ID: 1107585510

View in Genome Browser
Species Human (GRCh38)
Location 13:41843300-41843322
Sequence TTAGACTCCCTTAGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107585510 Original CRISPR TTAGACTCCCTTAGAAAAAC AGG Intronic
900134707 1:1111218-1111240 TTATTTTCCCTTAGAAGAACTGG + Intronic
900322530 1:2092213-2092235 TTCGCCTCCCGTAGGAAAACAGG - Intronic
902126947 1:14222446-14222468 ATAGACTCCTTTATAAAAAGTGG - Intergenic
908929615 1:69303258-69303280 TAAGAACCCCTTAGAAAAACTGG + Intergenic
910514400 1:88043055-88043077 TTGGACTCCATTACAAAAATTGG + Intergenic
914852912 1:151328023-151328045 CAAGACTCCCTTAGTAAATCAGG + Intergenic
917181670 1:172304414-172304436 TTAGACTCCCATACAATAAGGGG + Intronic
918921723 1:190720585-190720607 TTTGTTTCCATTAGAAAAACTGG + Intergenic
924820262 1:247482758-247482780 TAAGAATCCAATAGAAAAACAGG + Intergenic
1064428622 10:15252483-15252505 TTAGATGCCTTTAGTAAAACAGG + Intronic
1068249998 10:54426134-54426156 TTAAATTTCCTTAGTAAAACAGG - Intronic
1071309750 10:84331258-84331280 TTGCACTCCCTCTGAAAAACTGG - Intronic
1073903416 10:108249484-108249506 TTAAACCCCCTTAGGAAAACTGG + Intergenic
1075992647 10:126850664-126850686 CCACACTCCCTTAGAAAAACAGG + Intergenic
1082055001 11:47807132-47807154 TTAGACTCCCTGTGAGAAAAGGG + Exonic
1082228531 11:49736970-49736992 TAAGACACAATTAGAAAAACTGG - Intergenic
1082915517 11:58430959-58430981 CTAAACTACCTAAGAAAAACAGG + Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1086621542 11:88892178-88892200 TAAGACACAATTAGAAAAACTGG + Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1087920424 11:103860759-103860781 TTAGACAGCCTTGGAAGAACAGG - Intergenic
1088535828 11:110859848-110859870 TTAGAGTCAGTTAGAAAATCAGG + Intergenic
1089794018 11:120966060-120966082 TTAGATTTCATTACAAAAACAGG - Intronic
1090663598 11:128900126-128900148 TTAGACTCACTTAGATACACTGG + Exonic
1091472590 12:742190-742212 ATTGACTCCCTTAGAATAGCTGG - Intergenic
1094681436 12:32670740-32670762 TTAGAGTGCCTGGGAAAAACAGG + Intergenic
1095266288 12:40162005-40162027 TAAAAGTCCCTTGGAAAAACTGG - Intergenic
1100347138 12:93743231-93743253 CTAGAATCCCATAGAAAAATTGG - Intronic
1101009211 12:100431705-100431727 TTAACCTCCCTTATCAAAACCGG + Intergenic
1103594340 12:122014716-122014738 TGAGACTCTCTTAAAAAAACAGG - Intergenic
1104594702 12:130113220-130113242 CTAGACTTCATTAGAAAGACAGG - Intergenic
1107585510 13:41843300-41843322 TTAGACTCCCTTAGAAAAACAGG + Intronic
1108326398 13:49336605-49336627 ATAGACTCCCATTGAAAAAAAGG + Intronic
1109216291 13:59593154-59593176 TTAGACTCCCACAGAATAATGGG + Intergenic
1110303766 13:73959975-73959997 CTAAACTCCCTGAAAAAAACTGG + Intronic
1111780862 13:92721974-92721996 TTAGAAACCCTTAAACAAACTGG + Intronic
1111803512 13:93008960-93008982 TTATACTCCCTTACACAAAGGGG - Intergenic
1114250807 14:20958879-20958901 TTAGACCACCTTAGCAAAAGGGG + Intergenic
1114709860 14:24767272-24767294 TTGGACTCCCCTGAAAAAACAGG + Intergenic
1115297372 14:31844172-31844194 TTAGACTCCCTAAGACATAGAGG - Intronic
1117307671 14:54492241-54492263 TAAGAGTCCTTTAGGAAAACTGG - Intergenic
1121940363 14:98064584-98064606 TTAGACTCACTTTGCAGAACGGG + Intergenic
1126829570 15:52587185-52587207 TTAGAGTCCCTTGGTAAAAGGGG - Exonic
1127152521 15:56092304-56092326 ATAGGATCCCTTTGAAAAACAGG - Exonic
1127228328 15:56959607-56959629 TTAGACTCTTTGAGAAAAAAAGG - Intronic
1131254968 15:90856050-90856072 TTACCCTTCCTTAGAAAACCTGG + Intergenic
1131922045 15:97338569-97338591 TTACTCTCCATTAGAAAAAATGG - Intergenic
1131951546 15:97686903-97686925 GTAGAAGCCCTTGGAAAAACAGG - Intergenic
1134200617 16:12195541-12195563 TTAGCCTCTCTTAGCAAAGCTGG + Intronic
1135042513 16:19128878-19128900 TTAGACTGCTTTTGAAAACCAGG - Intronic
1135358355 16:21789860-21789882 TTAGACTCATTTGGGAAAACAGG - Intergenic
1135456858 16:22605985-22606007 TTAGACTCATTTGGGAAAACAGG - Intergenic
1135887073 16:26319921-26319943 TTCTACTCTCTTTGAAAAACAGG - Intergenic
1148906132 17:50913404-50913426 TGAGATTGCCTTGGAAAAACAGG - Intergenic
1151087703 17:71399805-71399827 TAAGAAACCATTAGAAAAACGGG - Intergenic
1151142868 17:72011844-72011866 TAAGGCTCCCTTAAAATAACTGG - Intergenic
1152158682 17:78652973-78652995 TGAGAATCCCAGAGAAAAACGGG - Intergenic
1153405365 18:4732791-4732813 TTAGACTTCCTTGGCAACACTGG - Intergenic
1156859686 18:41821407-41821429 CTTTACTGCCTTAGAAAAACTGG + Intergenic
1158054083 18:53258823-53258845 TTAGACTCCCATACAATAATGGG - Intronic
1159770895 18:72544021-72544043 TTAGACACCCTTAAAAGCACCGG + Exonic
1164936393 19:32217875-32217897 TTAAACTTTCTTAGAAGAACGGG + Intergenic
926457579 2:13086837-13086859 TTAAAGTCCCTTGGAAAAACTGG + Intergenic
929771605 2:44897019-44897041 TTACCCTCCCTTAGAAATACAGG - Intergenic
930119628 2:47749732-47749754 ATAAACACCCTTGGAAAAACTGG + Intronic
933218081 2:79653421-79653443 ATTCACTCCATTAGAAAAACAGG + Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
938559202 2:132456090-132456112 TTAGACTCCCATACAATAATTGG - Intronic
939787216 2:146531152-146531174 TTAGATTCTGTTAGAAAAGCTGG + Intergenic
941055784 2:160786304-160786326 TTTGATTCCATTAGAAAAATAGG + Intergenic
941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG + Intronic
942145968 2:173026568-173026590 ATAGACTCCCTTACCAGAACAGG + Exonic
943190618 2:184673726-184673748 ATAGACTACCAAAGAAAAACGGG + Intronic
945685338 2:212962132-212962154 TTAGACAGCCATAGATAAACAGG + Intergenic
946978122 2:225175789-225175811 CTAGATTCCCTGATAAAAACAGG + Intergenic
948177727 2:235957372-235957394 TTAGACTGAGTTATAAAAACGGG - Intronic
1171451355 20:25238190-25238212 GTACAATCCCTTTGAAAAACTGG - Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1178127261 21:29528522-29528544 TCAGGCTCCCTTAAAAAAAAGGG - Intronic
1178626467 21:34222856-34222878 TGAGACTCCCTGAGAAACACTGG - Intergenic
1181779819 22:25184552-25184574 TTAGAGTCCCATAAGAAAACCGG - Intronic
1183240375 22:36653403-36653425 TTTGGCTTCCTTTGAAAAACTGG + Intronic
949800265 3:7896426-7896448 TTAGACTCCCACATAATAACAGG - Intergenic
951228657 3:20150422-20150444 TGTGACTCCCTAAGTAAAACAGG - Intronic
951666361 3:25128118-25128140 TTAGAACCCCTAAGAAAAGCAGG - Intergenic
953917275 3:46928000-46928022 TTAACCTCCCTTATAAAAGCAGG + Intronic
954358330 3:50102090-50102112 TTAGACTCCTTTTTAAAATCTGG + Intronic
954401444 3:50321665-50321687 TGAGACTCCCATAGAAAGCCCGG - Exonic
955223950 3:57045801-57045823 TTAACCTCAATTAGAAAAACTGG - Intronic
959597580 3:108144734-108144756 TGAGACTCACAAAGAAAAACAGG - Intergenic
964383221 3:156119478-156119500 TTAGAGTCCCTGAGAAGAGCAGG - Intronic
965837608 3:172868593-172868615 TTTGGCTACCTTAGAAAAATGGG - Intergenic
967284457 3:187854675-187854697 TTAGACTCCCTTGTAGAAAATGG - Intergenic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
971588409 4:28434747-28434769 TAAAAGTCCCTCAGAAAAACTGG + Intergenic
971629169 4:28967152-28967174 TTAGACTTCCTGAGAGAAACTGG + Intergenic
972907261 4:43766346-43766368 TTAGACTGCCTGAGCAAAAGGGG - Intergenic
975782222 4:77851320-77851342 TTAGAAACCCTTAGTCAAACTGG - Intergenic
976267464 4:83197554-83197576 ACAGACTCCCTGAGAAAAACGGG + Intergenic
977354788 4:95932073-95932095 TAAAAGTCCCTTGGAAAAACTGG + Intergenic
981662018 4:147178640-147178662 CAAGAATCCATTAGAAAAACTGG + Intergenic
982242931 4:153318812-153318834 ATAGACACTCTTAGAAGAACTGG + Intronic
982467176 4:155745602-155745624 CAAGTCTACCTTAGAAAAACAGG - Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983295489 4:165862794-165862816 TTATCTTCACTTAGAAAAACTGG - Intergenic
984226171 4:177037602-177037624 CTAGACTACCTTAAAAAAATGGG - Intergenic
984332288 4:178339850-178339872 TTAGATTCTCTGATAAAAACTGG - Intergenic
984501600 4:180565609-180565631 TGAGACCCACTTAGAAAAAGGGG + Intergenic
985279619 4:188272232-188272254 TTAGATTCCCTAATAATAACAGG - Intergenic
988087774 5:26493925-26493947 TAAAACTGCCTTGGAAAAACTGG + Intergenic
988395408 5:30691598-30691620 AGAGACTCACTTATAAAAACAGG + Intergenic
994007606 5:94857998-94858020 TTTGAATTACTTAGAAAAACTGG - Intronic
994809049 5:104489552-104489574 TTAAAATGCCTTAGAAACACTGG + Intergenic
995801774 5:116004401-116004423 TTAGACTCCATTTACAAAACTGG + Intronic
1003534172 6:6961739-6961761 TAAGACTCCCTTAGAATGACAGG - Intergenic
1003896081 6:10609012-10609034 TCAGACTTCCATAGAAAATCTGG + Intronic
1004381381 6:15135492-15135514 TGAGACTCCCTTAGAACTGCAGG - Intergenic
1005256758 6:24011501-24011523 ATACACTCCCTGAGCAAAACAGG + Intergenic
1010670301 6:78678533-78678555 TTAGACTCCCATGGAATAATGGG + Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013941340 6:115666936-115666958 GTAGGCTCCATTAGAAAAATGGG - Intergenic
1015441808 6:133256976-133256998 ATTGAATCCCTTAGAATAACAGG - Intronic
1018379708 6:163247363-163247385 TCCTACTCCCTTAGAAAAATAGG + Intronic
1022154247 7:27643223-27643245 GTAGACTACCTTAGCAAAATGGG - Intronic
1022844045 7:34192038-34192060 TTAGACTCCTGGAGAAAAAGAGG - Intergenic
1026251872 7:68678359-68678381 TGAGACTCCCTGAGAAACTCAGG - Intergenic
1026371971 7:69709149-69709171 TTAGACTACCTTGGAAGAATTGG + Intronic
1027471758 7:78582760-78582782 ATAGACTCCTCTAGAAAAATGGG + Intronic
1030861260 7:114632817-114632839 TTAGAATAACTCAGAAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1033252858 7:139776268-139776290 TCAGACTCTCTTAGAAACAAAGG - Intronic
1033999151 7:147390120-147390142 TTTAACTCCCTTAGAAACAGAGG - Intronic
1038667847 8:29556521-29556543 TAAGACAGGCTTAGAAAAACAGG - Intergenic
1040456850 8:47606702-47606724 CTAGACTCCTTTTGAAAAGCTGG + Intronic
1043431965 8:80204045-80204067 TTAGAGTTCCTGAGAAAAATGGG + Intronic
1044001430 8:86886149-86886171 TTGAACACCATTAGAAAAACAGG + Intronic
1047677168 8:127215044-127215066 TTAGAGTCAGTGAGAAAAACTGG - Intergenic
1048384905 8:133903095-133903117 AAAGACTCCCTTTGAAACACAGG + Intergenic
1049082806 8:140456718-140456740 TATGACTACCTTAGAAACACGGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1052465146 9:28820756-28820778 TTTTACTCCCTTAGAAACAGTGG + Intergenic
1053230473 9:36403517-36403539 TGAGGCTCCCTTTAAAAAACTGG + Intronic
1055393670 9:75850334-75850356 TTAGACCCCCTTACAACAGCTGG - Intergenic
1056095265 9:83246537-83246559 TTTGACTTCCATAGAGAAACTGG - Exonic
1058729130 9:107833101-107833123 TTACCCTCCCTTAGAAAAACTGG - Intergenic
1061566074 9:131441237-131441259 TCTGACTCCCTCAAAAAAACTGG - Intronic
1186968272 X:14811694-14811716 TTAGACTCCCATATAATAATGGG + Intergenic
1188034911 X:25306687-25306709 TTAGACTCACTTACAAATTCAGG - Intergenic
1191702090 X:64054117-64054139 TTAGACTGCCCTAGAGAATCAGG - Intergenic
1194542752 X:95194716-95194738 TTAGACTCCCACACAATAACAGG - Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1199449697 X:147965662-147965684 ATAGATTCCCTGAGAAAAAGAGG + Intergenic
1202133627 Y:21637599-21637621 TTACATTCCTTTAGCAAAACTGG + Intergenic