ID: 1107577112

View in Genome Browser
Species Human (GRCh38)
Location 13:41737460-41737482
Sequence TGAATTTGTCTTTTATAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 689
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 637}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107577112_1107577113 -8 Left 1107577112 13:41737460-41737482 CCTATCTATAAAAGACAAATTCA 0: 1
1: 0
2: 3
3: 48
4: 637
Right 1107577113 13:41737475-41737497 CAAATTCACTTTGCCATATTAGG 0: 1
1: 0
2: 0
3: 37
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107577112 Original CRISPR TGAATTTGTCTTTTATAGAT AGG (reversed) Intronic
900153644 1:1193984-1194006 TAATTTTGTTTTTTAGAGATGGG - Intronic
901255527 1:7822599-7822621 TAAATTTGCATTTTATTGATTGG - Intronic
902723746 1:18321966-18321988 TGAAATTGAGTTTTACAGATGGG + Intronic
903078623 1:20790938-20790960 AGAATTTTTTTTTTAGAGATGGG + Intergenic
903702453 1:25260395-25260417 TGAGTTTGTAATTGATAGATTGG - Intronic
903711693 1:25330549-25330571 TGAGTTTGTAATTGATAGATTGG - Intronic
903795513 1:25926237-25926259 TGTATTTTTTTTTTAGAGATGGG - Intergenic
904661788 1:32090957-32090979 TAAATTTGTTTTGTAGAGATGGG + Intronic
905782577 1:40725459-40725481 TGAAATTGTCAATTTTAGATTGG + Intronic
906288449 1:44603567-44603589 TGAATTTGTCATTTTTAGCTGGG - Intronic
907378656 1:54066242-54066264 TTTTTTTGTTTTTTATAGATGGG - Intronic
909186338 1:72491280-72491302 TTAATTTTTTTTTTAGAGATAGG - Intergenic
909258822 1:73460307-73460329 TTATTTTTTATTTTATAGATAGG + Intergenic
909452063 1:75809070-75809092 TAAATTTTTTTTGTATAGATGGG + Intronic
909730376 1:78881465-78881487 TGGATTTGTGTTTTTTAGAATGG + Intergenic
910029202 1:82696112-82696134 TGAATATTTCTTTTATGGACAGG - Intergenic
910317269 1:85900631-85900653 TTATTTTATCTTTTAAAGATGGG - Intronic
910562650 1:88608657-88608679 TAAATTTGTTTTGTAGAGATGGG - Intergenic
910708396 1:90154045-90154067 TTTCTTTGTCTTTGATAGATTGG + Intergenic
910878486 1:91900844-91900866 TGAATTTGCTTTTTCAAGATAGG - Intronic
911123286 1:94317156-94317178 AGAATTTGTCTTTTGGTGATTGG - Intergenic
911199533 1:95030905-95030927 TGATTTTCTATTTTATATATTGG - Intronic
913276194 1:117140553-117140575 TGAATTTTTTTTTAAGAGATAGG + Intergenic
913373157 1:118122977-118122999 TCAATTTGTCCTTTTCAGATTGG - Intronic
913420897 1:118667667-118667689 TGAAATTATCTTTTAAAAATTGG + Intergenic
914445007 1:147742723-147742745 TGTATTTTTTTTGTATAGATGGG + Intergenic
915425735 1:155825155-155825177 TTAATTTTTTTTTTAGAGATAGG - Intronic
916139217 1:161679342-161679364 TGTATTTGTGTTTTAAAAATTGG + Intergenic
916357174 1:163924628-163924650 TTATTTTTTCTATTATAGATTGG - Intergenic
916645257 1:166778356-166778378 TGAGTTTTTCTTTTTGAGATAGG - Intergenic
917705011 1:177623937-177623959 TGTATTTGTCTGATATAGAATGG - Intergenic
917934307 1:179849580-179849602 TGAATTTTTTTTTAAGAGATGGG + Intronic
918230882 1:182530471-182530493 TGAATTTTTATTTTGTAGAGAGG - Intronic
918578386 1:186093883-186093905 TAAAATGGTCTTTTATAGACAGG + Intronic
918849651 1:189669970-189669992 TTATTTTTTCTTTTATATATTGG - Intergenic
918995037 1:191747069-191747091 TGAATTTTTTTTTAAGAGATGGG - Intergenic
919265478 1:195258800-195258822 TGAATTTTTTTTTTATATCTAGG - Intergenic
919384641 1:196905047-196905069 TGAATACTTCTTTTATAGAAGGG - Intronic
919598618 1:199594972-199594994 TGTATTTTTGTTTTATAGGTAGG - Intergenic
919624031 1:199893871-199893893 TTAACTTTTTTTTTATAGATGGG + Intergenic
920585837 1:207159518-207159540 TGAATTTTTTTTTTTGAGATAGG + Intergenic
920828408 1:209444007-209444029 TGATTTAGTCATTTATAGCTTGG - Intergenic
921393053 1:214636598-214636620 TGAATTTGGCTTTGCTACATCGG + Intronic
921730656 1:218574410-218574432 TGCAAATTTCTTTTATAGATTGG - Intergenic
922002323 1:221491981-221492003 TGAATTTTTTTTGTAGAGATAGG - Intergenic
922382808 1:225049667-225049689 TGGATTTGTGTTTTATATTTAGG + Intronic
922404127 1:225294512-225294534 TTAATTTGTCTTTAATAGTTTGG + Intronic
922541175 1:226421169-226421191 TGTATTTTTCTTGTAGAGATGGG + Intergenic
923737133 1:236620856-236620878 TTATTTTGAGTTTTATAGATTGG - Intergenic
924547213 1:245040768-245040790 TGTGTTTGTTTTTTATAGACAGG - Intronic
924862005 1:247935033-247935055 TGGATTTGTCTTTTATACAATGG - Intergenic
1063795746 10:9512358-9512380 TGAGTTTGGGTTTTATGGATGGG + Intergenic
1063876800 10:10487402-10487424 TGATTTTGTCTTGCATGGATTGG + Intergenic
1063923629 10:10956085-10956107 TAAATTCGTCTTATATGGATGGG + Intergenic
1064148865 10:12846769-12846791 TCAATTTTTTTTTTAGAGATGGG + Intergenic
1064330710 10:14391626-14391648 TGAATTTGTGTGTAATAGATTGG + Intronic
1064654291 10:17541578-17541600 TCAATTTTTTTTTTTTAGATAGG + Intergenic
1064722944 10:18248118-18248140 TCAATTTCTCTTTTCTAGTTTGG - Intronic
1065549616 10:26857467-26857489 TGTATTTGTTTTGTAGAGATGGG - Intronic
1066208384 10:33212419-33212441 TGTATTTGTCTTTTTGTGATTGG - Intronic
1066231012 10:33433159-33433181 TTAATTTATTTTTTAGAGATCGG + Intergenic
1067211978 10:44266945-44266967 TAAATTTGTCTGGTAGAGATGGG - Intergenic
1067821089 10:49531407-49531429 TGAATTTGTGTTTTGAAAATTGG - Intronic
1068017458 10:51535174-51535196 ACAATTGGTCTTTTATGGATAGG + Intronic
1068040255 10:51815357-51815379 TGAATTTGTTTGTTACAGAATGG - Intronic
1068202448 10:53799544-53799566 TGAAACTGTCTTTTATAAAGTGG - Intergenic
1068898381 10:62234351-62234373 TGTATTTTTCTTGTAGAGATAGG - Intronic
1069289204 10:66756417-66756439 TGACTTTGTTTTTTAGTGATGGG + Intronic
1069399903 10:68032335-68032357 TGAATTTCTCTGTTATTCATAGG - Intronic
1069540731 10:69292074-69292096 TAATTTTATTTTTTATAGATGGG + Intronic
1069965463 10:72111479-72111501 TGAATTTTTTTTTTTGAGATAGG - Intronic
1070085263 10:73230833-73230855 TGAACTTGTCCTTGAAAGATGGG + Intronic
1070201752 10:74213282-74213304 AAAATTTGTTTTTTAGAGATGGG + Intronic
1070222876 10:74469363-74469385 TTAATTTATTTTTTAGAGATAGG + Intronic
1070445673 10:76498724-76498746 TGAATCTAACTTTTATAGATTGG - Intronic
1071708335 10:88023891-88023913 TAAATTTGTTTTGTAGAGATAGG - Intergenic
1071790159 10:88944986-88945008 TGGATTTGTGGTTTATAGAAGGG + Intronic
1072769133 10:98123013-98123035 TTTATTTGTCTTTGATAGATTGG + Intergenic
1073276306 10:102314631-102314653 TGAATTTTTCTTTTTGAAATGGG + Intronic
1074794717 10:116931053-116931075 TGAATTTTTCTTTTGAAAATGGG - Intronic
1075234702 10:120716429-120716451 TCAATTTGTCTCTCATAGAAGGG - Intergenic
1075297023 10:121286582-121286604 TGAATTTGTCTGTTACTGTTAGG - Intergenic
1076036053 10:127198983-127199005 TGCATTTTTTTTTAATAGATGGG + Intronic
1078211269 11:9271518-9271540 TTAATCTGTCTTCTATAGCTAGG - Intergenic
1078381688 11:10848046-10848068 TCAATTTTTTTTTTAGAGATGGG + Intronic
1078388699 11:10916492-10916514 CTAATTTGTTTTTTAGAGATGGG - Intergenic
1079074620 11:17376455-17376477 GCAATTTGTCTTGTATAAATGGG - Exonic
1079640980 11:22805090-22805112 TCAATTTTTTTTTTTTAGATCGG + Intronic
1079912153 11:26324003-26324025 TGAATGTGGCTTTAACAGATAGG - Intronic
1080198031 11:29634578-29634600 TGCAATTGTCTTTTAAAGCTGGG - Intergenic
1080837792 11:35956313-35956335 TGAATTTTATTTTTAGAGATGGG - Intronic
1081090957 11:38866141-38866163 TTATTTTGTCTTTTATGGATTGG + Intergenic
1083022396 11:59520377-59520399 TGAATTTCTCACTCATAGATGGG + Intergenic
1084152468 11:67296284-67296306 TTAATTTGTCTTCAAAAGATTGG + Intronic
1086341341 11:85852182-85852204 TGAATTTGTTTTTTAAAAAATGG - Intergenic
1086844554 11:91732048-91732070 TTTCTTTGTCTTTTATGGATTGG - Intergenic
1087838840 11:102902227-102902249 TTATTTTGGCTTTAATAGATAGG - Intergenic
1088299701 11:108343773-108343795 TGTGTTTGTTTTTTAGAGATGGG - Intronic
1088519332 11:110678015-110678037 TTACTTTCTGTTTTATAGATAGG - Intronic
1088610701 11:111573446-111573468 CTAATTTGTCTTTTACAGCTTGG + Intergenic
1088668321 11:112117066-112117088 AGTATTTGTCTTTTTTAGACTGG + Intronic
1089842784 11:121432826-121432848 TGATTTTTTCTTTAAGAGATGGG - Intergenic
1090343575 11:126047827-126047849 TGAATTTGTGTTACATAAATGGG - Intronic
1090562839 11:127951213-127951235 TGCATTACTCTTTCATAGATAGG + Intergenic
1092787939 12:12046410-12046432 TAAATTTATCTTTTATAAGTTGG + Intergenic
1092862160 12:12727971-12727993 TTAATTTTTCTTTTAAAGACAGG + Intronic
1093003319 12:14024598-14024620 TGACTTTTTTTTTTATAGAGAGG + Intergenic
1093007620 12:14067669-14067691 TGACTTTGGATTTTATACATTGG - Intergenic
1093046803 12:14455756-14455778 TGTATTTTTTTTTTAGAGATGGG + Intronic
1093496086 12:19759958-19759980 TAAATTTATTTTTTAGAGATGGG + Intergenic
1093516771 12:19996769-19996791 TTAATTTGTCCTTGATATATAGG - Intergenic
1093671828 12:21885526-21885548 GGAACTTGTCTTTCAGAGATAGG - Intronic
1094002429 12:25709263-25709285 TTAATTAGCATTTTATAGATTGG + Intergenic
1094026661 12:25966800-25966822 TAAATTTGTTTTTTATAGATTGG + Intronic
1095182810 12:39165665-39165687 TAAATTTGTTTTTTAGAGATGGG + Intergenic
1095194211 12:39294137-39294159 TGAAAGTGTGTTTTATAGATAGG + Intronic
1095892273 12:47246073-47246095 TGTATTTTTCTTTTTGAGATGGG + Intergenic
1096501770 12:52068525-52068547 TTAATTTTTATTTTAAAGATGGG + Intergenic
1096723125 12:53539257-53539279 TGAATTTGCCTATAATAAATTGG + Intronic
1096729815 12:53600126-53600148 TGGATTCGTCTTTCCTAGATAGG + Intronic
1097287179 12:57887368-57887390 TGGTTTTGTCTTTTAGAGACAGG - Intergenic
1097646029 12:62235757-62235779 TGTTTTTGTTTTTTAGAGATGGG + Intronic
1097846392 12:64370992-64371014 TGTTTTTGTTTTTTAGAGATGGG - Intronic
1098164388 12:67678752-67678774 AGTATCTGTATTTTATAGATGGG + Intergenic
1098215946 12:68219429-68219451 TTATTTTTTCTTTTATATATGGG - Intronic
1098644104 12:72877190-72877212 TGAGTTTGTCTTTGATTCATTGG + Intergenic
1099142756 12:78999631-78999653 TGAATTTGTGTGTTTTAGAGAGG + Intronic
1099203388 12:79701107-79701129 AGAATTTGGCTTTTTTAGATTGG - Intergenic
1099247865 12:80215557-80215579 GGAACTTTTATTTTATAGATTGG + Intronic
1099414348 12:82369117-82369139 TGAATATTTATTATATAGATGGG - Intronic
1099525341 12:83711454-83711476 TGAATTTCTCTTTTGAAAATGGG + Intergenic
1099732159 12:86518975-86518997 TAAATTTGTCTTTTCTAGAATGG - Intronic
1099775051 12:87115641-87115663 TGAATTTATTTTTTGTATATAGG - Intergenic
1099839101 12:87943694-87943716 TGACTCTGTCTTTTATAAACAGG + Intergenic
1100616903 12:96237785-96237807 TGTTTTTGTTTTTTAGAGATGGG - Intronic
1101426009 12:104589225-104589247 TGAATTTTTTTTATAGAGATGGG - Intronic
1101543786 12:105690353-105690375 TGCATTTGTATTGTTTAGATTGG - Intergenic
1102281233 12:111620568-111620590 TAAATTTTTTTTTTAGAGATGGG + Intergenic
1103108220 12:118250130-118250152 TTAATTTTTTTTTTAGAGATGGG + Intronic
1103278900 12:119738053-119738075 TTTATTTCTATTTTATAGATGGG + Intronic
1103845190 12:123897055-123897077 TGAATTTGCCTGTTCTAGAGAGG + Intronic
1104866457 12:131958690-131958712 TGTATTTTTCTTGTAGAGATGGG + Intronic
1104871683 12:132003172-132003194 TTAATATTTCTTTTAGAGATGGG - Intronic
1105400308 13:20086717-20086739 TATATTTGTTTTTTATTGATTGG - Exonic
1105533387 13:21241333-21241355 TGTTTTTTTCTTTTAGAGATGGG + Intergenic
1105985441 13:25561751-25561773 AGAATTTTTGTTTAATAGATAGG - Intronic
1106068320 13:26380487-26380509 TGTATTTGTTTTTTTGAGATAGG + Intronic
1106799212 13:33239124-33239146 CGAATTTGTCTTTTTGTGATTGG + Intronic
1107244522 13:38277503-38277525 TGAATTTTTGCTTTATACATTGG - Intergenic
1107558949 13:41543609-41543631 TGATTTTGTTATTTAGAGATGGG + Intergenic
1107577112 13:41737460-41737482 TGAATTTGTCTTTTATAGATAGG - Intronic
1108180897 13:47838845-47838867 TGTAGTTGTCTTTTGTAGTTAGG + Intergenic
1108300380 13:49068355-49068377 TTAATTTATTTTTTATAGACGGG - Intronic
1108306370 13:49139051-49139073 TGCATTTGTTTTTTATTTATTGG - Intronic
1108381169 13:49855839-49855861 TTATTCTGTCTTTTATAGTTAGG - Intergenic
1108494605 13:51012035-51012057 TGATTTTTTTTTTTTTAGATAGG - Intergenic
1108579206 13:51814460-51814482 TAATTTTGTTTTTTAGAGATGGG + Intergenic
1108911637 13:55560218-55560240 TAAATTTGTCTTTCCTAGTTAGG - Intergenic
1108941886 13:55965115-55965137 TTAATGTGTATTTTATTGATTGG - Intergenic
1109559396 13:64026887-64026909 TGGGTTTTTATTTTATAGATGGG + Intergenic
1109951860 13:69510603-69510625 TGAATTTCTCTTTAAGAAATGGG - Intergenic
1110037089 13:70701340-70701362 TTAACTTCTCTGTTATAGATTGG - Intergenic
1111007978 13:82275033-82275055 TGAATTGGTCAATTATAGATTGG + Intergenic
1111216507 13:85149704-85149726 TTAGTTTGTGTTTTAGAGATGGG + Intergenic
1111341598 13:86893349-86893371 TGAGGATGTCTTTTGTAGATGGG + Intergenic
1111802786 13:92999952-92999974 AAAATTTGTTTTTTAGAGATGGG - Intergenic
1111998723 13:95190784-95190806 TGAATTTCTCGTGGATAGATTGG + Intronic
1112706521 13:102075653-102075675 TTAACTTGTCTATTATAGTTAGG - Intronic
1113033552 13:106022399-106022421 TAAATTTGTCTTTGATATAATGG - Intergenic
1114136648 14:19859566-19859588 TTAATTTGTATCTTATTGATAGG - Intergenic
1114498804 14:23153115-23153137 TTTATTTTTCTTTTACAGATGGG + Intronic
1114682633 14:24499190-24499212 TGATATTGTCTTTTATGGATGGG + Intergenic
1116266453 14:42697670-42697692 ATAATTTGTCTTTTAGAAATAGG + Intergenic
1116505537 14:45674529-45674551 TGAGTTAGTCTTGTATACATAGG + Intergenic
1116648529 14:47560854-47560876 TGAATTGATTTTTTATATATGGG + Intronic
1116695480 14:48170241-48170263 TGAATTTTTCTTGTTAAGATGGG + Intergenic
1117046827 14:51821106-51821128 TTAAATTGTCATTTATAAATTGG + Intergenic
1117197799 14:53358573-53358595 TGAATTTTTCTTTTGTAAAAAGG + Intergenic
1117377880 14:55131877-55131899 TGAATTTGTCTTTGGCAAATGGG + Intronic
1117379273 14:55144315-55144337 TGTATTTTTCTTGTAGAGATGGG + Intronic
1117631465 14:57697207-57697229 TGACTTTCTCTTTGATACATTGG + Intronic
1118460022 14:65979255-65979277 TGAATTTGTCTTTAGAAAATGGG - Intronic
1118728136 14:68645245-68645267 AGCATTTGTCTTTTAGTGATTGG + Intronic
1119347989 14:73942162-73942184 TGTATTTTTCTTTTAGAGATGGG + Intronic
1120228769 14:81820276-81820298 AGGATTTTTCTTTTATAGAGAGG - Intergenic
1120885509 14:89448765-89448787 TGTATTTTTTTTTTAGAGATGGG - Intronic
1120916823 14:89717848-89717870 TGAATTTTTTTTGTAGAGATGGG + Intergenic
1120985930 14:90334678-90334700 TCAATTTGTTTTTAATACATTGG + Intergenic
1121199432 14:92105408-92105430 TTAATTTTTATTTTAAAGATGGG - Intronic
1121848315 14:97195436-97195458 TTTCTTTGTCTTTGATAGATTGG + Intergenic
1123001208 14:105295432-105295454 TGTATTTTTCTTGTAGAGATGGG - Intronic
1123387311 15:19826574-19826596 TGAAATTTTCTTTGATAGAGTGG - Intergenic
1124185487 15:27524150-27524172 TCAATTTGTTTTTTCTATATAGG - Intronic
1125301249 15:38254947-38254969 TTAAGTTTTCTTTTAGAGATGGG + Intronic
1125457603 15:39876673-39876695 TGTATTTTTTTTTTATAGAGAGG - Intronic
1125601956 15:40920253-40920275 TGAATTTGGATTTGATTGATAGG - Intergenic
1126241468 15:46449618-46449640 TGCATTTGTCATTTATTCATAGG + Intergenic
1126292062 15:47092284-47092306 TGATTTTGTCTTTGATTCATTGG - Intergenic
1127266544 15:57366913-57366935 TGTTTTTGTTTTTTAGAGATGGG + Intergenic
1127576325 15:60295611-60295633 TGAATTTCTCCTTTAAAAATGGG + Intergenic
1127792514 15:62410918-62410940 TAAATTCGTGTTTTATAGTTTGG + Intronic
1128370678 15:67036883-67036905 TTTATTTTTCTTTTAGAGATGGG - Intergenic
1130438020 15:83921855-83921877 TGTATTTTTTTTTTAGAGATGGG + Intronic
1130446423 15:84006218-84006240 TTGATTTGCCTTTTATAAATTGG + Intronic
1130524305 15:84690609-84690631 TGAATATTTTTTTTAAAGATGGG - Intronic
1132173364 15:99686929-99686951 TTAATTTGTCTTTGTTCGATTGG + Intronic
1132919547 16:2378772-2378794 TGAAGTTATCTTTTAATGATAGG + Intergenic
1133839592 16:9395405-9395427 TTGATTTATCTTTTAGAGATAGG + Intergenic
1133979596 16:10623245-10623267 TGAATTTTTTTTGTAGAGATGGG + Intergenic
1135015208 16:18919319-18919341 TAAATTTTTTTTTTAGAGATGGG - Intronic
1135145354 16:19957240-19957262 TCCATTAGTCTTTTATAGAGAGG - Intergenic
1135236583 16:20762013-20762035 TGACTTTGCGTTTTATACATTGG - Intronic
1135880799 16:26254061-26254083 TGCATTTTTCTTTTAGAGATGGG - Intergenic
1136012285 16:27371714-27371736 TGAAGTTGTGTTTTATAGGGAGG + Intergenic
1136967476 16:34931763-34931785 TGTATTTGTCTTTTCTCTATAGG + Intergenic
1137668255 16:50264224-50264246 TGAATGTGTCTTTTGTGGGTGGG + Intronic
1138070194 16:53985152-53985174 TTCATTTGTATTTTATAAATGGG - Intronic
1138753365 16:59451398-59451420 TGAATTCTTCTTTGACAGATTGG + Intergenic
1138866411 16:60826161-60826183 TCAAATTGTCTTGTATAAATAGG - Intergenic
1139352989 16:66349162-66349184 GGAATTTGTCTTTCAGAGCTTGG - Intergenic
1139918439 16:70442695-70442717 TAAATTTATTTTTTAGAGATGGG - Intergenic
1140334180 16:74088523-74088545 TTATTTTGTCTTTTTTAAATAGG + Intergenic
1140422152 16:74828780-74828802 TGTATTTTTTTTTTAGAGATGGG - Intergenic
1140571534 16:76112101-76112123 TGTATTTCTCTTTTGTAGAGAGG - Intergenic
1140668585 16:77251197-77251219 TAAATTTCTCTTGTAGAGATGGG + Intronic
1140675361 16:77323327-77323349 TTAGTTTGTCTTTTATTGAGAGG - Intronic
1140794860 16:78427770-78427792 TTAATTTTTATTTTAGAGATGGG - Intronic
1140940421 16:79716836-79716858 TGAAATGGTTATTTATAGATTGG - Intergenic
1141022031 16:80506399-80506421 TGTATTTGTTTTTTAGAGACAGG + Intergenic
1141251518 16:82363330-82363352 TGACTTTGGGTTTTATACATTGG + Intergenic
1141309169 16:82896465-82896487 TGTATTTTTTTTTTAGAGATTGG + Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144465868 17:15496794-15496816 TGGATTTTTATTCTATAGATGGG + Intronic
1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG + Intronic
1146719624 17:35114684-35114706 TTAATTTGTTTTTTAGAGACAGG - Intronic
1147370870 17:39992047-39992069 TGAACTGGTCTTTGAAAGATGGG + Intronic
1148078184 17:44951704-44951726 TTAATTTCTTTTTTAGAGATAGG - Intergenic
1149653397 17:58293826-58293848 TGATTTTTTTTTTTTTAGATAGG + Intergenic
1151752454 17:76047610-76047632 TGTATTTGTTTTGTAGAGATGGG - Intronic
1151808770 17:76423372-76423394 TGTATTTATTTTTTAGAGATAGG - Intronic
1152775429 17:82198597-82198619 TAATTTCCTCTTTTATAGATGGG - Intronic
1153016924 18:591249-591271 TAAATTTTTCTTTTGTAGAGAGG + Intergenic
1153152273 18:2108951-2108973 TGAATTTATTTTTTAATGATAGG - Intergenic
1153708895 18:7777192-7777214 TGTATTTGTCTTATGTATATAGG + Intronic
1154463919 18:14623951-14623973 TGAATTTGTATTGTTTGGATGGG - Intergenic
1155095003 18:22547135-22547157 TCAGTTTGTCCTTCATAGATAGG + Intergenic
1155322827 18:24635316-24635338 TTAATTTGTATTTTATAAAGGGG - Intergenic
1155388003 18:25302040-25302062 TCAATTTCCCTTTTATAGAAAGG + Intronic
1155603046 18:27571327-27571349 TGGATTTTTATTTTAGAGATAGG - Intergenic
1156348324 18:36279611-36279633 TGATTTTGTTTTTTATACACAGG + Intergenic
1156418575 18:36925708-36925730 TTAATTTTTTTTTTAGAGATGGG + Intronic
1156562662 18:38146070-38146092 TCAATTTATATTTTATATATAGG + Intergenic
1156611172 18:38726436-38726458 TGAAGTAGTTTTCTATAGATGGG + Intergenic
1156692092 18:39720425-39720447 TGAGTATGTATTTAATAGATTGG - Intergenic
1156706609 18:39889839-39889861 TGTTTTTGTATTTTAGAGATGGG - Intergenic
1157080248 18:44517058-44517080 TGATTTTGTCTTTTATGCAAAGG + Intergenic
1157261113 18:46176010-46176032 TGAATTTATCTTTACTATATGGG - Intronic
1157586073 18:48802122-48802144 TGACTTTCCATTTTATAGATGGG + Intronic
1157974028 18:52305760-52305782 TTAATTTCTCTTTTAGATATTGG - Intergenic
1158756632 18:60332855-60332877 TTAATTTGTCTTTGTTGGATTGG - Intergenic
1158985176 18:62808070-62808092 TGACTGTGTTTTTTAAAGATAGG + Intronic
1159072997 18:63646847-63646869 TGAAATTCTCTTCCATAGATTGG - Intronic
1161334364 19:3704514-3704536 TTAATTTGTTTTGTAGAGATGGG - Intergenic
1161948119 19:7451584-7451606 TTAATTTTTTTTTTAGAGATGGG + Intronic
1162075532 19:8184442-8184464 TAATTTTTTTTTTTATAGATAGG + Intronic
1162137173 19:8562703-8562725 TAAATTTTTTTTTTACAGATGGG + Intronic
1162596433 19:11633265-11633287 TGAATTTCTCCTTTAAAAATGGG - Intergenic
1162719456 19:12653617-12653639 TAAATTTGTTTTCTAGAGATGGG + Intronic
1164892035 19:31832257-31832279 GGCATTTTTCTTTCATAGATTGG + Intergenic
1165206194 19:34188866-34188888 ATAATTTGTCTTTTGTTGATGGG + Intronic
1165424305 19:35737508-35737530 TAAATTTTTATTTTAGAGATGGG - Intronic
1165770685 19:38378332-38378354 TGTATTTTTCTTTTAGAGACAGG - Intronic
1168607554 19:57771799-57771821 TGGATTTGTGTTTTTTAGAGGGG + Intronic
925239623 2:2312437-2312459 TGAATTTTTTTTATAGAGATGGG - Intronic
926232037 2:11011642-11011664 TGGATTTATTTCTTATAGATAGG - Intergenic
926359638 2:12074250-12074272 TGAATCTGTCCTTTCTAAATAGG + Intergenic
926458828 2:13102288-13102310 TGTATTTATTTTTTACAGATAGG + Intergenic
926896745 2:17699203-17699225 TGAATTTTTCCTTTATTGCTTGG + Intronic
927218861 2:20688152-20688174 TCAAATTGTCTTGTATACATGGG - Intronic
927411873 2:22835304-22835326 TGGATTTGTATTTTCTAAATAGG + Intergenic
927587838 2:24324676-24324698 AGAATTTTTTTTTTAGAGATAGG - Intronic
927903737 2:26842488-26842510 TGTTTTTGTTTTTTAGAGATGGG - Intergenic
928185607 2:29107679-29107701 TGAAATTGTTTTTTAGAGATGGG + Intronic
928218421 2:29381882-29381904 TGAATTTGTCTTCTATGGGAAGG + Intronic
928357048 2:30626856-30626878 TGATTTTATCTTTTATCCATGGG + Intronic
929202097 2:39246228-39246250 TGATTTTGTTTGTTAAAGATGGG - Intergenic
929536201 2:42785855-42785877 TGTTTTTGTTTTTTAGAGATGGG - Intronic
929969805 2:46564304-46564326 TTAATTTTTCTTTTAGAGACAGG - Intronic
930471650 2:51823376-51823398 TGCATTTGTATTTCCTAGATAGG - Intergenic
930555534 2:52890918-52890940 TGACTTTTTCTTTTCTAGCTTGG + Intergenic
930591036 2:53326596-53326618 TGACTTGGGGTTTTATAGATTGG - Intergenic
930946958 2:57085931-57085953 TGAATTGGGGTTTTATACATTGG + Intergenic
931363842 2:61601729-61601751 TCAATTTGTGTTGAATAGATAGG + Intergenic
931536732 2:63286011-63286033 TCATTTTGTTTTTTTTAGATAGG + Intronic
932166136 2:69509007-69509029 TGAATTTGTCTTTAGTGCATGGG - Intronic
932438762 2:71718610-71718632 TGAAATTGACTTTTATATCTTGG + Intergenic
932940610 2:76160444-76160466 TGAAATTTTTTTTTAGAGATGGG - Intergenic
933132644 2:78691531-78691553 TGAATTTGAATTTTAAAGAGGGG + Intergenic
933512395 2:83257615-83257637 TGAATTTCTTTTTTGTAGAATGG + Intergenic
933916730 2:87002148-87002170 TTAATTTTTTTTTTAAAGATGGG - Intronic
934006264 2:87767766-87767788 TTAATTTTTTTTTTAAAGATGGG + Intronic
935756239 2:106278090-106278112 TGTATTTGTATTTGCTAGATGGG - Intergenic
935841171 2:107112372-107112394 TGAATATTTATTTTATACATTGG - Intergenic
936445848 2:112594564-112594586 TTAATTTTTGTTTTATAGTTTGG + Intergenic
937636459 2:124161192-124161214 TTCATTTATATTTTATAGATAGG + Intronic
937811180 2:126201084-126201106 TGAATTTGTCTCTGATATAATGG - Intergenic
938835004 2:135093088-135093110 TGAATTTGTCATGTATTTATGGG + Intronic
939098398 2:137863986-137864008 TTAATTTGTCTTTCAAAGTTGGG + Intergenic
939681538 2:145140941-145140963 TCAACTTGTCTTTTAAAAATTGG - Intergenic
939946455 2:148417126-148417148 TGAATTTTTGTTTTTTAGACAGG + Intronic
940087207 2:149873630-149873652 TTAATTTTTCTGTTATAGACAGG + Intergenic
940384992 2:153060025-153060047 TAAATTTATCTTTTTTAGTTTGG + Intergenic
940774734 2:157874871-157874893 TGAATTTGGCTTTTGGAGAGAGG - Exonic
940915981 2:159256467-159256489 TAAATCTGTGTTTTATAGCTAGG + Intronic
941318249 2:164021936-164021958 TGAATTTTTCTTATGTAGAATGG + Intergenic
941319138 2:164032900-164032922 TGAGTTTGTGTTTTGTGGATGGG - Intergenic
941510628 2:166404297-166404319 TGAAATTGTTTTTTAAAGATAGG - Exonic
941682821 2:168416890-168416912 TGTTTTTGTTTTTTAGAGATGGG - Intergenic
941693133 2:168522536-168522558 TGAATTTTTTTTTTTTAGACAGG + Intronic
941882981 2:170500467-170500489 GGAGTTTGCCTTTAATAGATAGG + Intronic
942018764 2:171844970-171844992 TGAATATGTCTATTGAAGATAGG + Intronic
942124485 2:172809701-172809723 TTAATTTATTTTTTAGAGATGGG + Intronic
942236012 2:173905825-173905847 TTAATTTGTTTTGTAGAGATGGG - Intergenic
942779135 2:179620283-179620305 TGCATTAGACTTTTATAGATAGG - Intronic
942925381 2:181425918-181425940 TGACTTGGGGTTTTATAGATTGG - Intergenic
943056516 2:182988427-182988449 TCAATTTGGCTTTTATATATTGG + Intronic
943554460 2:189385366-189385388 TGTACGTGTCTTTTATAAATAGG - Intergenic
943805163 2:192115278-192115300 TTAGTTTGTCTTATATACATAGG - Intronic
944346990 2:198680271-198680293 TGATTTTTTCTTTTATACATTGG - Intergenic
944522230 2:200584016-200584038 TGAATTTGGTTTTTATAATTTGG + Intergenic
944739610 2:202598975-202598997 TGTATTTGTTTGTTAGAGATGGG - Intergenic
944746228 2:202659481-202659503 TGTATTTGTTTTGTAGAGATGGG + Intronic
944806512 2:203287042-203287064 TGTATTTTTTTTTTAGAGATAGG - Intronic
944980567 2:205114915-205114937 TGAGGTTGTTTTTGATAGATAGG + Intronic
945329393 2:208522004-208522026 TGAAATTGTCTTTTTTTGTTGGG + Intronic
946469538 2:219945717-219945739 ATTCTTTGTCTTTTATAGATGGG + Intergenic
946701761 2:222422091-222422113 TGTATTTCTCTTTCATAGAATGG - Intergenic
946815474 2:223573469-223573491 TGTATTTGTCTTTTTCATATTGG - Intergenic
946848845 2:223885548-223885570 TCAATTTGTAATCTATAGATAGG + Intronic
947824446 2:233095273-233095295 AGAACTTGTATTTTAGAGATAGG + Intronic
948358688 2:237402113-237402135 TGCATTTGTCTTTTAGTGACTGG - Intronic
948975397 2:241460606-241460628 TGAATTTGGATTTGAAAGATGGG + Intronic
1169419522 20:5448796-5448818 TAAATGTGTCTTGTATAGAGTGG - Intergenic
1169478964 20:5960284-5960306 TAATTTTGTTTTTTAGAGATGGG + Intronic
1169520756 20:6370497-6370519 CCAAATTGTGTTTTATAGATGGG - Intergenic
1170340598 20:15322711-15322733 TGAATTTGTCTTCTATTTAGTGG + Intronic
1170452248 20:16495693-16495715 TGGTTTTGTTTTTTAGAGATGGG + Intronic
1170576591 20:17667357-17667379 TGAATATTAATTTTATAGATTGG - Intronic
1170659960 20:18328406-18328428 TGATTTTGTCTTTAATAAAATGG + Intergenic
1171316028 20:24195498-24195520 TGAAATCGTCTTTTGAAGATTGG + Intergenic
1171985682 20:31659426-31659448 TTAATTTGTCAGTTATAGAAAGG + Intergenic
1172692572 20:36800312-36800334 GGAATTATTCTTTTATAGACAGG + Intronic
1172725069 20:37033483-37033505 TGTATTTTTTTTTTAGAGATGGG + Intronic
1172920192 20:38474448-38474470 TGAATTTTTTTTGTAGAGATGGG + Intronic
1173061993 20:39671398-39671420 TGAGTTTGTCTTTAAAAGTTAGG - Intergenic
1173092593 20:39987743-39987765 TTCATTTGTGTTTTATATATTGG - Intergenic
1173764180 20:45591440-45591462 GGATATTGTCTTTTATAAATTGG + Intergenic
1174357288 20:50006972-50006994 TAAAATTGTATTTTAGAGATGGG + Intergenic
1174428705 20:50451852-50451874 TGTATTTGTTTTGTAGAGATGGG - Intergenic
1174430069 20:50461069-50461091 TCAATTTGTCTTTGAAACATTGG - Intergenic
1176810612 21:13534421-13534443 TGAATTTGTATTGTTTGGATGGG + Intergenic
1176892474 21:14334624-14334646 AGAATATGTTTTTTATAAATTGG + Intergenic
1177356808 21:20019022-20019044 TGAACTTCTGTTTAATAGATAGG - Intergenic
1178253184 21:31024220-31024242 ACAATCTGCCTTTTATAGATTGG + Intergenic
1179134328 21:38666648-38666670 TGAAATTTTTTTGTATAGATGGG - Intergenic
1179300403 21:40103540-40103562 TGACATCTTCTTTTATAGATGGG - Intronic
1179672916 21:42962386-42962408 TTAATTTGTCTTTTGTAGCAGGG + Intergenic
1180755479 22:18157984-18158006 TGTTTTTGTTTTTTACAGATAGG - Intronic
1181038476 22:20181093-20181115 TGAATTTTTTTTTTGTAGAGAGG + Intergenic
1181679642 22:24484815-24484837 TGATTTTTTTTTTTAAAGATGGG + Intergenic
1181866496 22:25861053-25861075 TGATTTTGTTTTTTAGAGATAGG + Intronic
1182193475 22:28489276-28489298 TTAATTTGTTTTTTAGAGATAGG - Intronic
1182225079 22:28791465-28791487 TGTATTTATTTTTTAGAGATGGG + Intergenic
1183069082 22:35383784-35383806 TGAAATACTCTTTTACAGATGGG - Intronic
1183070887 22:35395421-35395443 TGTATTTTTTTTTTAGAGATGGG + Intergenic
1183172321 22:36197463-36197485 TAAATTTGTGTTTTATTGATGGG + Intronic
1183233341 22:36596921-36596943 TGAATTTTTTTTGTAGAGATGGG + Intronic
1183239431 22:36645869-36645891 TGCATTTGACTTTTAAAGTTTGG - Intronic
1184704249 22:46199459-46199481 TAAATTTTTTTTGTATAGATGGG - Intronic
1185298528 22:50066792-50066814 TGAGCTCGTCTTTTATAGTTTGG + Intronic
949157318 3:844947-844969 TGAATGAGTCTTTTCAAGATGGG - Intergenic
949440860 3:4078734-4078756 TGATTTTTTTTTTTAGAGATGGG - Intronic
950085737 3:10256345-10256367 TGTATTTTTCTTGTACAGATGGG + Intronic
951365194 3:21772945-21772967 AGTATTTGTCTTTTAGTGATTGG - Intronic
952042683 3:29279579-29279601 AGTATTTCTATTTTATAGATGGG + Intergenic
952621956 3:35355505-35355527 TGATTTTGTATTTTATATTTAGG - Intergenic
952779062 3:37076351-37076373 TGAATTTTTTTTATAGAGATGGG - Intronic
953479582 3:43239093-43239115 TCAATTATTCTTTAATAGATTGG + Intergenic
953911401 3:46894888-46894910 TAAATTTTTTTTTTAGAGATGGG - Intronic
954474327 3:50729690-50729712 TTAATTTTTTTTTAATAGATGGG + Intronic
954550817 3:51480152-51480174 TGACTTTGACTTTCATAGGTAGG - Intronic
955006062 3:54969959-54969981 TGATTTTTTTTTTTTTAGATTGG - Intronic
955151681 3:56373894-56373916 TGAATTTGACTTTTTTAAATGGG - Intronic
955181232 3:56672217-56672239 TGCATATCTATTTTATAGATAGG - Intronic
955415866 3:58690294-58690316 TAAAGTTTTCTTTTAGAGATTGG + Intergenic
956488837 3:69750188-69750210 TGAAATTGACTTTTTTAGAAAGG - Intronic
956679353 3:71763893-71763915 TAAATTTGTCATTTAAAGTTTGG + Intergenic
956774692 3:72555295-72555317 TAAATTTGTTTTGTAGAGATAGG - Intergenic
956925518 3:73983276-73983298 TGAATTTGATTTTTACACATGGG - Intergenic
958544963 3:95534699-95534721 GGTATTTGTCTTTTAAAAATAGG - Intergenic
958761467 3:98313968-98313990 TAAATTTTTGTTTTAGAGATGGG - Intergenic
958991459 3:100850777-100850799 TGAATTTGTATTTTATTCCTGGG - Intronic
959033598 3:101333516-101333538 TTAATTTATTTTTTAGAGATAGG - Intronic
959441680 3:106383919-106383941 CTAATTTGTTTTTTACAGATAGG - Intergenic
960275331 3:115722357-115722379 TGAATTTATTTTTTATAGACAGG - Intergenic
960359586 3:116695506-116695528 TGAATTTGATTTTTATAGAATGG - Intronic
960481959 3:118202601-118202623 TTAATTTTTCTTTTTTAGTTTGG - Intergenic
961025799 3:123556132-123556154 TCAATTTATTTTTTAGAGATGGG - Intronic
961798916 3:129429643-129429665 TTAACTTGTCTTTTAAAAATGGG - Intergenic
961982111 3:131090933-131090955 TAAAATTGTTTTTTAGAGATGGG + Intronic
962137480 3:132751495-132751517 TGTATCTGTATTTTATACATGGG - Intergenic
963610583 3:147462758-147462780 AGAATTTCTCTTTTATAAAAAGG + Intronic
963752062 3:149190925-149190947 TGAATTTTTCTTTAATATATTGG - Intronic
963947096 3:151158201-151158223 TAAGGTTGTATTTTATAGATAGG + Intronic
964234357 3:154507456-154507478 TGTTTTTGTTTTTTAGAGATGGG + Intergenic
964401050 3:156299037-156299059 TTACTTTGTTTTATATAGATTGG + Intronic
964509011 3:157429399-157429421 CTAAATTGTCTTTTATATATAGG - Intronic
964915641 3:161838290-161838312 TGACTTGGGCTTTTATACATTGG + Intergenic
965241980 3:166213244-166213266 TCATTTTGTATTTTATAAATTGG + Intergenic
965274668 3:166666073-166666095 TGATTTAGTATTTTTTAGATGGG + Intergenic
965296527 3:166954648-166954670 TTTCTTTGTCTTTTATGGATTGG + Intergenic
965818048 3:172657035-172657057 TCTTTTTGTCTTTTATTGATTGG + Intronic
966229802 3:177639774-177639796 TTAATTTGTCTTTGACAGACTGG + Intergenic
966590051 3:181672907-181672929 TGAATTTTTTTTGTAGAGATAGG + Intergenic
966995624 3:185277355-185277377 TAAATTTATCTTTAATAGAATGG + Intronic
967016720 3:185488901-185488923 TGAATTTCTCTTTTGTGGTTAGG + Exonic
967752220 3:193127851-193127873 TGATTTTGTTTTTGAGAGATAGG + Intergenic
967925824 3:194646458-194646480 CGAATTTGTCTTTCATAGCGTGG - Intronic
970437118 4:16046413-16046435 AAAATTTGTCTTCTTTAGATAGG + Intronic
970493554 4:16602012-16602034 TTAATTTTACTTTTATAAATTGG + Intronic
970888835 4:21018848-21018870 TGAATTTGTCTATGAGAGTTTGG + Intronic
971050288 4:22854511-22854533 TTTCTTTGTCTTTGATAGATTGG + Intergenic
971116319 4:23649949-23649971 TAAAGTAGTCTTTTATAGACTGG + Intergenic
971179359 4:24314359-24314381 TGAATTAGTGTTTTATAAAAGGG + Intergenic
971464080 4:26936038-26936060 TGTATTTGTCTTTTTTATGTGGG + Intronic
971664867 4:29470121-29470143 TGAATGTGTGCTTTAAAGATTGG - Intergenic
971703408 4:30008839-30008861 TGACTTTGTCTTTTCTAATTTGG + Intergenic
971874825 4:32294284-32294306 TGTATTTGTCTTTTTTATCTCGG - Intergenic
971986181 4:33828160-33828182 TTAATTTATCTTTTATAAGTTGG + Intergenic
972110455 4:35552032-35552054 TGAATTTTTCTTTTAAATACAGG + Intergenic
972307927 4:37850162-37850184 TGAATTTGTATTTGTTTGATAGG + Exonic
972435982 4:39035932-39035954 TGTATTTGTATTTTAGAGAAGGG + Intergenic
972657445 4:41078430-41078452 TCAATTTGTCTTATACAGTTGGG - Intronic
973099313 4:46243460-46243482 TGTATGTGGCTTTTATATATTGG - Intergenic
973234406 4:47883696-47883718 TGTATTGGTCTTTTAAAGAGAGG - Intronic
974225707 4:59040163-59040185 TGTATCTGTATTTTGTAGATGGG + Intergenic
974518883 4:62955172-62955194 TAAATTTTTTTTTTAGAGATGGG + Intergenic
975787239 4:77904860-77904882 TGACTTTATCTTTTATATTTAGG - Intronic
975879004 4:78879858-78879880 TAAATTTGTATTTTATATATTGG + Intronic
975962777 4:79933352-79933374 GCAATTTGTCTTTAATATATAGG + Intronic
976162950 4:82222332-82222354 TGAAGATGTCTTTTAAAGTTGGG + Intergenic
976494666 4:85713298-85713320 TGAACTTATCTTTTTGAGATAGG - Intronic
976587376 4:86813863-86813885 TGAAGTTGTCTTTGATTGGTGGG - Intronic
976626983 4:87195984-87196006 TTAATTTTTATTTTAGAGATGGG + Intronic
976937476 4:90654850-90654872 TAAATTTTTATTTTATAGGTGGG + Intronic
976977567 4:91183372-91183394 TGAAAATGTTTTTTACAGATAGG - Intronic
977058344 4:92222249-92222271 TGAATTAGTATTTGATAAATAGG - Intergenic
977069944 4:92372780-92372802 TGAATTTCTCTTGTACAAATGGG - Intronic
977171820 4:93771767-93771789 TGGGTCTGTCTTTTATAGAATGG + Intronic
978323267 4:107521866-107521888 TGAAGTTGTCTTTTAAAAATGGG - Intergenic
978376574 4:108080790-108080812 TGAATATGTCTTTTTTATATGGG - Intronic
978616405 4:110600934-110600956 TGATTTTGGCTTTGAAAGATGGG - Intergenic
978653202 4:111033156-111033178 AGAATTTATCTCTTATAAATAGG + Intergenic
979053479 4:115967192-115967214 TGAATATGTATTTTATACTTTGG + Intergenic
979194580 4:117904880-117904902 TAAATTTGACCTTTAAAGATAGG - Intergenic
980185378 4:129454739-129454761 TGAGTTGGTCTTTGATAGGTTGG + Intergenic
981264169 4:142761603-142761625 TGAATTTTTCTATTATAGGTTGG - Intronic
981464285 4:145049753-145049775 TGAATTTCTTTTGTAGAGATGGG + Intronic
981788971 4:148514042-148514064 TGATTTTATCTTTTGAAGATGGG - Intergenic
981862136 4:149369421-149369443 TAAAAATGTCTTTTTTAGATGGG - Intergenic
981912625 4:149999145-149999167 TGAATATGTATTTTAAAAATCGG + Intergenic
982380956 4:154746376-154746398 AGTATTTTGCTTTTATAGATCGG + Intronic
982582044 4:157191394-157191416 AGATTTTGTCTTTCTTAGATCGG + Intergenic
982665382 4:158254586-158254608 TAAATTTCTTTTTTAGAGATGGG - Exonic
982944268 4:161599365-161599387 TGAGTTTATATTTTACAGATTGG - Intronic
982950820 4:161693400-161693422 AGAATTTTTCTTTTAAAGTTTGG + Intronic
983885813 4:172979266-172979288 TGTATTTCTCTTTTAGATATGGG - Intronic
984027177 4:174557230-174557252 TGTATTTTTCTTTTAGAGATGGG + Intergenic
984030961 4:174603597-174603619 TGTATTTGTTTTGTAGAGATGGG + Intergenic
984076752 4:175191377-175191399 TGAGTTTGACTATTTTAGATAGG - Intergenic
984117424 4:175699346-175699368 TGAATTTTGGTTTTATACATAGG + Intronic
984236920 4:177170717-177170739 TGACTTTGTCTTTGATCCATAGG - Intergenic
984701840 4:182823359-182823381 TGAAATTTTCTTGTAAAGATGGG + Intergenic
984797343 4:183674695-183674717 TGTTTTTGTTTTTTACAGATTGG + Exonic
985211390 4:187599306-187599328 TGGATATTTCTTTTATAGTTTGG - Intergenic
987570925 5:19657523-19657545 TCAATTTGTTTTTAATAAATAGG + Intronic
987573522 5:19696787-19696809 TGCATTTATCATTTATAAATGGG + Intronic
987747267 5:21992453-21992475 TGAATATTTCTTTTAAAGTTTGG + Intronic
988261441 5:28891236-28891258 TGAATTTGTTTTTTAAATCTAGG - Intergenic
988277640 5:29102756-29102778 TATATTTGTATTTTATAAATAGG - Intergenic
988682693 5:33499314-33499336 TGTATTACTCTTTTCTAGATTGG + Intergenic
989081010 5:37621474-37621496 AGAATGTGTCTTTTATAAATGGG - Intronic
991007964 5:61849717-61849739 TCAATTTCTTTTCTATAGATAGG - Intergenic
991052044 5:62283426-62283448 TGAAGTTGGCATTTATAGACTGG - Intergenic
991575320 5:68097239-68097261 TGAATTTGGCTTTTAGAAGTAGG - Intergenic
991673613 5:69071773-69071795 TTAATTTTTTTTTTAGAGATGGG - Intergenic
991767442 5:70002242-70002264 TGAATATTTCTTTTAAAGTTTGG + Intergenic
991846677 5:70877318-70877340 TGAATATTTCTTTTAAAGTTTGG + Intergenic
992211720 5:74486576-74486598 TGAACTTGTCTTTTATTCCTGGG - Intergenic
992569636 5:78042245-78042267 TTTATTTTTTTTTTATAGATAGG + Intronic
992804281 5:80322005-80322027 TTAATTTTTTTTTTAGAGATGGG - Intergenic
993109858 5:83643621-83643643 TTATTTTTTCTTTTAGAGATGGG + Intronic
993136518 5:83973238-83973260 TGAATTAGTCTATAATTGATAGG + Intronic
994257962 5:97622793-97622815 TGAATTTGTATGTCAAAGATTGG + Intergenic
994558449 5:101334531-101334553 TGAATTTCTCACTTATAAATGGG + Intergenic
994833249 5:104813017-104813039 TGTATTTTTCTTTTAAATATTGG - Intergenic
995130069 5:108620732-108620754 TGACTTGGGGTTTTATAGATTGG + Intergenic
995851995 5:116555820-116555842 TGTATTTATCTTTTAGAGACTGG - Intronic
996058702 5:119009098-119009120 AGAGTTTTTCTTTTATAGAGAGG + Intergenic
996728926 5:126698491-126698513 TTAAATTGACATTTATAGATGGG + Intergenic
997515485 5:134485807-134485829 TAATTTTGTCTTTTATATTTAGG - Intergenic
999165290 5:149544489-149544511 TAAATTTTTTTTATATAGATGGG - Intronic
999462441 5:151769486-151769508 TGAATTTGTTTTGTAGAGACGGG + Intronic
1000190384 5:158904628-158904650 TGAATTTGACTTTTTTCGAAAGG + Intronic
1000863985 5:166490176-166490198 TTAATTTGGATTTTATAGATGGG - Intergenic
1001529059 5:172449533-172449555 GTTATTTGTCTTTTATTGATTGG - Intronic
1001576108 5:172765049-172765071 TGAATGTGGCTTTTAAAGCTAGG - Intergenic
1001640620 5:173241840-173241862 AGAATTTGTATTTTAAATATGGG + Intergenic
1002813223 6:654628-654650 TTAATTTTTCTTTTGTAGAGAGG - Intronic
1003235345 6:4290544-4290566 TGATTTTTTCTTTTTTAGACAGG + Intergenic
1003388875 6:5695002-5695024 TGTTTTTTTCTTTTAGAGATGGG - Intronic
1003549571 6:7091012-7091034 TGTATTTTTTTTTAATAGATAGG - Intergenic
1004786312 6:18971779-18971801 TGAATTTCACAATTATAGATGGG - Intergenic
1006224454 6:32525039-32525061 TGAAAGTTTCTTTTATACATTGG + Intronic
1006566936 6:34967688-34967710 TGTTTTTGTTTTTTAGAGATAGG - Intronic
1007333653 6:41135446-41135468 TCAATTTGCAGTTTATAGATGGG + Intergenic
1007557602 6:42780072-42780094 TTAATTTTTTTTTTAGAGATGGG + Intronic
1008399209 6:51045077-51045099 TTAATTTCTCTTTTTTAAATGGG - Intergenic
1008681837 6:53880396-53880418 TGACTTTATCTTATAGAGATGGG - Intronic
1009400374 6:63247545-63247567 TTAATTTCTCTTTTATAAATAGG - Intergenic
1010639845 6:78311165-78311187 AGAATTTCTCTTTTATACTTGGG + Intergenic
1011178350 6:84589200-84589222 ATAATTTCTATTTTATAGATTGG + Intergenic
1011324532 6:86135175-86135197 TGTGTGTGTATTTTATAGATGGG - Intergenic
1011641645 6:89421239-89421261 TAAATTTGTTTTTTAGAGACAGG - Intergenic
1011782417 6:90804762-90804784 TGAATTTATCTTCCAGAGATGGG + Intergenic
1011837003 6:91443803-91443825 TGAAATTGGGTTTTGTAGATAGG + Intergenic
1011911606 6:92447782-92447804 TGAATATGTCTCTGAGAGATGGG + Intergenic
1012163522 6:95919251-95919273 TTAATCTGTCTTCTATAGATGGG - Intergenic
1013148574 6:107420812-107420834 TTTTTTTTTCTTTTATAGATTGG - Intronic
1014506476 6:122265781-122265803 TGATTTTCTCTTTTAAAGAGGGG - Intergenic
1014923096 6:127236104-127236126 TAAATTTGTCTTATATGCATGGG + Intergenic
1015180673 6:130358907-130358929 TTAAGTAGTCTTTTATTGATGGG + Intronic
1015469873 6:133592204-133592226 TGAAGTTGTATTTTATAACTTGG - Intergenic
1016310073 6:142724782-142724804 TGTATTTTTTTTTTAGAGATGGG + Intergenic
1016337410 6:143022181-143022203 TGAATATTTGTTTTATACATTGG + Intergenic
1016521108 6:144947926-144947948 TAAATTTTTCTTTTAAAAATGGG + Intergenic
1016615507 6:146043120-146043142 TTAATTTTTTTTTTAGAGATGGG - Intronic
1016851045 6:148619419-148619441 TGCATTAGTCTTTCTTAGATAGG + Intergenic
1016888732 6:148984538-148984560 TTAATTTGTTTTTTAGAGACGGG + Intronic
1017149212 6:151263042-151263064 TTATTTTGTTTTTTATAGATGGG + Intronic
1017668037 6:156740361-156740383 TTAATTTGTTTTTTAGAGAAAGG - Intergenic
1017681004 6:156863628-156863650 TGTATCTCTATTTTATAGATGGG + Intronic
1017892115 6:158647243-158647265 TGATTTTAGCTTTTATACATTGG + Intergenic
1018104738 6:160473669-160473691 TGAATGTGTATTTTGTAGTTTGG + Intergenic
1018157718 6:161003671-161003693 TTATTTTGTCATTTACAGATAGG - Intronic
1018228487 6:161654001-161654023 TGCATTTTTTTTTTAAAGATGGG + Intronic
1018494463 6:164335696-164335718 TTAATTTTTCAGTTATAGATAGG - Intergenic
1018712310 6:166505802-166505824 TGTATGTTTCTTTTCTAGATCGG + Intronic
1019231411 6:170568030-170568052 TGAAATTGTCTTTCAGTGATGGG + Intronic
1019328290 7:450494-450516 TTAAATTTTCTTTTATAGACAGG - Intergenic
1019505939 7:1391050-1391072 TTTATTTTTTTTTTATAGATGGG + Intergenic
1019795746 7:3046939-3046961 TGTTTCTGACTTTTATAGATGGG + Intergenic
1019953819 7:4395800-4395822 TAGATTTGTATTTTATAGTTTGG + Intergenic
1020360501 7:7322297-7322319 TGAATTTGTCTTTTGTAACAGGG + Intergenic
1020463886 7:8454498-8454520 TAAATTTGACTTGTATTGATTGG + Intronic
1021119476 7:16782102-16782124 TGAATTTGTAGTTTGTAGAATGG + Intronic
1021751521 7:23805654-23805676 TGAATTTTTTTTGTAAAGATGGG + Intronic
1022184558 7:27954554-27954576 TGAATTTGACCTTTATATATGGG - Intronic
1023514603 7:40988453-40988475 TGAAGGAATCTTTTATAGATTGG + Intergenic
1023896514 7:44438187-44438209 TGAATTTTTTTTTAAGAGATGGG - Intronic
1025019568 7:55470195-55470217 TTATTTTGTGTTTTAGAGATGGG - Intronic
1025155432 7:56601903-56601925 TGATCTTGGCTTTTATAGCTGGG - Intergenic
1025993714 7:66514732-66514754 TAAATTTGTTTTGTAGAGATGGG - Intergenic
1026009769 7:66628129-66628151 AGACTTTGTCTTTTAAAGAAAGG + Intergenic
1026356263 7:69560241-69560263 TAAATTTTTCTTGTAGAGATGGG - Intergenic
1026460236 7:70608274-70608296 TTAATTTTTTTTGTATAGATGGG + Intronic
1026505623 7:70980237-70980259 TAAATTTTTTTTTTAGAGATGGG + Intergenic
1026680598 7:72463730-72463752 TTAATTTTTTTTGTATAGATGGG + Intergenic
1028053795 7:86218924-86218946 TGAATTTTTCCATTATACATTGG + Intergenic
1029139350 7:98399887-98399909 TGAACTTGGCTTTTATATATGGG - Intronic
1029592476 7:101516441-101516463 TTAATTTTTTTTTTAGAGATGGG + Intronic
1029630298 7:101746074-101746096 TTAAATTGTTTTTTAGAGATGGG + Intergenic
1029668569 7:102012191-102012213 AGAATTTTTCTTTAAGAGATGGG + Intronic
1029799294 7:102929488-102929510 TGAATTTTTTTTGTAGAGATGGG - Intronic
1030724326 7:112907762-112907784 TGAATTTTTCTCCGATAGATTGG - Intronic
1031337846 7:120558707-120558729 TGAATTTGTCCTTTATAGGTGGG + Intronic
1031539879 7:122981628-122981650 TGAGTTTTTGTTTTATAGAAAGG + Intergenic
1031655346 7:124348523-124348545 TGTCTTTGTCTTTGACAGATTGG + Intergenic
1033441850 7:141387332-141387354 TGCATTTTTATTCTATAGATAGG + Intronic
1033763110 7:144458248-144458270 TGAATTTGTTTCTTATAAAATGG + Intronic
1033963188 7:146939661-146939683 TTAATTTGCCTGTAATAGATGGG + Intronic
1035008828 7:155692895-155692917 TGATTTACTCTTTTATACATTGG - Intronic
1035196937 7:157229632-157229654 TAAATTTTTATTTTAGAGATGGG + Intronic
1036146321 8:6258093-6258115 TTTATTTTTTTTTTATAGATGGG + Intergenic
1036926111 8:12907699-12907721 TTAATTCTTCTTTTAGAGATGGG - Intergenic
1037104590 8:15091190-15091212 TTTATTTTTCTTTTACAGATGGG + Intronic
1037435997 8:18863963-18863985 TGAATTGCTCTTTTAAAGAAAGG - Intronic
1037637573 8:20713577-20713599 TCCATTTGTCTTGGATAGATAGG + Intergenic
1037696677 8:21229854-21229876 TGGATATGTCATTTAAAGATAGG - Intergenic
1039414569 8:37382663-37382685 TTAATTTGTTTTTTAGAGACAGG - Intergenic
1039640122 8:39210247-39210269 TGAATTTGTCTTTTTAGGAGAGG - Intronic
1039646970 8:39296857-39296879 TGAATTTTTCTTTAAAAGTTTGG + Intergenic
1040406325 8:47107237-47107259 TAAATTTGTCCTATATAAATAGG + Intergenic
1040429957 8:47329704-47329726 TAATTTTGTCTTTTATAGAAGGG + Intronic
1040659176 8:49549137-49549159 TGTATTAGGCTTTTATAGGTAGG - Intronic
1040731281 8:50450035-50450057 TGAAATTGTCTTTACTTGATGGG - Intronic
1041946652 8:63451305-63451327 TGATTTTTTTTTTCATAGATGGG + Intergenic
1042771149 8:72383826-72383848 GGAATTTGTCTTATATTGAGAGG - Intergenic
1042824454 8:72965991-72966013 TTTATTTCACTTTTATAGATAGG - Intergenic
1042889162 8:73588135-73588157 TGCAATTGTCTTTTTCAGATTGG - Intronic
1042938884 8:74087960-74087982 TGAATTTGTCCTTGAAGGATAGG - Intergenic
1042969777 8:74395478-74395500 TGAAGTTGTCTTTTATACAAAGG - Intronic
1043256561 8:78145703-78145725 TGTGTTTGTCCTTTATAGGTAGG + Intergenic
1043569653 8:81588605-81588627 TGACTTTTTCTTTTATAGTTTGG + Intergenic
1043728746 8:83648156-83648178 TCATTTTTTCTTTTATAGTTAGG + Intergenic
1043954621 8:86345581-86345603 TGTATTTTTTTTTTAGAGATGGG + Intronic
1045188741 8:99863112-99863134 TGAGTTTCTCTTTTGTATATTGG + Intronic
1045288022 8:100808694-100808716 TGAATATATTTTTTAAAGATAGG + Intergenic
1045504814 8:102770924-102770946 CTAATTTTTATTTTATAGATTGG + Intergenic
1045561181 8:103264842-103264864 AAAATTTGTCTTTAAAAGATTGG + Intergenic
1046430521 8:114120572-114120594 TGAATTTCTTTGTTATACATAGG - Intergenic
1047089910 8:121562402-121562424 TGGATTTTTCTTTGATACATTGG - Intergenic
1047586323 8:126277827-126277849 TGATTTTGTCTTTTAATTATTGG - Intergenic
1048703826 8:137126668-137126690 TGGATTTGTCTTTGCTATATGGG + Intergenic
1049125356 8:140782218-140782240 TGAATTTATCTTTTAAAATTTGG + Intronic
1049978587 9:883172-883194 TGAAGTTGGCTTTTAAAGATAGG - Intronic
1051106174 9:13583023-13583045 TGAATTTGTGTTTGATAGGTGGG - Intergenic
1051678931 9:19587218-19587240 TGATTCTGTTTTTTATATATAGG - Intronic
1051915674 9:22204136-22204158 TGAATTTGACTTCTATATTTTGG + Intergenic
1052199481 9:25761047-25761069 TTAATTTTTCTTTGATAGCTTGG - Intergenic
1052847633 9:33351284-33351306 TGAATTTTTTTTTAAGAGATGGG - Intronic
1053079875 9:35166512-35166534 TTAATTTTTTTTTTAAAGATGGG + Intronic
1053096827 9:35335875-35335897 TAAATTTTTCTTGTAGAGATGGG + Intronic
1054838244 9:69703578-69703600 TGATTTTGTCTTTGATCCATTGG + Intergenic
1055007635 9:71526771-71526793 TGATTTTGCCTTTTGTACATGGG + Intergenic
1055187005 9:73469679-73469701 TGTCTTTGTCTTTTTCAGATCGG + Intergenic
1055800979 9:80035480-80035502 TGGATTTGATTTTTATATATTGG - Intergenic
1056604123 9:88071582-88071604 TGAATTTGTTTTTTAGATCTAGG - Intergenic
1058503179 9:105643291-105643313 TTATTTTTTCTTTTATAGACAGG + Intergenic
1059014789 9:110504231-110504253 TGAATTTTTTTATTAGAGATGGG + Intronic
1059124628 9:111672520-111672542 TGAAATTGTCTTTTTTTGTTGGG - Intergenic
1059135861 9:111805517-111805539 TGAATTGGGCTTTGAAAGATGGG - Intergenic
1059188470 9:112300191-112300213 TATATTTGACTTTAATAGATTGG - Intronic
1059555833 9:115279219-115279241 TGAATCTATGTTTTATACATTGG + Intronic
1060020079 9:120122108-120122130 TGACTTTGTTTTTTCAAGATTGG + Intergenic
1060420651 9:123467351-123467373 TGAACTGGTGTTTTATAAATGGG - Intronic
1060572070 9:124651228-124651250 TGTATTTTTTTTTTAGAGATGGG + Intronic
1186115835 X:6304245-6304267 TGATTTTTTTTTTTAGAGATGGG - Intergenic
1186217338 X:7314181-7314203 TAAATCTGTTTTTTAGAGATGGG - Intronic
1186320611 X:8420490-8420512 TCAATTTGTTTTGTACAGATGGG - Intergenic
1186694890 X:12019750-12019772 TGAACTTGGCCTTGATAGATGGG - Intergenic
1187353879 X:18548053-18548075 TGATTTTTTGTTTTTTAGATAGG + Intronic
1187902512 X:24037943-24037965 TGGATTTTTTTTTTAGAGATGGG - Intergenic
1187938545 X:24359941-24359963 TGTATTTTTTTTTTAGAGATGGG - Intergenic
1188060989 X:25601896-25601918 TGAATTTGTCTTTCAGGTATTGG + Intergenic
1188181531 X:27062207-27062229 TGTTTTTGTTTTTTAGAGATGGG + Intergenic
1188891459 X:35615897-35615919 TGAGTTCGTCTTTTATGGGTGGG - Intergenic
1189206410 X:39243091-39243113 TGAATTTGTCTCTTAAAGCCAGG + Intergenic
1189945866 X:46178285-46178307 TTTATTTGTCTTTGATGGATTGG + Intergenic
1190162461 X:48042992-48043014 TAGTTTTGTCTTTTACAGATGGG - Intronic
1190328314 X:49220245-49220267 TTAATTTCTTTTTTAGAGATGGG + Intronic
1191162165 X:57341642-57341664 TGAATTTGTCATTTGTAAATTGG - Intronic
1191911072 X:66150622-66150644 TCAATTTGTCCTTGAAAGATAGG + Intergenic
1191915402 X:66195919-66195941 TCAGTTTTTCTTTTATAGTTTGG - Intronic
1192905114 X:75543218-75543240 TTTCTTTGTCTTTGATAGATTGG + Intergenic
1193448518 X:81636983-81637005 TGTATTTTTTTTTTAAAGATTGG - Intergenic
1193483880 X:82061401-82061423 TGATTTTGTCTTTTCTATACTGG - Intergenic
1193806301 X:85999082-85999104 TGAATTTTTTTTTTCTAGGTAGG - Intronic
1194538124 X:95133031-95133053 TTACTTTGTCTGATATAGATTGG + Intergenic
1194644501 X:96442123-96442145 TGAATTTGACTTGTAAACATTGG - Intergenic
1194701198 X:97116814-97116836 TGAATAAGTCATTTATACATAGG + Intronic
1194786167 X:98086654-98086676 AGCATTTGTGTTTTACAGATGGG + Intergenic
1195609930 X:106854685-106854707 TAAATTTTTTTTTTAGAGATAGG + Intronic
1195893185 X:109718351-109718373 TGAATTTGTCTTTCAAAGTTGGG - Intronic
1196374577 X:115019005-115019027 TCAAATTCTCTTTTATAAATTGG + Intronic
1196597506 X:117562101-117562123 CGATTTTGTCTTTTATTGTTTGG - Intergenic
1196848341 X:119914492-119914514 TAAATTTGTTTTGTAGAGATAGG + Intronic
1197266503 X:124379711-124379733 GGAATTTCTCATTTATATATAGG - Exonic
1197565492 X:128079447-128079469 TGAGTTTGTCTTTTAAAAATTGG - Intergenic
1199249860 X:145648128-145648150 TAAATATGTCTTTTAGAGAGAGG - Intergenic
1199739162 X:150716690-150716712 TGAATTTGTTATTTATAGTTTGG + Intronic
1200821340 Y:7586647-7586669 AGAATTTTTACTTTATAGATGGG - Intergenic
1201057200 Y:10006558-10006580 AGAATTTTTACTTTATAGATGGG + Intergenic
1201412315 Y:13712446-13712468 TCAATTTTTCTTTTAATGATAGG - Intergenic
1201579098 Y:15492503-15492525 TTAACTTTTCTTTTAGAGATAGG - Intergenic
1201726679 Y:17159626-17159648 TTAGTTTGTTTTTTAGAGATGGG - Intergenic
1201934614 Y:19395050-19395072 TTTTTTTGTCTTTTTTAGATTGG + Intergenic
1201934987 Y:19400760-19400782 TGAAGTTGTCTTTTAAATTTAGG - Intergenic
1202238964 Y:22746104-22746126 AGAATTTTTACTTTATAGATGGG + Intergenic