222 TTGGAAAAGAGCAAATAGGGAGG - Intergenic
1049169215 8:141148237-141148259 GTGGAAAGGAGGGAGGAGGGAGG + Intronic
1050038548 9:1463156-1463178 AAGGAAAGGAGGAAGGAAGGAGG - Intergenic
1050330591 9:4541505-4541527 GTGTGAAAGAGGAAAGAGGGAGG + Intronic
1050475918 9:6040989-6041011 AAGGAAAAGAGGAAGAAGGAAGG - Intergenic
1050793733 9:9509538-9509560 TGGGAAAACAGGAATTAGGGAGG - Intronic
1051139385 9:13962159-13962181 AGGGAAGAGAGGAATGAAAGCGG - Intergenic
1051185116 9:14452343-14452365 AGGGAAAGTAGGAAGGAGGGAGG + Intergenic
1051213701 9:14773794-14773816 ATGGAAAAGAGGATGGAGATTGG - Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051497703 9:17743522-17743544 AGGGAAAGGAAGAAGGAGGGAGG - Intronic
1051653485 9:19354041-19354063 GTAGAATAGGGGAATGAGGGTGG - Intronic
1051700907 9:19822932-19822954 AAGGAGAAGAGGAAGGAAGGAGG - Intergenic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1053095595 9:35325250-35325272 GTTGTGAAGAGGAATGAGGGGGG + Intronic
1053514745 9:38721264-38721286 AAGAAAAGGAGGAAAGAGGGAGG - Intergenic
1053595023 9:39551815-39551837 TGAGAAAAGAGGAAAGAGGGGGG - Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1053852805 9:42306843-42306865 TGAGAAAAGAGGAAAGAGGGGGG - Intergenic
1054460253 9:65458668-65458690 ATGGGAGAGAGGTGTGAGGGGGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054772528 9:69096239-69096261 AAGGAAAGAAGGAAGGAGGGAGG - Intronic
1054936254 9:70691930-70691952 GAGGAAAAGAGGGATGAGGAAGG - Intronic
1055078876 9:72246941-72246963 GCAGAAAAGAGGGATGAGGGAGG - Intronic
1055419872 9:76128034-76128056 ATGAGAAATAGAAATGAGGGGGG + Intronic
1056163847 9:83923183-83923205 ATGAAATATAGGAATGAAGGTGG + Intergenic
1056180431 9:84077061-84077083 ATGGAAAAGAGGAGGGAGATTGG + Intergenic
1056455877 9:86759342-86759364 AAGGAAAAAAGGAAGGAAGGAGG + Intergenic
1056468333 9:86880771-86880793 AGGTACAAAAGGAATGAGGGTGG - Intergenic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1056860889 9:90180637-90180659 CAGGAAAACAGGAATTAGGGAGG - Intergenic
1056878272 9:90360244-90360266 TTGAAAATGAGGAATGAGGTGGG - Intergenic
1056893933 9:90523305-90523327 ATGGAACAGAGGAAAGAGGCTGG - Intergenic
1057034315 9:91800653-91800675 ATGGAAAACAGGAAGGGGCGAGG + Intronic
1057042161 9:91855708-91855730 ATGGATGAGGGGAATGGGGGTGG + Intronic
1058822123 9:108742223-108742245 ATCGGTAAGAGGAATGAGGCCGG - Intergenic
1058872671 9:109216143-109216165 ATGGAAAAGAGAAAGAGGGGAGG - Intronic
1059226118 9:112674768-112674790 AAGGAGGAGAGGAAAGAGGGGGG - Intergenic
1059489982 9:114658968-114658990 CTGGAAAAGAGAAAGGAGGTTGG - Intergenic
1059713698 9:116893694-116893716 AGGGAAGAGAGGAGAGAGGGAGG - Intronic
1059745035 9:117191933-117191955 ATGGAAAAGGATCATGAGGGAGG + Intronic
1059799617 9:117737061-117737083 ATGGAAAAGAGGAATGTCAAGGG - Intergenic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1059845232 9:118268276-118268298 CCAGAAAAGAGGAGTGAGGGTGG - Intergenic
1060012226 9:120053846-120053868 ATGGCAAAGGGGAATTAAGGTGG - Intergenic
1060185285 9:121560390-121560412 AGGGAAAGGAGGAGAGAGGGAGG + Intergenic
1061081325 9:128372244-128372266 GTGGAAAAGAGGAAATAGGTAGG + Intronic
1061257317 9:129460347-129460369 ATGGAGAGGAGGAGGGAGGGAGG - Intergenic
1061619185 9:131800089-131800111 CCAGACAAGAGGAATGAGGGTGG - Intergenic
1062154774 9:135040922-135040944 AGGGAAGAGAGGGATGAAGGAGG - Intergenic
1062327121 9:136017730-136017752 CTGGGACACAGGAATGAGGGAGG - Intronic
1062515258 9:136930645-136930667 AAAGAAAAAAGGAAGGAGGGAGG - Intronic
1203613294 Un_KI270749v1:28339-28361 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1185593065 X:1291424-1291446 AAGAAAAAGAGGAAGGAAGGAGG - Intronic
1185660563 X:1725525-1725547 GTGGCAAAGACGAATGAAGGTGG + Intergenic
1185726574 X:2426590-2426612 AAGGAAAGAAGGAAAGAGGGAGG - Intronic
1185766929 X:2733013-2733035 TTGGAAAAAAGGAAGCAGGGAGG - Intronic
1185928742 X:4176308-4176330 ATGGGAATGGGGGATGAGGGAGG + Intergenic
1185954834 X:4478168-4478190 ATGAAAGAAAGGAAGGAGGGAGG + Intergenic
1186145699 X:6621845-6621867 AGGGAAGAAAGGAAGGAGGGAGG + Intergenic
1186239990 X:7555412-7555434 AAGGAAGAGAGGAAGAAGGGAGG + Intergenic
1186291870 X:8109096-8109118 AAGGAAAGGAGGAAGGAGGGAGG - Intergenic
1186615085 X:11177759-11177781 ATGTAAAAGTGGAATGATGGGGG - Intronic
1187264594 X:17719186-17719208 AGGGAAAGAAGGAATGAAGGAGG + Intronic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187278283 X:17835697-17835719 AGGGAACAGAGGAAGGAGGTGGG - Intronic
1187783871 X:22862157-22862179 AGGGAAAAGAGGAAGGGGGAAGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188170218 X:26915282-26915304 CAGGAAAACAGGAATCAGGGAGG - Intergenic
1188186383 X:27120534-27120556 TTAGAAAACAGGAATGAGGGAGG - Intergenic
1189141962 X:38616532-38616554 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1189205548 X:39235450-39235472 AGGGAAAAGAGCAAGGTGGGGGG - Intergenic
1189246763 X:39569275-39569297 AAGGAAAAGAGAGAGGAGGGAGG - Intergenic
1189289093 X:39872733-39872755 AGGGAAAAGAGGAGGGAGAGAGG - Intergenic
1189450359 X:41123108-41123130 AAGGACAAGAGGTATGAGGGTGG - Intronic
1189958795 X:46305709-46305731 CAGGAAAACAGGAATTAGGGAGG + Intergenic
1190187457 X:48248259-48248281 TTGGAAAAGAAGAATAAGGTGGG - Intronic
1190191950 X:48284424-48284446 TTGGAAAAGAAGAATAAGGTGGG - Intergenic
1190363376 X:49669452-49669474 AAGGAAAACAGGAATTAGAGAGG + Intergenic
1190436695 X:50432866-50432888 ATAGAAAAGAAGAAGGGGGGAGG - Intronic
1190595246 X:52046570-52046592 TTGAAAAAGAGCAATGATGGAGG + Intergenic
1190613578 X:52207503-52207525 TTGAAAAAGAGCAATGATGGAGG - Intergenic
1190936821 X:55005223-55005245 ATGCATAAGAGGAATGAGGCAGG - Intronic
1192113327 X:68387397-68387419 ATGGATTATAGGAATGAGAGTGG - Intronic
1192735304 X:73844915-73844937 AGGGAAAGGAAGATTGAGGGTGG + Intergenic
1194256221 X:91638236-91638258 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1194644464 X:96441655-96441677 ATGGATAAGAGTAATTGGGGTGG + Intergenic
1194698058 X:97080230-97080252 AAGGAAGAAGGGAATGAGGGAGG - Intronic
1195026494 X:100882821-100882843 ATGGCAAAGGGGAATGAAGGTGG + Intergenic
1195328402 X:103776597-103776619 CTGGAAATGTGGATTGAGGGTGG - Exonic
1195866666 X:109439760-109439782 ATGGAAATGAGGAATGAAGTTGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196619352 X:117804906-117804928 ATGGAAAGAAGGAAAGAGGGAGG + Intergenic
1196715276 X:118805080-118805102 TGGGAAAACAGGAATTAGGGAGG - Intergenic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1196812673 X:119641128-119641150 AAGGGGAAGTGGAATGAGGGGGG + Intronic
1196913219 X:120505512-120505534 AAGGAAGGGAGGAAGGAGGGAGG - Intergenic
1197867867 X:131037652-131037674 AAGGAAAAGGGGAATGAGAAAGG - Intergenic
1197887194 X:131230934-131230956 ATGGAAAGGAGGAAAGGGAGAGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198204361 X:134452203-134452225 AGGGAAGAAAGGAAAGAGGGAGG + Intergenic
1198210945 X:134515467-134515489 AAGGAAAGAAGGAAGGAGGGAGG + Intronic
1198229146 X:134673191-134673213 AGGAAGAAGAGGAAAGAGGGAGG + Intronic
1199344667 X:146724277-146724299 AAGGAAGAAAGGAAGGAGGGAGG + Intergenic
1199755635 X:150862369-150862391 AAGTAAAACAGGGATGAGGGAGG + Intronic
1200574950 Y:4877520-4877542 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1201256355 Y:12112015-12112037 AGGGAAAAGAGAAGAGAGGGAGG - Intergenic
1201625635 Y:16011891-16011913 AAGGAAAAAAGGAAGGAAGGAGG + Intergenic
1201935567 Y:19407366-19407388 GTGGAAAAGAGTAATGATGTAGG + Intergenic