ID: 1107585490

View in Genome Browser
Species Human (GRCh38)
Location 13:41842918-41842940
Sequence CTGCTCTTCTAGGGCATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107585487_1107585490 -8 Left 1107585487 13:41842903-41842925 CCAGCACAAAGAAAACTGCTCTT 0: 1
1: 0
2: 3
3: 15
4: 253
Right 1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG 0: 1
1: 0
2: 1
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107585490 Original CRISPR CTGCTCTTCTAGGGCATCAA TGG Intronic
903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG + Intergenic
903342052 1:22660800-22660822 CTGCTTTTCCAGGGCTTCCAGGG + Exonic
908112561 1:60911743-60911765 CTGCTCTTCTAGGTCATTTTGGG - Intronic
911774735 1:101794146-101794168 ATGTTCTCCTAGGTCATCAATGG + Intergenic
920347962 1:205318807-205318829 CTGCTCTAGGAGGACATCAAAGG - Intronic
922746697 1:228048240-228048262 CTGCTCTCCCAGGGCCTCGAGGG + Intronic
1065447790 10:25821294-25821316 CAGCTCTTCCTGTGCATCAAGGG + Intergenic
1065522488 10:26586189-26586211 CTGCTCTTCTTGGGCAGCTTGGG - Intergenic
1065522798 10:26588627-26588649 CTGCTCTTCTCGGGCAGCTTGGG - Intergenic
1065528729 10:26647900-26647922 CTGCTCTTCTTGGGCAGCTTGGG - Intergenic
1068903040 10:62291415-62291437 CTGCTCTTCTAGTCTAACAAGGG + Intergenic
1068956997 10:62827311-62827333 CTGGCCTTCTAGGTCATCAGAGG + Intronic
1070281348 10:75051097-75051119 CTGCTCTCCTAGGCCTTCCAGGG - Intronic
1070601118 10:77867040-77867062 GTGCTCTTCCTGGGCATCACAGG - Intronic
1071431891 10:85612972-85612994 CTGCTCTCCCAGCGCATCAGGGG - Intronic
1072017079 10:91359038-91359060 GTTCTCTTTTAGGGTATCAAAGG + Intergenic
1072734382 10:97869204-97869226 CTCCACTTCCAGGGCATCACGGG + Exonic
1077208839 11:1358650-1358672 CTGCTTTTCTAGGTCAACACTGG + Intergenic
1081255391 11:40887134-40887156 CTGACTTTCTAGGTCATCAAAGG + Intronic
1081276135 11:41151176-41151198 CTGGTCTCCTATGGCATTAATGG - Intronic
1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG + Intronic
1086566505 11:88232520-88232542 TTCCTCTTCTAGATCATCAAAGG + Intergenic
1090641430 11:128732256-128732278 CTTCTCATCTAGGACATCTAAGG + Intronic
1096774421 12:53955449-53955471 CTGCTCAACGAGGGCAACAAGGG + Exonic
1101928220 12:108990953-108990975 CTGCTCTTCTCGTTCATCAGAGG + Intronic
1104103758 12:125639969-125639991 CGGCTCCTCTAGGCCATCGAGGG + Intronic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1118096716 14:62545627-62545649 CTCCTTTTCTATGGTATCAATGG + Intergenic
1119095336 14:71824730-71824752 CTGCTCTTCAAGACCATCGAGGG - Intergenic
1120101990 14:80455334-80455356 CTACTCCTCTAGGTCATTAAAGG - Intergenic
1121775318 14:96586962-96586984 CTTCACTTCTAGGCCATGAAGGG - Intergenic
1127302060 15:57664384-57664406 CTCCTCTCCTAGGGAATCAGAGG + Intronic
1135158181 16:20072161-20072183 CTGCTCTCCTAGGGCAGCCGTGG + Intronic
1136297062 16:29309658-29309680 GTGCTCTTCTAGCGCCTCAGCGG + Intergenic
1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG + Intergenic
1137795153 16:51211047-51211069 CTGCTCTGGTAGGGGATAAAAGG + Intergenic
1139735688 16:68986039-68986061 TTGCTCTTCCAGGGAAGCAAAGG - Intronic
1140045902 16:71440651-71440673 TGGCTCTTCTAGGGGAGCAAAGG - Intergenic
1140452807 16:75084726-75084748 CTGTTCTTCTAATACATCAAGGG + Intronic
1142058612 16:88015762-88015784 GTGCTCTTCTAGCGCCTCAGCGG + Intronic
1144885956 17:18461898-18461920 CTCCTCTTCTAGGGTAGCAAAGG - Intergenic
1146591069 17:34128365-34128387 CTGTTCTTGTAATGCATCAAGGG + Intronic
1149269736 17:54965354-54965376 CTGCTTTTCTAAGGTATCACAGG + Intronic
1150649696 17:67001718-67001740 CTGCTCTTCCAGGACTTCAGGGG + Intronic
1151247162 17:72803786-72803808 CTTCTCTTCAAGGCCATCCAGGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156907455 18:42370841-42370863 CTGCTCCTCTGAAGCATCAATGG + Intergenic
1164826998 19:31291123-31291145 CTGCTCCTCTAGGGAACCCATGG + Intronic
1165351858 19:35279992-35280014 ATGCACGTCTAGGGCCTCAAAGG - Intergenic
1167398172 19:49245372-49245394 CTGCTCCTCTAGGGCTGCAATGG + Intergenic
927879198 2:26678767-26678789 CTCCTCTTCTGTGCCATCAAGGG + Intergenic
934681203 2:96285180-96285202 CTGCTCTGCCAGGGCCTCCATGG + Exonic
937361877 2:121235224-121235246 CGGCTCTTCAACGCCATCAAAGG - Exonic
938416527 2:131107489-131107511 CTGTTCTTCAAGGGCAACAGTGG - Intronic
940377531 2:152972383-152972405 ATGCCCTTCTAGGACATCCAGGG - Intergenic
942623366 2:177872354-177872376 CTCCTCTTCCAGGGTATCACTGG - Intronic
943267680 2:185756097-185756119 CAGCTCCTCTTGGGCATAAAAGG + Intronic
943559364 2:189442380-189442402 CTACTCTTCTAAGGCAGAAAGGG - Intronic
946073401 2:217053624-217053646 CTTCTCTTCTAGGGCCTGTATGG - Intergenic
947837707 2:233187697-233187719 CAGCTCTTCTGGGGCTTCAGTGG - Intronic
1175805581 20:61826736-61826758 ATGCTATCCTAGGCCATCAACGG - Intronic
1176450096 21:6854728-6854750 CTGCCAATCAAGGGCATCAATGG - Intergenic
1177306025 21:19317152-19317174 CTGCTTTTCTGGGGTATGAAGGG + Intergenic
1179052672 21:37901788-37901810 CTACTCTTCTAGGACTTTAAAGG - Intronic
1182752768 22:32654926-32654948 CAGCTCTTCTAGAGCAGGAAAGG + Intronic
953665877 3:44926183-44926205 CTGCCCTTCTCAGGCCTCAAGGG + Exonic
956320061 3:67986539-67986561 CTTCTCTTTCAGGGCATCATGGG + Intergenic
960817862 3:121691561-121691583 CTCTTCTTGTAGGGCATTAAAGG + Exonic
960925330 3:122790291-122790313 CTGCTCTTCTCTGGATTCAATGG + Intronic
969630739 4:8334515-8334537 CTGCTCTTGCAGGACAGCAAGGG - Intergenic
971503848 4:27345141-27345163 TTTCTCATTTAGGGCATCAAGGG - Intergenic
972370783 4:38421246-38421268 CTTCTGTTCTTGGGCATCAGTGG - Intergenic
977572706 4:98646136-98646158 CTTCTCCTCTAGGGCATAATGGG - Intronic
985840223 5:2300284-2300306 CAGCTCTTCTAAGGCATGGAAGG + Intergenic
988705537 5:33722958-33722980 CTGCTTTTCTTGGGCTTCCAGGG - Intronic
992045971 5:72889788-72889810 CTCCTCTTCTAGGGTAGCAAAGG - Exonic
996913458 5:128681915-128681937 CTGCTCTATAAGGTCATCAAGGG - Intronic
996963417 5:129279071-129279093 CTCTTCTTTTGGGGCATCAAAGG + Intergenic
997832922 5:137167136-137167158 CTGCTCTTTTATGGCTTCCATGG - Intronic
1000163181 5:158620924-158620946 ATGCTCTTATAGAGCCTCAAAGG - Intergenic
1000295155 5:159906997-159907019 CTGCCCTTCTAGGGTATGAATGG + Intergenic
1004956454 6:20732977-20732999 CTGCTTTACAAGGGCAACAAGGG - Intronic
1008016964 6:46531634-46531656 CTACTCTTCTAGTGCAGCAAAGG - Intergenic
1010064977 6:71672024-71672046 CCTCTCCTCTAGGACATCAACGG - Intergenic
1011581264 6:88868162-88868184 CAGCTCTTTTAAGGCCTCAAAGG + Intronic
1016285210 6:142464761-142464783 CTGCTCTTCTAGGGTATCTTTGG - Intergenic
1021783596 7:24130536-24130558 GTGCTCTTCCAGGTCATCAGTGG - Intergenic
1022561961 7:31358718-31358740 CTGCTCCTCTAGGTCTGCAATGG + Intergenic
1026350169 7:69508668-69508690 CAGCTCTCCTAGGGCTTCATAGG + Intergenic
1028966746 7:96810488-96810510 CTGCTCTTCAAGGGCATGGGTGG + Intergenic
1032463017 7:132125838-132125860 CAGCTCTTCAAGGCCTTCAAGGG - Exonic
1032785769 7:135198141-135198163 CTTTTCCTCTAGGGCACCAAGGG - Exonic
1037936838 8:22920619-22920641 CTGTTCTTCTAGGGAAGTAAAGG - Intronic
1040476466 8:47782456-47782478 CAGCTCTTCCAGGTCATGAATGG - Exonic
1041162602 8:55060530-55060552 ATTCTCTTCTAGGGCTACAAGGG - Intergenic
1041835018 8:62201927-62201949 CTGCTTTTCTCAGTCATCAATGG + Intergenic
1045114922 8:98972323-98972345 CTGCTCCTCTAGGGCTTGGAGGG + Intergenic
1047777127 8:128081665-128081687 CTGCTCTTCTATGGCTTCCATGG + Intergenic
1047796647 8:128263609-128263631 CTGATCTTTTAGGGCATTTAAGG + Intergenic
1047953241 8:129953126-129953148 CTTGTCTTCTAGGGGATGAAAGG + Intronic
1048390097 8:133954752-133954774 CTGCTCCACTAGGTCATTAAGGG - Intergenic
1049861820 8:144903816-144903838 CTTCTCCTATAGGGCAACAAAGG + Intergenic
1050251490 9:3749501-3749523 ATGCCCATCTAGGGCATCTATGG - Intergenic
1050326593 9:4503886-4503908 GTGGGCTTCTAGGGGATCAATGG - Intronic
1050766595 9:9142196-9142218 CTGCTCTTCTAGGGCTTCTATGG - Intronic
1053729714 9:41041080-41041102 CTGCTCTGCTAGGAAATGAAGGG + Intergenic
1054698791 9:68390982-68391004 CTGCTCTGCTAGGAAATGAAGGG - Intronic
1058579087 9:106435428-106435450 CTGCTCTTCCAGGTCTTCACTGG + Intergenic
1058970272 9:110075202-110075224 CTACTCTTCTAAGGCTTGAATGG + Intronic
1203519086 Un_GL000213v1:29789-29811 CTGCCAATCAAGGGCATCAATGG + Intergenic
1196097083 X:111811869-111811891 TTGCTGTTCTGGGCCATCAAAGG - Intronic