ID: 1107586178

View in Genome Browser
Species Human (GRCh38)
Location 13:41850541-41850563
Sequence GGCTCTGAAGCCTGAGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 467}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107586178_1107586181 1 Left 1107586178 13:41850541-41850563 CCATGAACTCAGGCTTCAGAGCC 0: 1
1: 0
2: 3
3: 50
4: 467
Right 1107586181 13:41850565-41850587 CCCTCAGAGACTTAGTTGATAGG 0: 1
1: 0
2: 0
3: 5
4: 59
1107586178_1107586186 30 Left 1107586178 13:41850541-41850563 CCATGAACTCAGGCTTCAGAGCC 0: 1
1: 0
2: 3
3: 50
4: 467
Right 1107586186 13:41850594-41850616 CACCTGCAGAGTCAGGCACCAGG 0: 1
1: 1
2: 6
3: 53
4: 358
1107586178_1107586183 23 Left 1107586178 13:41850541-41850563 CCATGAACTCAGGCTTCAGAGCC 0: 1
1: 0
2: 3
3: 50
4: 467
Right 1107586183 13:41850587-41850609 GCCCACTCACCTGCAGAGTCAGG 0: 1
1: 1
2: 1
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107586178 Original CRISPR GGCTCTGAAGCCTGAGTTCA TGG (reversed) Intronic
900933519 1:5751253-5751275 GGCTTTGCAACCTGAGCTCACGG + Intergenic
901324980 1:8360524-8360546 GGCTCTGAGGCATGAGTTGCAGG + Exonic
901726074 1:11243178-11243200 GGCTGTGAGGTCTGAGTTTAAGG - Exonic
902559275 1:17266917-17266939 GACTCTGAGGCCAGAGTCCAGGG + Intronic
902568573 1:17331989-17332011 GGTTCAGAAGTCTGAGGTCAAGG + Intronic
902649906 1:17830208-17830230 AGCTCTGAAGCCAGACTTCATGG + Intergenic
903275129 1:22216746-22216768 GTCTCTGAAGGCTGACATCAAGG + Intergenic
903668726 1:25023078-25023100 GGCTCTGTAGCCTGAGAACCTGG + Intergenic
903911888 1:26733385-26733407 GGCTCTAGAGCCAGAGTTCCTGG + Intronic
904168981 1:28577939-28577961 CACACTAAAGCCTGAGTTCAAGG + Exonic
905388265 1:37619343-37619365 GACTCTGAAGCCTGAGCTCTGGG - Intronic
906109236 1:43312286-43312308 GGCTCTGGGGCCAGAGGTCAGGG - Exonic
906441025 1:45844877-45844899 GGCTCAGAAGCCCAAGATCAAGG + Intronic
907124332 1:52035883-52035905 GGCTCTGAAGCCAGAGTGCTTGG + Intronic
907311601 1:53542011-53542033 GGCTCAGAGGCCTCTGTTCAAGG + Intronic
907973080 1:59403785-59403807 GGCTCTGGAGCCAGACTGCATGG + Intronic
908512734 1:64862175-64862197 GGCTCTAGAGCCTGAGCTGAGGG - Intronic
908646325 1:66281977-66281999 GGCTCAGAAGCCTGTGTACTTGG + Intronic
909103854 1:71384365-71384387 TGCTCTGAAGCGTGAGTCCCAGG + Intergenic
909476021 1:76081735-76081757 GGCCCTGAAGCTTGCGTTCAGGG - Intronic
909745715 1:79094944-79094966 GGCTCTGCTGCCTGAATTTAAGG + Intergenic
910487883 1:87735982-87736004 GGCTCTGGAGCCAGACTGCATGG + Intergenic
910798807 1:91124650-91124672 GGCACTGAAGCCTGCTTTAATGG + Intergenic
911196177 1:94997548-94997570 GGCTCTGGAGCCTGACTGCCTGG + Intronic
911794323 1:102057591-102057613 GTCTCAGACTCCTGAGTTCAGGG - Intergenic
912454679 1:109789536-109789558 GGCTCTGAAGCCTGACGCCTGGG + Intergenic
912867946 1:113275747-113275769 GGTTCTTCAACCTGAGTTCAAGG - Intergenic
916311071 1:163399336-163399358 GGCTTTCAATCCTGACTTCATGG + Intergenic
917039773 1:170792070-170792092 GACTACGAAACCTGAGTTCATGG + Intergenic
917373065 1:174317018-174317040 TGCCCTGAAGCCTGAGTCCCAGG - Intronic
917869872 1:179231626-179231648 GGCTCTGAAGCCAGACTGCTTGG + Intergenic
917948636 1:180004832-180004854 AGCTCTGAGGACTGAGGTCAAGG - Intronic
918384251 1:183989368-183989390 GCCTCTGAAACATGAGGTCATGG + Intronic
921741206 1:218687274-218687296 TGCTGGGAAGCCTGAGATCAAGG + Intergenic
922796797 1:228343518-228343540 GGCTCTCAAGCCTGGGTGCTTGG - Intronic
923114203 1:230919296-230919318 GGCTGGGAAGTCTGAGATCAAGG + Intronic
923233396 1:232009777-232009799 AGCTCTGAAGACTCAGGTCATGG - Intronic
923725077 1:236498532-236498554 GCCTCTGACTCCTGAGTTCAAGG - Intergenic
924127854 1:240874373-240874395 GGATCAGAGGCCTCAGTTCATGG - Intronic
924177169 1:241403026-241403048 GGCTGGGAAGTCTGAGATCAAGG - Intergenic
924535050 1:244928341-244928363 TGCTTTGAAGGCTGAGTACAGGG + Intergenic
1063707435 10:8444447-8444469 CCCTCTGAAGCCTGCTTTCAGGG - Intergenic
1063757867 10:9035881-9035903 GGCTCTGGAGCCAGACTGCATGG + Intergenic
1064573989 10:16725721-16725743 GGCTGGGAAGCCTGAGATCAAGG - Intronic
1064971478 10:21071573-21071595 GTCTCTGAGGGCTGAGTTAAGGG - Intronic
1065387972 10:25152435-25152457 GGCTGTGAAGTCCAAGTTCAAGG + Intergenic
1065997099 10:31069450-31069472 GTAACTGAAGCCTGAGGTCAGGG - Intergenic
1067703534 10:48590358-48590380 GGATGTGGAGCCTGAGCTCAGGG + Intronic
1067844542 10:49709446-49709468 GGCTCTGAAGCCAGAGGTTCAGG - Exonic
1069468366 10:68662497-68662519 GGCTATGAAGAGTGAATTCATGG - Intronic
1069689307 10:70339427-70339449 GGCTCTGAAGCCTGGTCTCCAGG + Intronic
1069801036 10:71081696-71081718 GGCTGTAAAGTCTGAGATCAAGG + Intergenic
1070630562 10:78081739-78081761 GGCTGGGAAGGCTGAGTGCAGGG + Intergenic
1070685814 10:78480027-78480049 GGCTCTGGAGCCTGATGTCCTGG - Intergenic
1071424078 10:85530851-85530873 GGCTCTCCAGCCTTAGCTCAGGG + Intergenic
1071888437 10:89976379-89976401 AGCTCTGAAGCCTGTGCACAGGG - Intergenic
1072825072 10:98598581-98598603 GTGACTGAAGCCTGAGCTCATGG + Intronic
1072825179 10:98599025-98599047 GGTCCTGAAGCCTGGGTCCACGG + Intronic
1073713307 10:106071240-106071262 GGCTGAGAAGCCCAAGTTCAAGG + Intergenic
1074964197 10:118474270-118474292 GGCTCTGATGACTGAGTCAATGG - Intergenic
1075747959 10:124741388-124741410 GGCCCTGAAGACTGAGTTCTGGG - Intronic
1076106027 10:127824370-127824392 GGCTCTGCCTCCTGGGTTCAAGG + Intergenic
1078107214 11:8365860-8365882 GGTGCTGAAGCCCGAGTTCCAGG - Intergenic
1078522580 11:12075231-12075253 TGGATTGAAGCCTGAGTTCAAGG + Intergenic
1079649386 11:22908050-22908072 GGCTGGGAAGCCTGAGAGCATGG - Intergenic
1081152463 11:39648676-39648698 AGCTATGAAGCCTGAGTGCTGGG - Intergenic
1081394466 11:42569391-42569413 GGCTGGGAAACCTGAGATCACGG + Intergenic
1081961248 11:47139210-47139232 GGCTCTGAAGACAGAGTTGGAGG + Intronic
1083792028 11:64991999-64992021 GGCGATGAAGCCTGAGCTTAAGG - Intronic
1085299109 11:75448190-75448212 TGCTAAGAAGCCTGGGTTCAAGG + Intronic
1085414728 11:76312460-76312482 GGCTCTGAAGCAGGAGTTTGAGG + Intergenic
1086944278 11:92829648-92829670 TGCTCTGAAGCCTTATTTCAAGG + Intronic
1086970477 11:93075445-93075467 GGCTGGGAAGTCTAAGTTCAGGG - Intergenic
1087989566 11:104731775-104731797 AGCTCTGAAGCCAGAGTGCCTGG - Intergenic
1088696082 11:112366928-112366950 GGCTGAGAAGTCTGAGGTCAAGG - Intergenic
1088974459 11:114803454-114803476 GGCTGAGAAGCCTGAGACCAAGG + Intergenic
1089057251 11:115595847-115595869 GGATGTGAAGCCTGTGTACATGG + Intergenic
1089462366 11:118660701-118660723 GGCTCTGTGGGCTGAGCTCAAGG - Exonic
1089868352 11:121651390-121651412 GGCTGGGAAGTCTGAGATCAAGG + Intergenic
1089896570 11:121935886-121935908 GGCCCAGAAGTCTGAGATCAAGG - Intergenic
1090598332 11:128343145-128343167 GGCCGTGAAGGCTGAGTTCAGGG - Intergenic
1091223572 11:133944983-133945005 GGCCCAGAAGCCTGAGAACAAGG + Intronic
1091274196 11:134338930-134338952 GGCACTGAGCACTGAGTTCAGGG + Intronic
1091370765 11:135056252-135056274 GGGTCAGAAGCCTGAATTCCAGG + Intergenic
1091522506 12:1260962-1260984 GGCTGTGAACACTGAGCTCATGG + Intronic
1091799059 12:3313398-3313420 GGCTCTGCAGCCAGAATTCCTGG - Intergenic
1091892799 12:4073975-4073997 GGCTGGGAAGTCTGAGATCAGGG - Intergenic
1092619878 12:10252217-10252239 GTCTCAAAATCCTGAGTTCAAGG - Intergenic
1093189610 12:16058894-16058916 GCCTGTGAAGCCTGATTGCATGG - Intergenic
1093600298 12:21013482-21013504 GGCTGGGAAGTCTGAGATCAGGG + Intergenic
1094023559 12:25939868-25939890 GGCTTTGAAGCCAGACTTCCTGG + Intergenic
1094224953 12:28034403-28034425 CCCTCTGAAGCCTGACTTCCTGG - Intergenic
1094376849 12:29799881-29799903 GGATCAGCAGCCAGAGTTCAAGG + Intergenic
1095347537 12:41169230-41169252 GCCACTGAAGTCTGAGTTCATGG + Intergenic
1095471616 12:42543098-42543120 GACTGGGAAGCCTGAGATCAGGG - Intronic
1095715914 12:45345878-45345900 GGCTGGGAAGTCTGAGATCAAGG + Intronic
1096237550 12:49939965-49939987 GGCCCTGGAGCCTGAGCTCTGGG - Intergenic
1096536313 12:52277413-52277435 GGCTCTGCAGCCTCAGAGCAAGG + Intronic
1096567966 12:52496855-52496877 GCTCCTGAAGCCTGAGCTCATGG + Intergenic
1096618487 12:52847941-52847963 GGCTCTGGATGCTGAGTTGAAGG - Exonic
1097574150 12:61370269-61370291 GGCTGGGAAGTCTAAGTTCAGGG - Intergenic
1099694678 12:86002881-86002903 GCCTCGGATTCCTGAGTTCAAGG + Intronic
1102239274 12:111313898-111313920 GGCTTTGAAACCGGAGTCCAGGG - Intronic
1102868324 12:116392130-116392152 GGCTCTGAAGGCTCAGTCAAAGG - Intergenic
1103142604 12:118562795-118562817 GGCTCTGAAGCCGGACTTTCTGG - Intergenic
1103447147 12:121001786-121001808 GGCTCTAACGCCTGAGCCCAGGG + Exonic
1103732751 12:123038756-123038778 CTCTCTGAAGCATGAGTTTAGGG + Intronic
1103821021 12:123698868-123698890 GGTTTTGAGGCCTGAGTCCATGG + Intronic
1103887626 12:124214726-124214748 GGGTAAGAAGCCTGATTTCATGG - Intronic
1104112540 12:125717365-125717387 AGCTCAGAAGTCTGAGGTCAAGG + Intergenic
1104709234 12:130973690-130973712 GGACATGAAGCCCGAGTTCATGG - Intronic
1104747140 12:131217804-131217826 GACTCTGAAACTTTAGTTCATGG + Intergenic
1106068674 13:26384968-26384990 AGCTCTGCTGCCTGAGGTCAGGG - Intronic
1106719002 13:32419908-32419930 GGCTCAGCAGCCTGAGAGCAGGG + Intronic
1107222595 13:38003127-38003149 GGGAGTGAAGCCAGAGTTCAAGG - Intergenic
1107299591 13:38950931-38950953 GGCTGGGAAGTCTGAGATCAAGG - Intergenic
1107586178 13:41850541-41850563 GGCTCTGAAGCCTGAGTTCATGG - Intronic
1107990033 13:45811713-45811735 CGTTCTGAAGTCAGAGTTCAGGG + Intronic
1108511099 13:51156508-51156530 GGCTCTGAAGACAGATTTCCTGG - Intergenic
1108592804 13:51925766-51925788 GGCACTGAAGTGTGATTTCATGG - Intergenic
1110263118 13:73508459-73508481 AGCTCAGAAGTCAGAGTTCATGG - Intergenic
1111513733 13:89299267-89299289 GCATCTGGAGTCTGAGTTCAAGG - Intergenic
1111904673 13:94241221-94241243 GGCTGGGAAGTCTGAGATCAAGG - Intronic
1112129305 13:96503865-96503887 GGCTGGGAAGTCTGAGATCAAGG + Intronic
1112166614 13:96926910-96926932 GACTCTGAAGCCAGACTGCATGG - Intergenic
1112266792 13:97931834-97931856 GGCTGGGAAGCCTCAGGTCAAGG + Intergenic
1113627948 13:111860156-111860178 GTTTCTGAAGCCTGAATTCAAGG + Intergenic
1114485799 14:23061028-23061050 GGCACTGAGGCTTGAGGTCAGGG - Intronic
1114647976 14:24266294-24266316 GGCTCTGTAGTGTGAGTTGAAGG - Intronic
1114931059 14:27467132-27467154 GGACCTGAAGCCTGGGTCCATGG - Intergenic
1116815409 14:49579287-49579309 GGCTAGGAAGTCTGAGATCAAGG - Intronic
1117494066 14:56284438-56284460 GGCCCTGCAGCCGGTGTTCAGGG + Intronic
1118792988 14:69112872-69112894 GGCTCTGAAGCCATACTTCTTGG - Intronic
1119524882 14:75314987-75315009 GTCTCTAACTCCTGAGTTCAAGG + Intergenic
1119995008 14:79243910-79243932 GGATCTGGAGCCTGAGAGCAGGG - Intronic
1120186405 14:81397941-81397963 GGCTCTGGAGCCAGAGTGCTTGG - Intronic
1120954793 14:90072318-90072340 CGGTCTGACCCCTGAGTTCATGG - Intronic
1121734275 14:96206871-96206893 GGCTGGGAAGCCCGAGATCAAGG + Intronic
1122685741 14:103505214-103505236 GGGCCTGAGGCCTGAGTGCATGG + Intergenic
1123624866 15:22220061-22220083 GTCTCAAAATCCTGAGTTCAAGG - Intergenic
1126410104 15:48364702-48364724 GGCTTTGATGTCTGTGTTCATGG + Intergenic
1126992775 15:54401802-54401824 GTCCCTGAAGCCTGACTCCAGGG + Intronic
1127259379 15:57317084-57317106 GGCACTGAGGCCTGAGAACAAGG - Intergenic
1127668548 15:61172528-61172550 GGCTCTCAAAACAGAGTTCAAGG + Intronic
1128217962 15:65947292-65947314 GGCACTGAAGCTTGAGCGCAGGG + Intronic
1128243261 15:66115911-66115933 GGCTCAGAAGTCTGAGATCCAGG - Intronic
1128876230 15:71203581-71203603 ACCTCTGACTCCTGAGTTCAAGG - Intronic
1130103366 15:80910988-80911010 GGCTCTGGAGCCAGACTTCCTGG + Intronic
1130137420 15:81193134-81193156 GGCTCTGAAGCCAAAATTCCTGG - Intronic
1130157492 15:81364207-81364229 TGCTCTCTAACCTGAGTTCAAGG - Intronic
1130422486 15:83762458-83762480 GGCTGGGAAGTCTGAGTTCAAGG + Intronic
1130794322 15:87192946-87192968 GGCTGGGAAGTCTGAGATCATGG + Intergenic
1133091224 16:3405386-3405408 GGCTAGGAAGTCTGAGTTCAAGG + Intronic
1134127914 16:11629188-11629210 GGCTCAGAAGGCTGAGCGCAGGG + Intronic
1134569440 16:15278946-15278968 GGCTGGGAAGTCTGAGATCAGGG + Intergenic
1134732937 16:16477103-16477125 GGCTGGGAAGTCTGAGATCAGGG - Intergenic
1134871618 16:17657164-17657186 TTTTCTGAAGCCTGAGATCAGGG - Intergenic
1134900964 16:17937538-17937560 GGCTCTGAAGCCAGACTTTCTGG - Intergenic
1134934502 16:18234868-18234890 GGCTGGGAAGTCTGAGATCAGGG + Intergenic
1135331406 16:21563062-21563084 GGCTGGGAAGTCTGAGATCAGGG - Intergenic
1135463844 16:22668588-22668610 GGCTCTGGAGCCAGACTTCCTGG - Intergenic
1135591383 16:23707282-23707304 GGCTCTGGAGCCTGACTGCCTGG - Intronic
1135792411 16:25409301-25409323 AGCTCTGAAGCCAGACTGCATGG - Intergenic
1136409711 16:30069186-30069208 GGCTTTGAAGCCTGAGTCCCTGG + Intronic
1137626080 16:49909639-49909661 GGCTGGGAAGTCTGAGATCAGGG + Intergenic
1137688995 16:50407324-50407346 GGCTCTGAAGCCAGACTTCCTGG - Intergenic
1137729389 16:50678860-50678882 GACTCTGAAGCCTCAGCTCAGGG + Intronic
1138085072 16:54126110-54126132 GGCTCTGGAGCCAGAGTGCCTGG - Intergenic
1139954522 16:70686736-70686758 GTCTCTGCTGCCTGAGTCCACGG + Intergenic
1140570748 16:76103802-76103824 TGATCTGGAGCCTCAGTTCATGG + Intergenic
1141427802 16:83955015-83955037 GGCTCTGTAGCCTCAGGGCACGG + Intronic
1142175319 16:88642561-88642583 GGCTCTGAAGTGTGAGTTGCTGG + Intergenic
1142664855 17:1456578-1456600 GGCCCTGGGGCCTGAGTTCTCGG + Intronic
1143128992 17:4664250-4664272 GGCCCAGAAGCCTGAGATCTTGG + Intergenic
1143860793 17:9889413-9889435 GGCTCTGCAGCCTGAGTGGCGGG - Exonic
1145797220 17:27662701-27662723 GGGTCTGAGCCCTGAGCTCATGG - Intergenic
1146576845 17:34001553-34001575 GGGTCTGAAGCCTGAGTCCCTGG + Intronic
1146673669 17:34758539-34758561 GGCTCTGCAGCCTGGGTGCTGGG + Intergenic
1148543731 17:48501172-48501194 TGCTCTGAACGCTGAGTCCAGGG + Intergenic
1149029885 17:52070560-52070582 GCCTCTGAAGTCAGAGTTGATGG - Intronic
1149592721 17:57843710-57843732 GGCTAGGAAGTCTGAGATCAGGG - Intronic
1150724785 17:67642913-67642935 TGCTCTGAACACTGAGTTCTGGG - Intronic
1150742824 17:67793216-67793238 GGCTCTGAAGCCAGATTTCCTGG - Intergenic
1151239185 17:72744593-72744615 GGCTGAGAAGTCTGAGATCAAGG + Intronic
1151331476 17:73411687-73411709 GGCTCTGAGGTCTGTGTTCCAGG + Intronic
1152072661 17:78141673-78141695 GGCTCTGGAGCCCGAGTGCCTGG - Exonic
1152163035 17:78681374-78681396 ACCTCTGAAGCCTCAGTTCTGGG + Intronic
1153045963 18:856160-856182 GCCTCCCAAGCCTGAATTCAAGG + Intergenic
1153331604 18:3880103-3880125 GGGTCTGGAGCCTGACTTCCGGG - Exonic
1153432003 18:5027941-5027963 GGCTGGGAAGCCTAAGATCAAGG - Intergenic
1153519840 18:5941253-5941275 GGCTCTGAAGTCCAAGATCAAGG - Intergenic
1156526899 18:37776310-37776332 AGCTCTGAGCCCTGAGTCCAGGG + Intergenic
1156684601 18:39629411-39629433 GGTCCTGGAGCCAGAGTTCAGGG - Intergenic
1157411437 18:47466268-47466290 GGCTCTGGAGTCTGAATCCATGG + Intergenic
1158623297 18:59050567-59050589 GGCTCTGAAGACTCAGTAAAAGG + Intergenic
1160262555 18:77308455-77308477 GGCTCTGAAGTCAGACTTCCTGG + Intergenic
1161369596 19:3903314-3903336 GGCTCTGAAGCCCCAGATCCCGG + Intronic
1161735218 19:5988049-5988071 GACTCTGAACCCTGCGTTGAAGG - Intergenic
1162243461 19:9378410-9378432 GGCTGTGAAGCTTCAGGTCAGGG - Intronic
1162481218 19:10928203-10928225 GGGTTTGAGGTCTGAGTTCAGGG + Intronic
1162847082 19:13401245-13401267 GGCTCTGCAGCCAGATTTCCTGG + Intronic
1164061153 19:21675480-21675502 CCCTCTGACTCCTGAGTTCAAGG + Intergenic
1164157162 19:22603754-22603776 GGCTCAGAAGCCTGATCTCTCGG + Intergenic
1165352121 19:35281323-35281345 GGCACTGAAGGCAGAGATCAGGG - Intronic
1166295585 19:41887822-41887844 GGCTCAGGAGCCTGGGTCCATGG - Intronic
1166645847 19:44531111-44531133 GGCTCTGGAGCCAGAGTGCATGG + Intergenic
1168646463 19:58062117-58062139 GGCTGGGAAGCCTAAGATCAAGG + Intronic
925051674 2:820388-820410 GGTACTGAGGGCTGAGTTCAGGG - Intergenic
925051690 2:820516-820538 GGCACTGAGGGCTGAGTGCAGGG - Intergenic
925051695 2:820549-820571 GGCACTGAGGGCTGAGTGCAGGG - Intergenic
926252328 2:11162184-11162206 GGCTCTGCAGCCTGTGTCTATGG + Intronic
926889742 2:17629004-17629026 GGCTCTGAGCCCTGTGTTGAAGG - Intronic
927569064 2:24142061-24142083 GGCTCTGCAGGCTGGGTTCCTGG + Intronic
928047718 2:27954083-27954105 GGCACAGAAGCCTGAGTTTGTGG + Intronic
928245959 2:29627104-29627126 GGCTCTGAAGCCAGGGCTGACGG + Intronic
928300032 2:30116868-30116890 GGCCCTGAAGCCAGAGTCCTGGG + Intergenic
928307149 2:30179559-30179581 GGCTGGGAAGCCTGAGATCAGGG + Intergenic
929090711 2:38214497-38214519 GGCCCAGAAGCCTGTGTTGAAGG - Intergenic
929232006 2:39569620-39569642 AGCTCTGAAGACTGGGATCAAGG - Intergenic
929388715 2:41442809-41442831 AGCTCTGCAGCCTGAGATTAGGG + Intergenic
929787012 2:45000618-45000640 GGCTCTGGGCCCTGAGGTCAGGG - Intergenic
930605961 2:53493248-53493270 GGCTGTGAAGTCTAAGATCAAGG - Intergenic
930725092 2:54674639-54674661 GGCTCTGAAGCCAGATTGAATGG + Intergenic
931379132 2:61735938-61735960 GGTGCTGAGGCCAGAGTTCAGGG - Intergenic
932095220 2:68841269-68841291 AGCTCTCAAACCTCAGTTCACGG - Intergenic
933783648 2:85820268-85820290 GGCTGTGAAGTCCGAGATCAAGG + Intergenic
934789282 2:97044591-97044613 GGCCCTGGAGCCTGGGTTTAGGG - Intergenic
934817197 2:97337950-97337972 GGCCCTGGAGCCTGGGTTTAGGG + Intergenic
934820499 2:97370534-97370556 GGCCCTGGAGCCTGGGTTTAGGG - Intergenic
935271868 2:101441535-101441557 GGCTGAGAAGTCTAAGTTCAAGG - Intronic
935802657 2:106714301-106714323 GTCTCTGAAGCCAGAGCTTAAGG - Intergenic
936417086 2:112325609-112325631 AGATCTGAAGCTAGAGTTCAAGG + Intronic
936753081 2:115670014-115670036 GGCTGGGAAGTCTGAGGTCAAGG + Intronic
937157161 2:119729373-119729395 GGCTCGGAAGCCTGAAGTGATGG + Intergenic
937730613 2:125224525-125224547 GGCTCTGAAACATGGGTTCTTGG + Intergenic
938568555 2:132541895-132541917 GGCTGGGAAGTCTGAGATCAGGG + Intronic
938956756 2:136306049-136306071 GACTCTGAAGCCTGTCTTCCTGG + Intergenic
940022006 2:149165742-149165764 GACTCTGAAGCCTGACCTCCTGG - Intronic
940580646 2:155575226-155575248 GGCTTGGAAGCCTAAGATCAAGG - Intergenic
940766749 2:157797993-157798015 GGCTGGGAAGTCTAAGTTCAAGG - Intronic
942275048 2:174315179-174315201 GGCTGAGAAGTCTGAGATCAAGG + Intergenic
943505424 2:188750399-188750421 GGCTGTGAAGCCCAAGATCAAGG - Intronic
944373233 2:199011171-199011193 GGATGTAGAGCCTGAGTTCATGG + Intergenic
945666069 2:212744224-212744246 GGCTGGGAAGCCTAAGATCAAGG - Intergenic
946031262 2:216707011-216707033 GCCACTGAAGCCTGAATTAAGGG + Intergenic
946124700 2:217552392-217552414 GGCTCTGCAGACTGTGTTAAAGG + Intronic
946838930 2:223800444-223800466 GTCACTTAAGCCTGAGTTCAAGG + Intronic
948398281 2:237663529-237663551 GGCTGTGAAGCCCAAGATCAAGG - Intronic
948809336 2:240466817-240466839 GGCTCTGCAGCCTGCGCTGAGGG - Exonic
1169350273 20:4863101-4863123 AGCCCTGAGGCCTGAGTGCAGGG - Intronic
1169452277 20:5722207-5722229 GACTCTGAAGCCAGAGTTCATGG + Intergenic
1169636548 20:7698452-7698474 GGCTGGGAAGTCTAAGTTCAAGG - Intergenic
1171175412 20:23048389-23048411 GGCTCTGAAGCACGGGTCCACGG + Exonic
1171238678 20:23547984-23548006 GGCCCTCCAGCCTGAGTTCTGGG + Intergenic
1171368858 20:24647389-24647411 GCCTCTGAAGCGTGACTTGATGG - Intronic
1171475938 20:25408819-25408841 GGCTCTGGAGCCAGAGTGCCAGG - Intronic
1173168376 20:40702061-40702083 GGCTCTGGAGCCTGACTCCCTGG + Intergenic
1173451723 20:43170419-43170441 GGCTCTGAAGCCAGACTTGTTGG - Intronic
1173542890 20:43867889-43867911 GGCTCTGAAGCCAGAGTACCTGG + Intergenic
1174208472 20:48858159-48858181 GGCTCTGAAGAATGAGATCCAGG - Intergenic
1175183928 20:57167150-57167172 GGCCCTGACGACTGAGTTCCTGG - Intergenic
1175202342 20:57286657-57286679 GGCTCTGAAGCCAGACTACCTGG + Intergenic
1175772049 20:61630100-61630122 TGCTCTGCATCCTGTGTTCATGG - Intronic
1176878291 21:14157728-14157750 GGCTCTGCTCCCTGGGTTCATGG - Intronic
1177008494 21:15702944-15702966 GGCTGAGAAGTCTGAGGTCAAGG - Intergenic
1177369640 21:20185075-20185097 GGCTGTGAAGTCTAAGATCAAGG + Intergenic
1179533921 21:42039235-42039257 GGCTGGGAAGTCTGAGATCAAGG + Intergenic
1180044090 21:45294886-45294908 GGCCCTGACCGCTGAGTTCAGGG + Intergenic
1180748135 22:18106052-18106074 GAGTCTGAAGCCTGAGATCCAGG + Intronic
1180748152 22:18106196-18106218 GAGTCTGAAGCCTGAGTTCCAGG + Intronic
1181802863 22:25358636-25358658 GGCTATGAAGCCTGCGCTCATGG - Intronic
1181868095 22:25875217-25875239 GGCTCTGCAGCCAGACTGCAAGG + Intronic
1182021806 22:27087853-27087875 GGCTCTGGAGCCAGACTTCCTGG + Intergenic
1182802399 22:33042178-33042200 GGCTGGGAAGTCTGAGATCAGGG - Intronic
1183676023 22:39299336-39299358 GGCTCGGAGGCCTCAGCTCATGG - Intergenic
1184749244 22:46474833-46474855 GGACCTGCAGCTTGAGTTCAGGG - Intronic
1184877802 22:47286501-47286523 GGCTGTGAAGCCAGACTTGATGG + Intergenic
1184904294 22:47469793-47469815 GGCTGAGAAGCCTGGGGTCAAGG + Intronic
1185125622 22:49009156-49009178 GGGCCTGAAGCCTGAGACCAAGG + Intergenic
1185145933 22:49136685-49136707 TGCCCTGAAGCCTGAGGTGAAGG + Intergenic
1185274565 22:49944731-49944753 GGCACTGCAGCCTGAGGTCTGGG - Intergenic
949845258 3:8363185-8363207 GGGTCTGAACCCTGAGTCCAAGG - Intergenic
950108356 3:10402638-10402660 GGCTCTGAAGCCAGACTGCCTGG - Intronic
950132610 3:10557631-10557653 GTCACTGAGGGCTGAGTTCAGGG + Intronic
950175093 3:10867703-10867725 TGCTCTGCAGTCTGGGTTCATGG - Intronic
950260409 3:11539348-11539370 GTCTCTGAAGCCAGACTTCCAGG - Intronic
950289827 3:11774666-11774688 GGCTGGGAAGTCTGAGATCAAGG + Intergenic
950669120 3:14514561-14514583 GGCACTGGAGCCAGAGTGCAAGG + Intronic
951044443 3:18022614-18022636 GCCTCAGAAGCCTGACTTCCTGG + Intronic
952622774 3:35366211-35366233 GGCTGGGAAGTCTGAGGTCAAGG + Intergenic
952639724 3:35579295-35579317 AGCTGTGAAGCCTGGGTTTAGGG - Intergenic
953240467 3:41144242-41144264 GGCTGTGGTCCCTGAGTTCAGGG - Intergenic
954214840 3:49118845-49118867 AGCTTTGAAGCCTGAGTACTTGG - Intronic
954469815 3:50683601-50683623 GGCTCCTTAGCCTTAGTTCATGG + Intronic
954734115 3:52690864-52690886 GGCTCTGGAGCCTGATTGCTTGG + Intronic
955357539 3:58243741-58243763 GCCTCTGCCTCCTGAGTTCAAGG + Intronic
956703020 3:71975500-71975522 GGCTCTGAAGCCAGACTGCCTGG + Intergenic
956734572 3:72228362-72228384 CGCTGTGAACCCTGAGTTCTAGG + Intergenic
957037666 3:75310111-75310133 GGCTCTGAAGCCAGACTGCATGG + Intergenic
958902538 3:99904929-99904951 GACACTGAAACCTGACTTCAAGG - Intronic
959938168 3:112052143-112052165 GGCTCTATAGCCTGAGTTGGGGG + Intronic
960695670 3:120393939-120393961 GGCTGGGAAGCCTAAGATCAAGG - Exonic
961085698 3:124065660-124065682 GGCTCTGAAGCCAGACTGCATGG + Intergenic
961089195 3:124094811-124094833 GGCTGTGAAGGATGAGTTCAGGG + Exonic
961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG + Intronic
961122166 3:124382036-124382058 GGCTCTGAAGCCTGCCAACAGGG + Intronic
961662482 3:128476965-128476987 GGCTCTGGTTCCTGAGTTCTGGG + Intergenic
961688299 3:128650566-128650588 GGCTTTGGAGCCTGAGCTCGAGG - Exonic
961809861 3:129515411-129515433 GGGCCTGAAGCCAGAGTCCAGGG + Intronic
962853707 3:139326366-139326388 GGCTCGGAAGTCTGAGATCAGGG - Intronic
963552310 3:146739661-146739683 GGCTCTCAACCATGTGTTCATGG - Intergenic
963552971 3:146747855-146747877 GGCTCTGCAGATTCAGTTCAGGG + Intergenic
964415776 3:156446072-156446094 GACTCTGAAGCTGGAGTTCTGGG + Intronic
964497070 3:157302594-157302616 GGCTGGGAAGCCCGAGATCAAGG - Intronic
964532377 3:157682438-157682460 GGCTGGGAAGTCTGAGATCAGGG + Intergenic
964655962 3:159066428-159066450 GGCTCAGAAGTCTAAGATCAAGG - Intronic
965115340 3:164481207-164481229 GGCTGGGAAGCCTAAGATCAAGG - Intergenic
966170621 3:177076033-177076055 GGCTGTGAAGCCCAAGATCAAGG + Intronic
966452005 3:180073640-180073662 GGCTATGCAGCCTGAGGTTAGGG - Intergenic
968584912 4:1411825-1411847 GGCTCTGCAGCCTGGTATCAGGG + Intergenic
969514199 4:7637511-7637533 GGCTGTGAACCCTGAGTTTACGG + Intronic
969912640 4:10459819-10459841 GGCTCAGAAGTCTGAAATCAAGG - Intergenic
969949486 4:10819741-10819763 GGCTATAAAGCCTGTGATCAAGG + Intergenic
969975261 4:11093146-11093168 GGCTGGGAAGCCTAAGATCAAGG - Intergenic
970906514 4:21222946-21222968 GGCTCTGCAGCCTGGCTTCCTGG + Intronic
971431317 4:26570936-26570958 GGCTCTGAAGTCCAAGATCAAGG + Intergenic
972725039 4:41739958-41739980 GGTTCTCAACCCTGGGTTCATGG - Intergenic
972773050 4:42216007-42216029 GACTCTGAAGTCTTAGTTCCTGG - Intergenic
973288740 4:48448708-48448730 GGCTCTGGGGACTGAGTCCAGGG + Intergenic
973288878 4:48449710-48449732 GGCTCTGGAGCCGGACTTCCTGG - Intergenic
973879559 4:55255305-55255327 GGCTCTGGTGCCTGACTTCTTGG + Intergenic
973962241 4:56123310-56123332 GGCTGGGAAGTCTGAGATCAAGG + Intergenic
974644200 4:64671607-64671629 GGGCCTGAAGCCTGAGGGCAGGG - Intergenic
974744620 4:66056437-66056459 AGCTGGGAAGCCTGAGATCAAGG + Intergenic
976075795 4:81298051-81298073 GGCTCTCAAGCCTCAATTCTTGG - Intergenic
977866518 4:102034842-102034864 GGATCTCATGCCTGAGTACATGG + Intronic
977930823 4:102746887-102746909 AGCTCTGACTCCTGGGTTCACGG - Intronic
978252451 4:106649556-106649578 CCCTCTGAAGCCTGAGTTTTGGG - Intergenic
978302119 4:107282192-107282214 GGCTCTGGAGACTGAGTTCCAGG - Intronic
979018913 4:115469146-115469168 AGCTGAGAAGCCTGAGGTCAAGG - Intergenic
979487301 4:121283685-121283707 GGGCCTGGAGCCTGGGTTCAAGG - Intergenic
979530914 4:121768236-121768258 GGCTCTGGAGCCAGACTTCCTGG - Intergenic
979638920 4:122989482-122989504 GATCCTGAAGGCTGAGTTCATGG + Intronic
979723740 4:123934905-123934927 GGCTGAGAAGTCTGAGATCAGGG + Intergenic
980374901 4:131932116-131932138 GGCTCTGAACCCTGGCTTCCTGG - Intergenic
980857979 4:138463559-138463581 GGTTCTTAACCCTGAGTTAATGG - Intergenic
981680534 4:147392332-147392354 GGCTGTGAAGTTTGAGATCAGGG - Intergenic
981755626 4:148139016-148139038 GGCTGAGAAGCCTAAGATCAAGG - Intronic
982125226 4:152178338-152178360 GGCTGGGAAGTCTAAGTTCAAGG - Intergenic
982763189 4:159313292-159313314 GACTCTGAAGCCAGAATTCCTGG + Intronic
983069516 4:163252482-163252504 GGCTCTGAAGCCAGAGAACGTGG + Intergenic
983206186 4:164912403-164912425 GGCTCTGAAGGGTGAGCTAAGGG + Intergenic
983894800 4:173070639-173070661 GGTCCTGGAGCCTGAGTTCATGG + Intergenic
985855063 5:2418019-2418041 GGTTTTGAAGCCTGGGTTCTGGG + Intergenic
985999194 5:3616776-3616798 GGGTCCAAAGACTGAGTTCAGGG - Intergenic
986464529 5:8008215-8008237 GGTCCTGGAGCCTGAGTTCATGG + Intergenic
986627298 5:9734219-9734241 GGCTGTGAAGTCTGATATCAAGG - Intergenic
987280909 5:16412663-16412685 GGCTGGGAAGCCTGAGTTCAGGG + Intergenic
988356683 5:30185420-30185442 GGTTATGCAGGCTGAGTTCAAGG - Intergenic
988607286 5:32689611-32689633 GGCTCTGAGTCCTGGGGTCAGGG - Intronic
990096393 5:52119475-52119497 GGCTGTGAAGTCTAAGATCATGG - Intergenic
991348499 5:65695238-65695260 GAATCTGAAGCCAGATTTCAGGG - Intronic
992048722 5:72924664-72924686 GAATGTGTAGCCTGAGTTCATGG - Intergenic
992734759 5:79707874-79707896 GGCTGGGAAGTCTGAGATCAAGG + Intronic
992881442 5:81114286-81114308 AGCTCTGCAGCCTGAGCTCACGG - Intronic
993120088 5:83764578-83764600 GGCTGTGAAGTCTAAGATCAAGG + Intergenic
993582334 5:89677861-89677883 TGCTCTGAAGCGTGAGTCCCAGG + Intergenic
994838274 5:104885995-104886017 CGCTCTGACTCCTGGGTTCAAGG - Intergenic
994890406 5:105626444-105626466 GGCTTAGAAGTCTGAGATCAAGG + Intergenic
995579419 5:113579989-113580011 GGATCTTAAGTCTGAGATCAAGG + Intronic
995652767 5:114389381-114389403 GGCTCTGAAGCCAGATTGCTTGG + Intronic
995893071 5:116978771-116978793 GGCTCTGAAGGCTGAGTGCTGGG + Intergenic
996151692 5:120044898-120044920 GGAACTGAAGCCTCAGGTCAGGG + Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
996385297 5:122904263-122904285 GCCTCTGCCCCCTGAGTTCAAGG + Intronic
996860459 5:128060083-128060105 GAGACTGAAGTCTGAGTTCACGG + Intergenic
997050472 5:130374015-130374037 GGCTCAGAGGCCTGAGTAAAAGG - Intergenic
997301582 5:132810224-132810246 GACTATGAAGGCTGAATTCAGGG - Intergenic
997858273 5:137392533-137392555 GGCTCTGGAGACTGACTGCATGG + Intronic
997922925 5:137999732-137999754 GGCTGAGAAGTCTGAGATCAAGG + Intronic
997977221 5:138447544-138447566 GTCTCAAAATCCTGAGTTCAAGG - Intergenic
998695159 5:144630539-144630561 GGCTCTGCATCCTGGGTTTAAGG - Intergenic
999136570 5:149324258-149324280 GGCTGGGAAGTCTGAGATCAAGG + Intronic
999183513 5:149688079-149688101 GGCTCTGGAGCCAGAATTCTTGG + Intergenic
999297243 5:150467389-150467411 GGCTGGGAAGTCTGAGATCAAGG - Intergenic
999499297 5:152130937-152130959 GGCTGTGAAGTCTAAGATCAAGG + Intergenic
1000947400 5:167438472-167438494 AGCTCTGCCTCCTGAGTTCACGG + Intronic
1001481248 5:172090555-172090577 GTTTCTGAAGGCTGAGATCAGGG - Intronic
1001652463 5:173325582-173325604 GGCTTTGGAGACTGAGTTCTGGG + Intronic
1001709946 5:173770247-173770269 GGCTCTGAAGCCAGACTGCCTGG + Intergenic
1002330255 5:178436041-178436063 GGCACTGAAGGCCGACTTCACGG + Intronic
1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG + Intronic
1003167591 6:3694697-3694719 GTCTCTGTACCCAGAGTTCAGGG - Intergenic
1003263116 6:4541204-4541226 GGCTGGGAAGTCTGAGATCAAGG - Intergenic
1003717111 6:8659526-8659548 GGCTGGGAGGTCTGAGTTCAGGG - Intergenic
1004217859 6:13719026-13719048 GTCTCCAAAGCCTGGGTTCAAGG + Intergenic
1004373879 6:15075439-15075461 GGCTGGGAAGCCTAAGATCAAGG + Intergenic
1004903661 6:20216571-20216593 TGCTCTAAAGGCTGAGTTCTTGG - Intergenic
1006907404 6:37542106-37542128 ACCTCTGAAGTCTGAATTCATGG - Intergenic
1008138207 6:47801308-47801330 GGCCCTAGAGCCAGAGTTCAAGG - Intronic
1008177592 6:48287984-48288006 TGCTCTGAAGACTGAGTCCCAGG - Intergenic
1009245481 6:61231859-61231881 GGCTCTGAAGGGTGAGTCCCAGG + Intergenic
1010566477 6:77420560-77420582 GGCTGTGAAGTCTAAGGTCAAGG - Intergenic
1013059353 6:106617127-106617149 GGCTGGGAAGCCTGAGATCAAGG - Intronic
1013819236 6:114135130-114135152 GGCTCTGAAGAAAGAGCTCATGG - Intronic
1014240590 6:119014046-119014068 AGATCTGGAACCTGAGTTCAAGG + Intronic
1017362999 6:153598589-153598611 GGCTGTGAAGTCTAAGGTCAAGG + Intergenic
1017459618 6:154636749-154636771 GGCTGGGAAGTCTGAGATCAGGG - Intergenic
1017538776 6:155377871-155377893 GGCTGGGAAGTCTGAGATCAAGG - Intergenic
1018699934 6:166418461-166418483 TGCTCTGAAGCCAGGATTCATGG + Intronic
1019340058 7:504654-504676 GGCTCTGAAATCTGGGTTCGTGG + Intronic
1019360486 7:602111-602133 GGGGCTGAAGCCTGAGTGGAGGG - Intronic
1019598030 7:1867391-1867413 GGCACTGCAGCCTGAGCTCCAGG + Intronic
1019600985 7:1883682-1883704 GGGTCCAAAGCCTGATTTCACGG + Intronic
1019702025 7:2478672-2478694 GGCTCTGAAGCCACAGTAAACGG - Intergenic
1021025260 7:15658820-15658842 GGCTGGGAAGACTAAGTTCAGGG - Intronic
1021465570 7:20939078-20939100 GGCTCTGGAGCCTGACTGCATGG + Intergenic
1022093531 7:27123745-27123767 GGCTCCGAAGCCAGGGGTCAGGG - Intronic
1022103001 7:27180291-27180313 GGCTGGGAAGCCTGGGTTTAGGG - Intergenic
1022860864 7:34365133-34365155 GGCTCTCATGCCAGACTTCATGG - Intergenic
1023258796 7:38337708-38337730 AGCTCTGAAAGCTGAGTTCTTGG + Intergenic
1023259326 7:38342373-38342395 AGCTCTGAAAGCTGAGTTCTCGG + Intergenic
1023259783 7:38346694-38346716 AGCTCTGAAAGCTGAGTTCTCGG + Intergenic
1023260259 7:38351023-38351045 AGCTCTGAAAGCTGAGTTCTCGG + Intergenic
1023260771 7:38355856-38355878 AGCTCTGAAAGCTGAGTTCTCGG + Intergenic
1023261235 7:38360174-38360196 AGCTCTGAAAGCTGAGTTCTCGG + Intergenic
1023305630 7:38823368-38823390 GGCTGGGAAGTCTGATTTCAAGG - Intronic
1024255030 7:47534189-47534211 GCCTCTGACTCCTGGGTTCAAGG - Intronic
1024804321 7:53119014-53119036 GGCTCAGAAGTCTTAGTTCAAGG - Intergenic
1026902027 7:74042780-74042802 GGCTCCCAAGCCTGAGTTGAGGG - Intronic
1026942157 7:74293430-74293452 GGGGCTGTAGCCTGAGTCCACGG + Intronic
1028111766 7:86949943-86949965 GGCTCTGAAGCCTGGGGGCTGGG + Intronic
1028354302 7:89887430-89887452 GGCCCTGAAGGCTGAGTTTCAGG - Intergenic
1028968829 7:96833809-96833831 GGGTTTAAAGCCTGAGGTCAAGG - Intergenic
1030264959 7:107610983-107611005 GGCTAAGAAGTCTGAGATCAAGG + Intronic
1030824126 7:114133905-114133927 GGTTCTGCAGGCTAAGTTCAAGG - Intronic
1031179647 7:118398044-118398066 GGCTCTGAAGCCGGATCTCCCGG + Intergenic
1031619478 7:123918602-123918624 GGCTCTGAAATCTGAATCCAAGG + Intergenic
1031913100 7:127538101-127538123 GTCTCTGAAGCCTGCGTTGGTGG - Intergenic
1032728284 7:134612647-134612669 GGCTGAGAAGTCTGAGATCATGG - Intergenic
1033049330 7:137989814-137989836 GGCTTGGAAGGCTGAGTTGACGG - Intronic
1033857415 7:145581388-145581410 GGCTTGGAAGTCTGAGATCAGGG + Intergenic
1034732960 7:153403881-153403903 GGCTCTGACTCCTGAGTGCATGG - Intergenic
1034862902 7:154615330-154615352 GCCTATGAAGCATGAGTTCATGG - Intronic
1035210035 7:157320854-157320876 GGCTCTGAGCCCAGAGTTCTGGG - Intergenic
1037800509 8:22032593-22032615 GGCTTTGAGGTCTGAGATCAGGG + Intronic
1037968219 8:23150185-23150207 GGGCCTGGAGCCTGAGTTCATGG - Intronic
1038024026 8:23573252-23573274 GGCTGCGAAGCCTGTGTTCTCGG - Exonic
1039589067 8:38731269-38731291 GGCTCTGTAGCCAGAGTGCCTGG + Intronic
1040389572 8:46938101-46938123 GGTTCTGTAACCTGGGTTCACGG + Intergenic
1041015160 8:53585661-53585683 GGCTCTGAAGCCAGACTGCCTGG - Intergenic
1041145407 8:54870897-54870919 GGCTCTGAAGTCAGACTTCTAGG - Intergenic
1041760589 8:61362095-61362117 GGCTTTGAAGGCTGAGAACACGG + Intronic
1042751216 8:72159995-72160017 GGCTGGGAAGTCTGAGATCAAGG + Intergenic
1043557844 8:81454286-81454308 GACTCTGAAACCTGAGGTCATGG - Intergenic
1045599354 8:103694788-103694810 GTGCCTGAAGCCTGAGGTCAGGG + Intronic
1046271434 8:111902552-111902574 TGTTCTGAAGCCTGAGTTCTTGG - Intergenic
1047806376 8:128365010-128365032 GGCTGTGAAGCCCAAGATCAAGG - Intergenic
1047857281 8:128925147-128925169 GGCTGAGAAGTCTGAGATCAAGG - Intergenic
1047950750 8:129932777-129932799 GGCCCTGCAGACTGAGTTCTGGG + Intronic
1048069640 8:131008233-131008255 GTCTCTGAAGCCTGACTTGCTGG - Intronic
1048130369 8:131689431-131689453 GGCTGGGAAGTCTGAGATCAAGG - Intergenic
1048527827 8:135220149-135220171 GGCTCTAGAGACTGTGTTCATGG - Intergenic
1049199199 8:141331647-141331669 GGCCCTGAGGACTGAGCTCATGG - Intergenic
1049314779 8:141958689-141958711 GGCTGGGAAGTCTGAGATCAAGG - Intergenic
1049465081 8:142747478-142747500 GGCTCTGCAGCCTGGATACAGGG - Intergenic
1050007990 9:1154570-1154592 GGATGTGAAGCCTGTGTACACGG - Intergenic
1050397477 9:5214571-5214593 GGTCCTGTAGCCTGAGTCCATGG - Intergenic
1050772626 9:9221486-9221508 GGCTGGGAAGCCTGAGATCAAGG + Intronic
1051662692 9:19440581-19440603 GGCTGGGAAGTCTGAGATCAAGG - Intronic
1051700495 9:19817810-19817832 GCCTCTCACTCCTGAGTTCAAGG + Intergenic
1051722867 9:20056726-20056748 GTCTCTGAAGCTTGATTGCATGG + Intergenic
1052005085 9:23337632-23337654 GGCTGTGAAGTCTAAGATCAGGG + Intergenic
1053137453 9:35660330-35660352 GGCTCTGGAGACTGAGGTGATGG + Exonic
1055689157 9:78810998-78811020 GGCTCCGGATGCTGAGTTCATGG + Intergenic
1055834883 9:80427633-80427655 GACTCTGAAGTCAGAGGTCAAGG + Intergenic
1056816717 9:89807075-89807097 GTCTGTGGACCCTGAGTTCATGG + Intergenic
1057105011 9:92406637-92406659 GGCACTGCAGCCTCACTTCAGGG + Intronic
1058165973 9:101619638-101619660 GGCTCTGGAGTCTGAGTACTTGG - Intronic
1059081583 9:111255831-111255853 GGCTGGGAAGCCTGAGATCAAGG - Intergenic
1059426898 9:114226931-114226953 GGCTCTGAGGCCTGACAGCAGGG + Intronic
1059999128 9:119942518-119942540 GGCTCAGAAGGCTGAAATCAAGG - Intergenic
1060188472 9:121577877-121577899 GGCCCTGCAGCCTGAGGTCAGGG + Intronic
1062345942 9:136115351-136115373 GGCGCAGATGCCTGTGTTCAGGG - Exonic
1062600868 9:137318118-137318140 GGCTCTGAAGCCCCTGTCCACGG + Intronic
1185963838 X:4577293-4577315 GGCTCAGAAGTCTCAGGTCAAGG - Intergenic
1186907383 X:14126470-14126492 GGCTCTGGAGCCTGAATGCTTGG - Intergenic
1187424163 X:19162111-19162133 GGCTCTGAAGCCAGATTGCTTGG + Intergenic
1188691555 X:33135651-33135673 GGCTCTGGAGCCTGAATGCCTGG + Intronic
1189260236 X:39673313-39673335 GGCTGAGAAGTCTGAGATCAAGG + Intergenic
1189415633 X:40810234-40810256 GGCTCTGTAGCCTATGTTCAAGG - Intergenic
1189610850 X:42732747-42732769 TCATCTGAAGTCTGAGTTCAGGG - Intergenic
1189779209 X:44498081-44498103 ACCTCTGACTCCTGAGTTCAAGG - Intergenic
1189804892 X:44725410-44725432 TGCTCTGAAGGATGTGTTCATGG + Intergenic
1190340553 X:49292404-49292426 GGCTCTGAGGCCTGTGCCCAGGG + Intronic
1190375176 X:49782325-49782347 AGTTCTGGAGCCTAAGTTCAAGG + Intergenic
1190823960 X:53999885-53999907 GGCTCTAAAGGCCAAGTTCAAGG + Exonic
1190838780 X:54126965-54126987 GGCTCGGAAGTCTAAGATCAAGG + Intronic
1191807106 X:65147623-65147645 AGGTCTAAAGCCTGAGTCCATGG + Intergenic
1192208717 X:69113032-69113054 TTCTCTGAACCCTGAGTTCCAGG - Intergenic
1192506055 X:71684591-71684613 GGAGCTGGAACCTGAGTTCATGG + Intergenic
1192520642 X:71796957-71796979 GGAGCTGGAACCTGAGTTCATGG - Intergenic
1192714829 X:73628234-73628256 AGCTGTGCAGCCTGAGTTTAGGG + Intronic
1192836797 X:74808319-74808341 GCCTCTGACTCCTGGGTTCAAGG - Intronic
1194470525 X:94289626-94289648 GGCTCTGAAGTCAGACTTCCAGG + Intergenic
1194964792 X:100275371-100275393 GGCTCTGAAGCCAGACTGCTTGG + Intergenic
1195294558 X:103463163-103463185 GGCTCTGAAGCATGACATCCTGG - Intergenic
1195696438 X:107671113-107671135 GGCTCTGGAGCCAGACTGCAAGG - Intergenic
1195854320 X:109313896-109313918 GGCTCTGAAGCCCAAGATCAAGG + Intergenic
1196508658 X:116478997-116479019 AGCTGTGCAGCCTGAGTTAAAGG - Intergenic
1197043650 X:121970366-121970388 AGATCTGAAGACTGTGTTCATGG - Intergenic
1197122980 X:122913901-122913923 AGGCCTGGAGCCTGAGTTCATGG + Intergenic
1197284349 X:124578419-124578441 GACTCTAAAGCCTGATTTCCTGG + Intronic
1197710142 X:129660179-129660201 GGCTGGGAAGTCTGAGATCAAGG - Intergenic
1197751694 X:129968607-129968629 GACTCTGAAGCCAGACTTTATGG + Intergenic
1198170626 X:134101862-134101884 GGCTGAGAAGTCTGAGATCAAGG - Intergenic
1198379389 X:136069861-136069883 GGTTCTGAAGGCTGAGTGTAAGG + Intergenic
1198940621 X:141952191-141952213 GGGTCTGAAGCCTGGGTGCTTGG + Intergenic
1198956470 X:142136786-142136808 GGCTGAGAAGCCTCAGTGCATGG - Intergenic
1198996198 X:142577114-142577136 AGCTCTGAAGGGTGAGTTCCAGG - Intergenic
1201386482 Y:13445071-13445093 GTCTCTGCCTCCTGAGTTCAAGG - Intronic