ID: 1107585609

View in Genome Browser
Species Human (GRCh38)
Location 13:41844601-41844623
Sequence CTGTTCTAGCAGCATTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 475}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107585609 Original CRISPR CTGTTCTAGCAGCATTTTGA GGG (reversed) Intronic
902891837 1:19449881-19449903 CTGTTATCCCAGCACTTTGAGGG + Intronic
904853717 1:33479197-33479219 CTTTTCTAGGAGCCTCTTGAAGG + Exonic
906360526 1:45153858-45153880 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
907047235 1:51306724-51306746 CTGGGCTGACAGCATTTTGAAGG + Intronic
908275704 1:62468673-62468695 CAGTTCTAGAAGCTTTTTGGAGG - Intronic
908537626 1:65092825-65092847 CTGTTCTACCAGCATTTCCTGGG + Intergenic
908747867 1:67393488-67393510 CTGTGGTAGCAGCACTTTGGCGG + Intronic
908839020 1:68259743-68259765 CTGTTCTAACAGCTTTTTGATGG + Intergenic
909098663 1:71322503-71322525 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
910078003 1:83303098-83303120 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
910113877 1:83711396-83711418 CTGGTTTAAAAGCATTTTGAAGG - Intergenic
910153174 1:84179648-84179670 CTTTTTTATCATCATTTTGATGG + Intronic
910254415 1:85233430-85233452 CAGTTCTAGTAGCCTTTTGGTGG + Intergenic
910358499 1:86390943-86390965 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
910380785 1:86624283-86624305 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
910933670 1:92467708-92467730 TTGTAATCGCAGCATTTTGAAGG + Intergenic
910996295 1:93107592-93107614 CTGAACTAGCAGCTTTTTCATGG + Intronic
911562368 1:99421854-99421876 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
911805849 1:102207206-102207228 CAGTTATAGGAGCTTTTTGAAGG + Intergenic
912232745 1:107814785-107814807 ATATTCTAGCAGCAATTTGCAGG + Intronic
912724643 1:112047955-112047977 CTATTCTACCAGCATTTACAAGG + Intergenic
913338076 1:117728706-117728728 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
916277758 1:163013643-163013665 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
916837562 1:168563631-168563653 CAGTTCTAGGAGCTTTTTGCAGG + Intergenic
917320592 1:173777291-173777313 CTGTTCTAATAGCTTTTTGGTGG + Intronic
917673439 1:177296592-177296614 CAGTTCTAGGAACATTTTGTTGG - Intergenic
917836885 1:178948143-178948165 ATGGACTAGAAGCATTTTGAGGG - Intergenic
920892050 1:209997231-209997253 CAGTTCTTGCAGCCTTTTGGTGG - Intronic
922040657 1:221893067-221893089 CAGTTCTAGGAGCCTTTTGGTGG - Intergenic
922658288 1:227405335-227405357 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
922708918 1:227811960-227811982 CAGTTCTAACAGCTTTTTGGTGG - Intergenic
922949185 1:229543999-229544021 CAGTTCTAGGAGAATCTTGATGG - Intronic
923459116 1:234192704-234192726 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
923658639 1:235939921-235939943 CTGTAATCCCAGCATTTTGAGGG + Intergenic
923893898 1:238247497-238247519 TAGTTCTAGCAGCTTTTTGGAGG - Intergenic
923945209 1:238878443-238878465 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
923960775 1:239081089-239081111 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
923982532 1:239341269-239341291 CTGTTATCCCAGCATTTTGTGGG - Intergenic
1063625254 10:7683209-7683231 CAGTTCTAGGAGCCTTTTGGTGG - Intergenic
1063697720 10:8353234-8353256 CTGGACTAGCAGCATTGTGTCGG - Intergenic
1064442691 10:15368884-15368906 TTGAGCTAGCAGCATTTTTAAGG - Intronic
1065079644 10:22115268-22115290 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1065911372 10:30309040-30309062 CTGTAATCCCAGCATTTTGAGGG + Intergenic
1066784561 10:38989061-38989083 CTGTTCTAGGAGCTTTTTAGAGG - Intergenic
1067371698 10:45689775-45689797 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1067388083 10:45836374-45836396 CAGTTCTAGGAGCTTTTTGGAGG + Intronic
1067418041 10:46120906-46120928 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1067446185 10:46348230-46348252 CGGTTCTAGGAGCTTTTTGGAGG - Intergenic
1067503397 10:46827469-46827491 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1067591195 10:47512541-47512563 CGGTTCTAGGAGCTTTTTGGAGG + Intronic
1067638313 10:48020633-48020655 CGGTTCTAGGAGCTTTTTGGAGG + Intergenic
1067875179 10:49999725-49999747 CGGTTCTAGGAGCTTTTTGGAGG - Intronic
1068310584 10:55269391-55269413 CCATTCTAGCAGCATTTTGATGG - Intronic
1069068265 10:63968527-63968549 CAGTTCCAGGAGCCTTTTGATGG - Intergenic
1069548848 10:69348349-69348371 CTCTTCTTGCAGCATTTGGGTGG + Intronic
1069583409 10:69580192-69580214 ATGTTCATGCAGAATTTTGAAGG + Intergenic
1070134918 10:73685059-73685081 CGGTTCTAGGAGCTTTTTGGAGG + Intronic
1070715012 10:78713440-78713462 CTGTAATGCCAGCATTTTGAGGG - Intergenic
1071295730 10:84217928-84217950 CTTTTCTAGCAGGATTCTGAGGG - Intronic
1071843805 10:89500902-89500924 CAGTTCTAGGAGCTTTCTGAAGG - Intronic
1072726590 10:97817685-97817707 CTGTTATCCCAGCATTTTGGGGG - Intergenic
1072829762 10:98645408-98645430 ATATTTTAGAAGCATTTTGAAGG - Intronic
1073346905 10:102790156-102790178 CTCTTGTAGAAGCACTTTGATGG + Intronic
1073953883 10:108844868-108844890 CAGTTCTAGGAGCCTTTTGATGG + Intergenic
1074042599 10:109806739-109806761 CAGTTCTAGTAGCTTTTTGGGGG - Intergenic
1074566383 10:114582126-114582148 CAGTTCTAGGAGCCTTTTGGTGG - Intronic
1074787214 10:116851598-116851620 CTGCTCTGGCAGCATTCTGCAGG - Intronic
1075541753 10:123319403-123319425 CCGTTCCACCAGCGTTTTGAGGG + Intergenic
1075750898 10:124770159-124770181 CTGTTATCCCAGCACTTTGAGGG + Intronic
1075849157 10:125573579-125573601 CTGTTGTAGCAGGATGTTGTTGG + Intergenic
1076665194 10:132084418-132084440 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1078372669 11:10762744-10762766 CTGTAATCCCAGCATTTTGAGGG + Intronic
1079591543 11:22189132-22189154 CTGTGGAAGCAGCATTTTGTAGG + Intergenic
1079805701 11:24928120-24928142 CAGTTCTAGGAGCTTTTTGGAGG + Intronic
1079926257 11:26495364-26495386 CTGTAATACCAGCAATTTGAGGG - Intronic
1080401268 11:31938148-31938170 CTGTAATCGCAGCACTTTGAGGG + Intronic
1080585536 11:33678730-33678752 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1080670131 11:34368543-34368565 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1080754151 11:35179430-35179452 CTCTTCTAGCAGCATCCTGGTGG - Intronic
1081058305 11:38438894-38438916 CTGTAATCCCAGCATTTTGAGGG + Intergenic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1082109077 11:48253334-48253356 CAGTTCTAGCAGCCTTTTGGTGG + Intergenic
1082722767 11:56698645-56698667 ATGTTCTAGATGCATTTTGAAGG + Intergenic
1083035763 11:59635905-59635927 CTGTACTCCCAGCATTTTGGGGG + Intergenic
1085782009 11:79418172-79418194 CTATTCTAGCCGCATTTCAAGGG + Intronic
1086082452 11:82918976-82918998 CAGTTCTAGCAGCTTTCTGGAGG + Intronic
1086196838 11:84150450-84150472 CAGTTCTAGGAGCTTTTTGGTGG + Intronic
1086345167 11:85889092-85889114 CTGTAATACCAGCATTTTGGGGG + Intronic
1087223652 11:95573630-95573652 CTCTTCTATCATCTTTTTGAAGG + Intergenic
1087429460 11:98033990-98034012 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1087429471 11:98034153-98034175 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1087725511 11:101711522-101711544 CAGTTCTAGGAGCCTTTTGGTGG - Intronic
1088431311 11:109761989-109762011 CAGTTCTAGGAGCATTTTTGTGG - Intergenic
1088501051 11:110482730-110482752 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1089141343 11:116287257-116287279 CTGTAATAGCAGCACTTTGGGGG + Intergenic
1089730371 11:120515216-120515238 CTCTTCCAGCAGCACCTTGAAGG - Intronic
1090415430 11:126537063-126537085 TTGTTCCAGCAGCAGATTGAGGG + Intronic
1091389702 12:118581-118603 CTCTACCAGGAGCATTTTGAAGG - Intronic
1091514660 12:1166789-1166811 TTGTTCTATCAGCATTATTATGG + Intronic
1092316409 12:7419616-7419638 CAGTTCTAGGAGCTTTTTGTTGG - Intronic
1092736507 12:11587901-11587923 CTTTTTTAGAAGCTTTTTGACGG - Intergenic
1093131680 12:15399520-15399542 CTAATCTAGAAGCACTTTGAAGG + Intronic
1093408862 12:18841134-18841156 CAGTTCTAGGAGCTTTCTGAAGG + Intergenic
1094253045 12:28388370-28388392 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
1094349922 12:29513029-29513051 TTATTTTAGCAGCTTTTTGAAGG - Intronic
1094868490 12:34570006-34570028 CTGTTCTTGTAGAATTATGAAGG - Intergenic
1095117905 12:38378031-38378053 CAGTTCTAGGAGCTTATTGAAGG + Intergenic
1095893322 12:47255273-47255295 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1096920009 12:55073596-55073618 CGGTTTTAGCAGTTTTTTGAGGG + Intergenic
1097352605 12:58564927-58564949 CTGTCCTAGCAGCCCTCTGAGGG + Intronic
1097371213 12:58783551-58783573 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
1097723443 12:63048624-63048646 CTGTAATCCCAGCATTTTGAGGG - Intergenic
1098781277 12:74689661-74689683 CTTTTGAAGCAGCATTTTCATGG + Intergenic
1098941842 12:76546498-76546520 ATTTTCTAGCAGCATTATTAAGG + Intronic
1099257318 12:80329864-80329886 CTGGTCTATCAGCAGTTTTAGGG - Intronic
1099759489 12:86898728-86898750 TAGTTCTAGCAGTATTTTGTTGG + Intergenic
1100307235 12:93362006-93362028 CTGTTATACCAGCACTTTGGGGG + Intergenic
1101518081 12:105455584-105455606 CTGCTCTACCACCAATTTGAGGG - Intergenic
1102897749 12:116612112-116612134 CTGTAATCTCAGCATTTTGAGGG - Intergenic
1104452417 12:128881272-128881294 CTGTAATCCCAGCATTTTGAAGG + Intronic
1105314827 13:19248484-19248506 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1106477581 13:30111795-30111817 CTCTTCTGTCAGCCTTTTGAGGG - Intergenic
1106622060 13:31380193-31380215 CTTTTTTAGCAGCCTTTTAAGGG - Intergenic
1106859606 13:33891229-33891251 ATTTTCTGCCAGCATTTTGAGGG - Intronic
1107585609 13:41844601-41844623 CTGTTCTAGCAGCATTTTGAGGG - Intronic
1107823787 13:44309341-44309363 CTGTTCTTTCAGCATTTTCTGGG + Intergenic
1108221856 13:48242661-48242683 TTTTTCTCTCAGCATTTTGATGG + Intronic
1108865255 13:54915412-54915434 CAGTTCTAGGAGCCTTTTGATGG - Intergenic
1109100352 13:58176256-58176278 CAGTTCTAACAGCTTTTTGGTGG + Intergenic
1109150837 13:58845379-58845401 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1109331524 13:60936675-60936697 TTTTTCTTGCAGCATTATGATGG + Intergenic
1109567464 13:64135962-64135984 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1110194406 13:72770293-72770315 CTGTTATAGCAAAATTTTGAGGG - Intronic
1110273513 13:73617254-73617276 CTGTTCTAGCAGCATTGGCAAGG - Intergenic
1111798910 13:92958767-92958789 CAGTTCTAACAGCTTTTTGGTGG + Intergenic
1111840384 13:93442246-93442268 ATTTTCTAGCAGCATTGTGCAGG + Intronic
1111857710 13:93660847-93660869 CTGCTATTGCATCATTTTGAAGG - Intronic
1114203183 14:20542148-20542170 CTTGTCTGGGAGCATTTTGAGGG - Intergenic
1115077364 14:29408194-29408216 CCGTTCTAGGGGCATTTTGGTGG - Intergenic
1115113295 14:29850315-29850337 CAGTTCCAGAAGCCTTTTGATGG - Intronic
1115213330 14:30990135-30990157 GTGTTCTAGCAGTCTTCTGAGGG + Intronic
1116033337 14:39599268-39599290 CAGCTAAAGCAGCATTTTGAGGG + Intergenic
1116189940 14:41651572-41651594 TTATTCTAGCAGCATTTTCCAGG - Intronic
1116381400 14:44273488-44273510 CTATTTTAGCAGCATTGTAATGG - Intergenic
1117215202 14:53544514-53544536 CAGTTCTAACAGCTTTTTGGTGG + Intergenic
1119663775 14:76469630-76469652 CTGTCATCCCAGCATTTTGAGGG - Intronic
1119795118 14:77389381-77389403 GTGTTCTAGCAGCAATTCCATGG + Intronic
1120016077 14:79475040-79475062 TGGTTCTAGCAACATTTTGTGGG - Intronic
1120137113 14:80883357-80883379 CAGTTCTAGCAGTTTTTTGATGG - Intronic
1120591497 14:86379259-86379281 TTGTTATAGAAGAATTTTGAGGG - Intergenic
1120687282 14:87552532-87552554 CAGTTCTAACAGTTTTTTGATGG - Intergenic
1120779636 14:88475247-88475269 CTGTTCTTGCACCATTATCATGG - Intronic
1122622207 14:103065800-103065822 CTGTTTGAGCAGCATTGGGAAGG - Intergenic
1125049129 15:35277304-35277326 CAGTTCTAGGAGCTTTTTGGAGG + Intronic
1126287600 15:47031461-47031483 CAGTTCCAGCAGCCTTTTGGAGG - Intergenic
1126419998 15:48461991-48462013 CTGGTCTAGAAACATTTTGCAGG + Intronic
1126547829 15:49891856-49891878 CTGTAATCCCAGCATTTTGAGGG + Intronic
1126634307 15:50766246-50766268 CTGTAATACCAGCATTTGGATGG + Intergenic
1126670107 15:51108449-51108471 TTGTTCCAGAAGTATTTTGAGGG - Intergenic
1127924244 15:63523175-63523197 CTGGTGTAGGAGGATTTTGAGGG + Intronic
1128850590 15:70951640-70951662 CAGTTCTAGAAGCCTTATGATGG + Intronic
1129546070 15:76396695-76396717 CGGTTCTAATAGCTTTTTGATGG + Intronic
1130139334 15:81210725-81210747 CAGTTCTAGCAGACTTTTGTTGG + Intronic
1130158478 15:81374640-81374662 CTGTTCCATCAGCATTTCTAAGG - Intergenic
1130397820 15:83519546-83519568 CAGTTCTAGGAGCCTTTTGGTGG + Intronic
1130405853 15:83601069-83601091 CAGTTCTAGGAGCTTTTTGGAGG + Intronic
1130730993 15:86492064-86492086 CTATTCTAGGAGCACTTTGAGGG - Intronic
1130749427 15:86694476-86694498 TAGTTCTAGGAGCTTTTTGATGG + Intronic
1131474315 15:92723635-92723657 CTGTAATTGCAGCACTTTGAAGG + Intronic
1131693405 15:94850449-94850471 ATGTTCTGGCAGCATTTTTAGGG + Intergenic
1131813127 15:96193614-96193636 TTGTTCTGGCATCATTTTGGGGG + Intergenic
1132946723 16:2535834-2535856 CAGTCCTGGCAGCATCTTGATGG + Intergenic
1133857696 16:9565028-9565050 CTGTAATCGCAGCACTTTGAGGG + Intergenic
1134639125 16:15814969-15814991 TTTGTCTAGCATCATTTTGAGGG - Intronic
1134646136 16:15868153-15868175 GTGTTCAATCAGCATTTTGAGGG + Intronic
1135277108 16:21122697-21122719 ATGTTTTAGCTGAATTTTGAAGG - Intronic
1138000834 16:53277867-53277889 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
1138274500 16:55723553-55723575 CAGTTCTAGTAGCCTTTTGGTGG - Intergenic
1138413247 16:56856009-56856031 CTGTGAAAGCAGCATTTTGGAGG - Intergenic
1138518263 16:57551749-57551771 ATGTTCTTGCAGCATCTAGAAGG + Intronic
1138782033 16:59800172-59800194 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1141071522 16:80959988-80960010 CTGTTCTAGCGGTTTTTTCAGGG - Intergenic
1141752570 16:85968726-85968748 CTGTAATCTCAGCATTTTGAGGG + Intergenic
1143002306 17:3802131-3802153 TTGTTCTAGTGGCATTTTAAGGG - Intergenic
1143533742 17:7523196-7523218 TTGTTCTAACAGCAGTTAGATGG - Intergenic
1144146680 17:12405591-12405613 CTGTAATCCCAGCATTTTGAAGG + Intergenic
1146931387 17:36780599-36780621 CTGTAATCCCAGCATTTTGAAGG + Intergenic
1148637216 17:49158048-49158070 CAGTTCTAGCTGCATTTTGGAGG + Intronic
1149136880 17:53377487-53377509 CAGTTCCAGGAGCCTTTTGATGG + Intergenic
1149194753 17:54106124-54106146 CAGTTCCAGTAGCATTTTGATGG - Intergenic
1150093052 17:62346809-62346831 CAGTTCTAGCAGCTTTCTGGGGG + Intergenic
1150744805 17:67808035-67808057 CTGTAATCCCAGCATTTTGAGGG + Intergenic
1152373742 17:79906851-79906873 CTGTAATCCCAGCATTTTGAGGG - Intergenic
1153199625 18:2635051-2635073 TTGGTCTCCCAGCATTTTGATGG - Intergenic
1153221542 18:2866578-2866600 CAGTTCTAGGAGCTTTTTGGAGG + Intronic
1153402228 18:4693604-4693626 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
1154097817 18:11434964-11434986 TAGTTCTAGAAGCACTTTGATGG - Intergenic
1154098862 18:11449244-11449266 CAGTTCCAGGAGCATTTTGGTGG - Intergenic
1156217742 18:35017706-35017728 CTGTTCCAGCAGTATTTTGGTGG + Intronic
1156426221 18:37015881-37015903 CAGTTCCAGGAGCCTTTTGATGG + Intronic
1156481052 18:37436684-37436706 CTGTTCCTGCAGCCCTTTGAAGG + Intronic
1158793731 18:60815255-60815277 CAATTCTAGGAGCCTTTTGATGG - Intergenic
1158823073 18:61183595-61183617 TTATTGTATCAGCATTTTGAAGG - Intergenic
1159013681 18:63083432-63083454 CTGTTCCAGCAGCCTTTTTTTGG + Intergenic
1159525543 18:69584157-69584179 CTGTTTTAACAGTGTTTTGATGG - Intronic
1161833990 19:6632602-6632624 CTGTCATCCCAGCATTTTGAGGG + Intergenic
1165983099 19:39742450-39742472 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1166009408 19:39930789-39930811 CAGTTCTAATAGCTTTTTGATGG - Intronic
1166263052 19:41656307-41656329 CAGTTCTAGAAGCTTTTTGAAGG - Intronic
1166428774 19:42704157-42704179 CAGTTCTAGGAGCTTTTTGGAGG + Intronic
1166630743 19:44404980-44405002 GAGTTCTAGAAGCTTTTTGAAGG - Intergenic
1167725242 19:51207652-51207674 CTGTAATCCCAGCATTTTGAAGG - Intergenic
925031962 2:657433-657455 ATTTTCTATCAGCATTTTAAGGG + Intergenic
925699511 2:6620587-6620609 CTGGCCTAGCAGAATTTTTATGG - Intergenic
925742728 2:7019988-7020010 GTCTTCTAGCAGCATTTTCCTGG + Intronic
926127815 2:10282755-10282777 CTGTTCTTGCAGCCTGGTGAGGG - Intergenic
926560527 2:14412274-14412296 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
927335452 2:21917521-21917543 CTTTACTAGCATTATTTTGAGGG - Intergenic
927363151 2:22261009-22261031 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
928079947 2:28302157-28302179 CTGTTCTCCCAGCATTTTGGGGG + Intronic
928181280 2:29070765-29070787 CTGTTCTTCCAGCATTCTGCTGG + Exonic
928525810 2:32139379-32139401 CAGTTCTAGTAGCCTTTTGACGG - Intronic
928578634 2:32682568-32682590 CTGCTCTAGCAGCAGCTTGGTGG + Intronic
928729587 2:34215845-34215867 CTGTTTTACAAGCATTTTGGTGG - Intergenic
929197430 2:39200098-39200120 CAGTTCTAGGAGCTTTTTGAAGG - Intronic
931016402 2:57985818-57985840 TAGTTCTAGCAGCATTTTAGTGG - Intronic
931365705 2:61617051-61617073 CTGTAATCGCAGCATTTTGGGGG + Intergenic
931554034 2:63479991-63480013 CAGTTCTAGGAGCCTTTTGGAGG - Intronic
933122416 2:78556570-78556592 CAGTTATAGGAGCATTTTGGAGG - Intergenic
933291742 2:80445436-80445458 CTGTAATGTCAGCATTTTGAGGG - Intronic
935007459 2:99093510-99093532 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
935646774 2:105343318-105343340 CTGTTCTTGAACCCTTTTGATGG + Intronic
935661976 2:105474701-105474723 CAGTTATATCTGCATTTTGAAGG + Intergenic
936382405 2:111998072-111998094 ATGTTCTAGTAGCATTCTGAAGG - Intronic
936708725 2:115106088-115106110 CTGTTTTGGCATCATTGTGATGG + Intronic
936856249 2:116961057-116961079 CTTTTTTAGCAGAATATTGAAGG + Intergenic
936898983 2:117462312-117462334 CAGTTCTAGAAGCTTTTTGGAGG + Intergenic
936910822 2:117591312-117591334 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
938542921 2:132300698-132300720 GAGTTCTAGAAGCTTTTTGAAGG + Intergenic
939494440 2:142911441-142911463 CAGTTCTAGGAGAATTTTGGTGG + Intronic
939923660 2:148147495-148147517 CTGTAATACCAGCACTTTGAGGG - Intronic
940146904 2:150555170-150555192 CTGTAATCCCAGCATTTTGAGGG + Intergenic
940691096 2:156922214-156922236 GTGTTGTAGCAACATTTTTATGG - Intergenic
940707264 2:157120925-157120947 CAGTTCTAGGAGCTTTCTGAAGG + Intergenic
941127132 2:161597639-161597661 CAGTTCTAGTAGCCTTTTGGTGG - Intronic
941702467 2:168618491-168618513 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
942741837 2:179189681-179189703 CAGTTCTAGAAGCCTTTTGGTGG - Intronic
943359999 2:186907601-186907623 GTGTTCTAGAAGCATATTAAAGG + Intergenic
944087047 2:195861725-195861747 CTTTTCTAACAACAGTTTGAAGG + Exonic
944431682 2:199640546-199640568 CTGTTCTAACAGCTTTCTGTAGG + Intergenic
944497226 2:200319306-200319328 CTGTAATCCCAGCATTTTGAAGG + Intronic
944528541 2:200644926-200644948 CAGTTCTAGGAGCTTTGTGAAGG + Intronic
944602462 2:201317309-201317331 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
944996829 2:205303549-205303571 CTGTACTTGCATCATTTGGAGGG - Intronic
945838720 2:214863121-214863143 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
946122285 2:217526568-217526590 CTCTTCTAGCAGCAGCTGGAGGG + Intronic
946605217 2:221396858-221396880 CTGTTCTAGCAGCACTTGGGAGG - Intergenic
946824405 2:223661912-223661934 CAGTTCTAGAAGCGTTTTGGAGG - Intergenic
947064842 2:226212270-226212292 GTCTTTTAGCTGCATTTTGAAGG + Intergenic
947287142 2:228529485-228529507 CTGTTCTGGCTGCTTCTTGAGGG - Intergenic
948025199 2:234771045-234771067 TTGTTCTGGCAGAATTTTGTAGG - Intergenic
1170086582 20:12539488-12539510 CAGTTCTAGGAGCTTTTTGGGGG - Intergenic
1170241381 20:14170225-14170247 CAGTTCTAGGAGCTTTTTGGAGG + Intronic
1171047522 20:21824684-21824706 CTGTTCTAATTTCATTTTGATGG + Intergenic
1171871801 20:30533527-30533549 GAGTTCTAGAAGCTTTTTGAAGG + Intergenic
1172179987 20:32996986-32997008 CTGTACTGGCAGCTTCTTGAAGG - Intronic
1174754746 20:53146637-53146659 CTGGTCTTGCATCATGTTGAGGG - Intronic
1177270128 21:18836993-18837015 CAGTTCTAGGAGCCTTTTGGTGG + Intergenic
1179083804 21:38198673-38198695 CAGTTCTAGGAGCATTCTGGAGG + Intronic
1179127803 21:38607136-38607158 ATTTTCCAGCAGCACTTTGAAGG - Intronic
1179224873 21:39444710-39444732 CTATTCTGGGTGCATTTTGAAGG + Intronic
1179488621 21:41726660-41726682 CAGGTCTGGCAGCATTTTGCCGG - Intergenic
1179659917 21:42867820-42867842 CTGTAATCCCAGCATTTTGAGGG - Intronic
1179933393 21:44587149-44587171 CAGTTCTAGGAGCTTTTTGTAGG - Intronic
1180027086 21:45172099-45172121 AGGTTCTCGCTGCATTTTGAAGG + Intronic
1180607515 22:17070499-17070521 CAGTTCTAGCAGTTTTTTGGTGG + Intergenic
1181454636 22:23050876-23050898 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1182682660 22:32093722-32093744 CAGTTCTACAAGCATTTTGGAGG + Intronic
1182741922 22:32574033-32574055 CTGTAATCCCAGCATTTTGAGGG - Intronic
1182968394 22:34546937-34546959 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1184338620 22:43872288-43872310 CAGTTCTAGGAGCTTTTTGAAGG + Intergenic
949708847 3:6850798-6850820 CTGTACTCTCAGCACTTTGAGGG - Intronic
949751454 3:7356731-7356753 TTGTACCAGCAGCTTTTTGAGGG + Intronic
949959217 3:9298434-9298456 ATGTTCTGGCAGCATTATGTAGG - Intronic
950988686 3:17406781-17406803 CTGTACTATCAGCATTTTAGAGG - Intronic
951000979 3:17559399-17559421 CTGTAATACCAGCATTTTGGTGG - Intronic
951184142 3:19692609-19692631 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
951282092 3:20764217-20764239 GTGTTTTAGCTGAATTTTGAAGG - Intergenic
952500117 3:33953815-33953837 CTGTGCCTGCAGCATTTAGAGGG + Intergenic
952601838 3:35092833-35092855 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
953157571 3:40388460-40388482 CTGTGCCAGCAACATTTGGATGG - Intronic
954440609 3:50519819-50519841 CTGGTCCAGCAGGATTGTGAGGG + Intergenic
955238667 3:57161692-57161714 CTGGTCTAGAAGCCTTTTTATGG - Intronic
955968723 3:64415166-64415188 CAGTTCCAGGAGCCTTTTGATGG - Intronic
956317858 3:67959051-67959073 CAGTTCTAACAGTTTTTTGATGG - Intergenic
956341787 3:68232859-68232881 CTGTAATCCCAGCATTTTGAGGG - Intronic
956377044 3:68624929-68624951 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
957798582 3:85044461-85044483 CTGTTCTCTCTGCATTATGAAGG + Intronic
958840308 3:99196029-99196051 CAGTTCTAACAGCATTTTGACGG - Intergenic
958951165 3:100417634-100417656 CTGTAATCCCAGCATTTTGAAGG - Intronic
959125567 3:102286525-102286547 CGGTTCTAGGAGCTTTTGGATGG + Intronic
959227601 3:103604838-103604860 CAGTTCTAGTAGCCTTTTGGTGG + Intergenic
959336715 3:105076366-105076388 CTGTAATACCAGCACTTTGAGGG - Intergenic
959572778 3:107902846-107902868 CAGTTCTAGGAGCCTTTTGGTGG + Intergenic
960471374 3:118070065-118070087 CAGTTCTAGCAGTGTTTTGGTGG + Intergenic
960487141 3:118268009-118268031 TTGTTCTGCCAGCATTTTGGTGG - Intergenic
963176471 3:142303074-142303096 CAGTTCTAGCAGCTTTCTGGAGG - Intergenic
963542383 3:146609146-146609168 CATTTGTAGCAGCCTTTTGAAGG + Intergenic
963687940 3:148461562-148461584 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
963701768 3:148635453-148635475 CAGTTCTAACAGTGTTTTGATGG - Intergenic
964277075 3:155020239-155020261 CTGTAATCCCAGCATTTTGAAGG + Intergenic
964630071 3:158801054-158801076 CTTTACTAACAGAATTTTGAGGG - Intronic
965154366 3:165028047-165028069 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
965290304 3:166869975-166869997 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
965572142 3:170183314-170183336 CTGTTATACCAGCAATTTGGGGG + Intergenic
966049417 3:175595492-175595514 CAGTTCTAGCAGCCTTTCGGTGG - Intronic
966128588 3:176608813-176608835 CTGTACTTACAGCATTTTGAGGG - Intergenic
966476193 3:180349881-180349903 ATGTTTAAGCATCATTTTGAGGG - Intergenic
966900090 3:184476044-184476066 CAGCTCAAGCAGCATTTCGAGGG - Intronic
968338506 3:197934708-197934730 CTGTAATCCCAGCATTTTGAGGG + Intronic
969307086 4:6332096-6332118 GTGTTCTATGAGCATTTTCAGGG - Intronic
970605556 4:17678281-17678303 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
970993928 4:22244120-22244142 CAGTTATAGAAGCCTTTTGATGG + Intergenic
971744618 4:30563690-30563712 TAGTTCTAACAGCATTTTGGTGG - Intergenic
971962194 4:33503499-33503521 CAGTTCTATGAGCATTTTGGAGG + Intergenic
972532335 4:39972620-39972642 CTGTAATCCCAGCATTTTGAGGG - Intronic
972806866 4:42537526-42537548 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
973044113 4:45513507-45513529 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
973342680 4:49021933-49021955 CAGTTCTAGGAGCTTTTTGGTGG + Intronic
973782790 4:54304939-54304961 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
974801439 4:66824046-66824068 CAGTTCTAGGAGCTTTTTGAAGG + Intergenic
974905884 4:68056284-68056306 CTCTTCTAACAGCTTTTTGTTGG - Intronic
975061755 4:70011740-70011762 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
975063326 4:70032277-70032299 GTGTTCTAACAGCATTTCAACGG + Intronic
975126878 4:70792934-70792956 CTTTTCTACGAGCATTTGGAAGG + Intronic
975501777 4:75094484-75094506 GTTTTCTTGTAGCATTTTGAGGG + Intergenic
975534911 4:75439656-75439678 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
975790149 4:77940426-77940448 CAGTTATAGGAGCTTTTTGAAGG + Intronic
975901471 4:79158221-79158243 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
976778459 4:88732032-88732054 GTGTCCTGGCTGCATTTTGATGG + Exonic
976791581 4:88884757-88884779 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
977287002 4:95120521-95120543 CAGTTCTAGTAGTCTTTTGATGG - Intronic
977444934 4:97119024-97119046 CTGTTCTAGGAGCTTTTTGGAGG - Intergenic
977510833 4:97960459-97960481 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
977549667 4:98427475-98427497 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
978158161 4:105513135-105513157 CAGTTCTAGTAGCTTTTTGGAGG + Intergenic
978288050 4:107101417-107101439 CAGTTCTAACAGTTTTTTGATGG - Intronic
979395449 4:120182710-120182732 CAGTTCTAACAGCTTTTTGGTGG - Intergenic
979396496 4:120196014-120196036 CTGTGCTGGCAGCCTTTGGAAGG - Intergenic
979498804 4:121415200-121415222 CTGTTCTAGGAGCTTTCTGGAGG + Intergenic
979507158 4:121511524-121511546 CAGTTCTAGGAGCCTTTTGGAGG - Intergenic
980543745 4:134230010-134230032 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
980595912 4:134953684-134953706 CAGATCTAGGAGCATTTTGGAGG + Intergenic
980885112 4:138753939-138753961 CAGTTCTAGTAGCCTTTTGGTGG + Intergenic
981335278 4:143562420-143562442 CTGTGGAAGCAGCATTTTGTAGG + Intergenic
982040702 4:151393230-151393252 CAGTTCCAGCAGCCTTTTGGTGG - Intergenic
982640708 4:157956291-157956313 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
982708847 4:158739500-158739522 CTGTACTTCCAGCATTTTGGGGG - Intergenic
982800453 4:159699288-159699310 CAGTTCTAACAGTATTTTGGTGG + Intergenic
983862881 4:172730110-172730132 CAGTTCTAACAGTTTTTTGATGG + Intronic
984324096 4:178229552-178229574 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
985198480 4:187459291-187459313 CTGTGCAAACAGGATTTTGAAGG + Intergenic
986444715 5:7811243-7811265 CTGTAATCCCAGCATTTTGAGGG + Intronic
987572275 5:19679564-19679586 CAGTTCTAGGAGCCTTTTGGTGG - Intronic
988107195 5:26767371-26767393 CAGTTCTAGTAGCCTTTTGGTGG + Intergenic
988165672 5:27586542-27586564 CAGTTCTAGTAGCCTTTTGGTGG + Intergenic
988355498 5:30168633-30168655 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
988639704 5:33027945-33027967 CAGTTCTAGGAGCTTTTTGAAGG - Intergenic
989324075 5:40169939-40169961 CTGTTCTAGCAGCCTTTTGATGG - Intergenic
990022872 5:51149715-51149737 CAGTTCCAGTAGCATTTTGGTGG - Intergenic
990307104 5:54504493-54504515 CTGTTCGAGCAGCACCTCGAGGG - Intergenic
990927590 5:61045703-61045725 TTGTTCTAACAGTTTTTTGATGG + Intronic
991093156 5:62712236-62712258 TTGTTGTAGCAGCATTTACATGG - Intergenic
991142435 5:63260370-63260392 CTGTTATAGCAGCATTCTATAGG + Intergenic
991940502 5:71847685-71847707 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
992031051 5:72721808-72721830 CTGTTTTAGTTGCATTTTGAAGG - Intergenic
992695256 5:79279714-79279736 CTGTGCTGTCAGCTTTTTGAGGG + Intronic
993009392 5:82462745-82462767 CAGTTCCAGGAGCCTTTTGAGGG - Intergenic
994289008 5:98004666-98004688 TTGTTCTAGCAGAATTACGATGG - Intergenic
994389412 5:99173472-99173494 CTGTTATCCCAGCATTTTGGAGG + Intergenic
996032303 5:118719478-118719500 CAGTTCTAGCAGCTTTCTGGAGG - Intergenic
996137037 5:119855613-119855635 GTGTTTTAGTAGCATTTTTAGGG + Intergenic
996492932 5:124119821-124119843 CAGTTCTAGGAGCCTTTTGGTGG + Intergenic
998732061 5:145089817-145089839 CAGCTCTAGAAGCCTTTTGATGG + Intergenic
999355309 5:150923681-150923703 CAGTTCTAACAGCTTTTTGGAGG + Intergenic
999484339 5:151980046-151980068 CTGTTCTAGGAGCTTTCTGGAGG + Intergenic
1000027279 5:157370240-157370262 CTGATCTAGAAGCATTTTCTTGG + Intronic
1000252414 5:159508262-159508284 CTGTTGAAGCAGCCTCTTGAGGG + Intergenic
1000592872 5:163179735-163179757 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1000915327 5:167074613-167074635 CAGTTCTGGCTCCATTTTGATGG + Intergenic
1001896925 5:175390432-175390454 CTGTAATCCCAGCATTTTGAGGG + Intergenic
1003994275 6:11523174-11523196 CTTGTCTAGCAGGAGTTTGAAGG + Intergenic
1004098331 6:12582076-12582098 TTGTGCTTGCAGCATTTTGAAGG - Intergenic
1005691192 6:28307657-28307679 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1005697399 6:28364231-28364253 CTGTAATTCCAGCATTTTGAGGG - Intronic
1006487424 6:34354907-34354929 TTGTTCTAGTAGCTTTTTGGTGG + Intronic
1006759258 6:36444623-36444645 CAGTACTAGTAGCATTATGAGGG + Intronic
1007987176 6:46218405-46218427 CTTTTCTCGCAGCATTTCCATGG + Intergenic
1008115863 6:47549313-47549335 CAGTTCTAGGAGCTTTCTGAAGG - Intronic
1008121347 6:47620924-47620946 CAGTTCTAGGAGCTTTCTGAAGG + Intronic
1008234048 6:49022551-49022573 CAGTTCCAGCAGCCTTTTGAGGG + Intergenic
1010045641 6:71440151-71440173 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
1010352800 6:74895516-74895538 TAGTTCTAACAGCTTTTTGATGG + Intergenic
1010840590 6:80645235-80645257 CAGTTCTAGAAGCCTTTTGGAGG - Intergenic
1012027963 6:94021941-94021963 CTGTTCTAGGAGCTTTTTGGAGG + Intergenic
1012786542 6:103635717-103635739 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1013876925 6:114842951-114842973 CAGTTCTAGGAGCCTTTTGGTGG - Intergenic
1013913530 6:115307822-115307844 CAGTTCTAGAAGCTTTTTGGAGG + Intergenic
1014056090 6:117016237-117016259 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1014334963 6:120121996-120122018 CAGTTCCAGGAGCCTTTTGATGG + Intergenic
1014856850 6:126412243-126412265 CTGTAATCTCAGCATTTTGAGGG - Intergenic
1014929219 6:127313458-127313480 CTGTTATCCCAGCATTTTGGGGG - Intronic
1015547493 6:134376489-134376511 CTGTATTACCAGCATTTTGCAGG - Intergenic
1015632408 6:135244970-135244992 CTGTACTAGAAGTATTTTAAAGG - Intergenic
1015849354 6:137555697-137555719 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1015871937 6:137784593-137784615 CTGTGATCTCAGCATTTTGAGGG + Intergenic
1016221211 6:141672062-141672084 CTGTTCCAGGAGCCTTTTGGAGG - Intergenic
1016509715 6:144827928-144827950 CTGTACAAGCAGGATTTAGATGG + Intronic
1016511381 6:144847047-144847069 GTGTTCTAACAGCTTTTTAATGG + Intronic
1017214553 6:151895277-151895299 CAGTTCTAGGAGCTTTTTGGGGG + Intronic
1018168402 6:161123110-161123132 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1020352307 7:7234147-7234169 CTGTTTTAGCAGCAAATAGAGGG + Intronic
1020551260 7:9607933-9607955 CTGTTCTGGGAGCCTTTTGGAGG - Intergenic
1020946037 7:14608690-14608712 CAGTTCTAACAGCCTTTTGGTGG - Intronic
1021348323 7:19555907-19555929 CTGTTCTAGAAGCCTTCTGGTGG - Intergenic
1021779560 7:24089572-24089594 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1023185258 7:37526329-37526351 TTTTTCCAACAGCATTTTGAAGG - Intergenic
1023222601 7:37934684-37934706 CTGTAATACCAGCATTCTGAGGG + Intronic
1024663831 7:51525657-51525679 CAGTTCTAACAGCTTTTTGGTGG - Intergenic
1025162067 7:56669920-56669942 CTGTAATCCCAGCATTTTGAGGG + Intergenic
1025820896 7:64962349-64962371 TGGTTCTAGGAGCTTTTTGAAGG - Intergenic
1027295778 7:76768294-76768316 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1028413341 7:90554393-90554415 CAGTTCTAGGAGCATTTTGGTGG - Intronic
1028529316 7:91820862-91820884 CAGTTCTAGAAGCTTTTTGGAGG + Intronic
1028725573 7:94083675-94083697 CATTTTTAGCTGCATTTTGAAGG + Intergenic
1028961876 7:96758029-96758051 CAGTTCTAGGAGCATTCTGGGGG + Intergenic
1030390097 7:108917226-108917248 CAGTTCTAGGAGCTTTCTGAAGG + Intergenic
1031139340 7:117924489-117924511 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1031655103 7:124345338-124345360 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1031698538 7:124892973-124892995 GTGTTCTAGTTGCATTTTCAGGG - Intronic
1031888241 7:127263069-127263091 CTGTTTTAGCAGCATGTGGAGGG + Intergenic
1034338399 7:150337800-150337822 CTGTCCTTGCAGCATGTGGAGGG - Exonic
1035445431 7:158938498-158938520 CTGTAATCGCAGCACTTTGAAGG + Intronic
1036539933 8:9696560-9696582 CAGTTCTAGCAGCCTTTTGGTGG - Intronic
1037064453 8:14559240-14559262 CAGTTCTAGGAGCTTTTTGGAGG - Intronic
1037240014 8:16766479-16766501 GCGCTCTAGTAGCATTTTGAAGG - Intergenic
1037308579 8:17530827-17530849 CTGTACTACCAGCACTTTGGGGG - Intronic
1037320477 8:17636995-17637017 CAGTTCTAGCAGCTTTTTGGAGG + Intronic
1038058198 8:23882055-23882077 CTGTAATACCAGCACTTTGACGG - Intergenic
1038079470 8:24117407-24117429 CTGTAATCCCAGCATTTTGAGGG - Intergenic
1038909092 8:31941652-31941674 CAGTTCTAGGAGCTTTTTGGTGG - Intronic
1039206042 8:35156180-35156202 CACTTCTAGAAGCCTTTTGATGG - Intergenic
1039582235 8:38676313-38676335 ATTTTCTCTCAGCATTTTGAAGG - Intergenic
1040064321 8:43132771-43132793 GAGTTCTAGTAGCTTTTTGATGG + Intergenic
1040507637 8:48065119-48065141 CTGTTATCCCAGCATTTGGAAGG - Intergenic
1041616397 8:59912143-59912165 CAGTTCTAGTAGTATTTTGGTGG - Intergenic
1042371490 8:67996449-67996471 CTATAATAGCAGCACTTTGAGGG - Intronic
1042768102 8:72348850-72348872 CAGTTCTAGCAGCTTTTTGGAGG + Intergenic
1042921435 8:73923850-73923872 CTGTCATCTCAGCATTTTGAGGG - Intergenic
1043133699 8:76493908-76493930 CAGTTCTAGCAGTTTTTTCATGG + Intergenic
1043836040 8:85047521-85047543 CAGTTCTAGTAGCCTTTTGGTGG + Intergenic
1044269311 8:90222178-90222200 CTGTGTTTGCAGCATTTTGCAGG + Intergenic
1044372737 8:91432425-91432447 CTATTAGAGCTGCATTTTGAGGG - Intergenic
1044704847 8:94998760-94998782 CTGCTTGAGCAGCATCTTGAAGG + Intronic
1044787905 8:95815293-95815315 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1045726669 8:105181922-105181944 CAGTTCTAGGAGCCTTTTGGTGG + Intronic
1046467457 8:114624747-114624769 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1046712225 8:117522931-117522953 CTGTTATAGGAGCAGTTTTAAGG + Intronic
1047394003 8:124477564-124477586 CAGTTGTAGCACCATTTTGTAGG - Intronic
1047559077 8:125966787-125966809 CTGTTCTTGTTGCATCTTGAGGG + Intergenic
1047807994 8:128379227-128379249 CTGTCCTAGGACCACTTTGATGG + Intergenic
1049966049 9:780859-780881 TAGTTCTAACAGCATTTTGGTGG - Intergenic
1050680079 9:8100781-8100803 CAGTTCCAGGAGCCTTTTGATGG + Intergenic
1050920902 9:11199468-11199490 CTGTTCAAGCAGCAGGCTGAGGG - Intergenic
1051316569 9:15840552-15840574 TTGTTATAGCAGCATCATGATGG + Intronic
1052560112 9:30074696-30074718 CTGTTCTAGCCACAGTTTCAAGG + Intergenic
1055345975 9:75339444-75339466 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1056985308 9:91358714-91358736 CTGTGTTAGAAACATTTTGATGG - Intronic
1058705609 9:107635848-107635870 CTGGTCTAGGAGCACCTTGAAGG - Intergenic
1058727292 9:107816454-107816476 CTGTTCTGCCAGTATTCTGAAGG + Intergenic
1059468240 9:114483277-114483299 CTGTTCCTGCAGGATTCTGATGG - Intronic
1059807545 9:117819437-117819459 TAGTTCTAGAAGCCTTTTGATGG + Intergenic
1059893488 9:118832777-118832799 CTGTTCTTGCAACATCTTGTAGG + Intergenic
1187647640 X:21366101-21366123 CAGTTCTAGTAGCCTTTTGGTGG + Intergenic
1188701241 X:33267102-33267124 CAGTTCTAGTAGCCTTTTGGTGG - Intronic
1189835388 X:45015546-45015568 ATGTTCTTACAGCTTTTTGATGG + Intronic
1189878794 X:45467363-45467385 CAGTTCTAGGAGCTTTTTGAAGG + Intergenic
1189932100 X:46023632-46023654 CAGTTCTAGGAGCTTTTTGAAGG - Intergenic
1190531475 X:51382522-51382544 CAGTTCTAGGAGCCTTTTGGTGG - Intergenic
1190742506 X:53299167-53299189 CTGTAATCCCAGCATTTTGAGGG - Intronic
1191159716 X:57316011-57316033 CAGTTTTAGTAGGATTTTGATGG - Intronic
1191164584 X:57374589-57374611 CAGTTCTAGGAGCTTTTTGCAGG + Intronic
1191834715 X:65452292-65452314 CAGTTCTAGCAGCTTTTTGGAGG - Intronic
1191950784 X:66589937-66589959 CAGTTCTAGGAGCATTCTGGAGG + Intergenic
1191954522 X:66629451-66629473 CAGTTCTAGGAGCTTTCTGAGGG - Intronic
1191994405 X:67076057-67076079 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
1192672881 X:73165297-73165319 CAGTTCTAGGAGCTTTTTGAAGG + Intergenic
1193015713 X:76731384-76731406 CAGTTCTAGGACCTTTTTGAAGG - Intergenic
1193078294 X:77379090-77379112 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1193950639 X:87793644-87793666 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1193989827 X:88292759-88292781 CAGTTCTAGTAGCTTTGTGATGG - Intergenic
1194218095 X:91156569-91156591 CAGTTCTAGTAGCCTTTTGGTGG - Intergenic
1194883101 X:99278738-99278760 CAGTTTTAGCAGCTTTTTGCTGG - Intergenic
1195796116 X:108649001-108649023 CAGTTCTAGCAGCTTTCTGGAGG - Intronic
1195930953 X:110075338-110075360 CAGTTCTAGGAGCCTTTTGTTGG + Intronic
1196613249 X:117737787-117737809 CTGTTTTGGCATCATTTTGTAGG + Intergenic
1196642543 X:118079401-118079423 CAGTTCTAGTAGCGTTTTGGTGG - Intronic
1197435266 X:126420279-126420301 CAGTTCTAATAGCATTTTGGTGG + Intergenic
1197911333 X:131485936-131485958 CAGTTCTAGGAGCTTTTTGGAGG - Intergenic
1198510646 X:137347777-137347799 CAGTTCTAGGAGCTTTCTGAAGG - Intergenic
1198569059 X:137935626-137935648 CAGTTCTAGGAACATTTTGGAGG - Intergenic
1198601176 X:138285718-138285740 CTCTTCTATCAGCATTCTAAAGG + Intergenic
1198910482 X:141607676-141607698 CAGTTCTTGCAGCAATTTGAAGG + Intronic
1198940363 X:141948167-141948189 TTGTTCTAACAGCTTTTTGGTGG + Intergenic
1199325774 X:146496245-146496267 CAGTTCTAATAGCATTTTGGTGG - Intergenic
1199821369 X:151451810-151451832 CAGTTCTAGGAGCTTTTTGGAGG + Intergenic
1200419590 Y:2950305-2950327 CTGTAATCCCAGCATTTTGAGGG - Intronic
1200554607 Y:4620358-4620380 CAGTTCTAGTAGCCTTTTGGTGG - Intergenic
1201471775 Y:14342627-14342649 CTGTCCTAGGAACATTTTGATGG + Intergenic
1201621137 Y:15959660-15959682 CTGTTCTAACTGCAATTAGATGG - Intergenic