ID: 1107587571

View in Genome Browser
Species Human (GRCh38)
Location 13:41868227-41868249
Sequence CTTGATAGTACTGCTTCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107587571_1107587572 -6 Left 1107587571 13:41868227-41868249 CCGACAGAAGCAGTACTATCAAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1107587572 13:41868244-41868266 ATCAAGAGAGAAGACTTACAAGG 0: 1
1: 0
2: 1
3: 25
4: 321
1107587571_1107587573 15 Left 1107587571 13:41868227-41868249 CCGACAGAAGCAGTACTATCAAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1107587573 13:41868265-41868287 GGAGATCATAAACCCAATTTAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1107587571_1107587576 28 Left 1107587571 13:41868227-41868249 CCGACAGAAGCAGTACTATCAAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1107587576 13:41868278-41868300 CCAATTTAGGTCATAAAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107587571 Original CRISPR CTTGATAGTACTGCTTCTGT CGG (reversed) Intronic
900885373 1:5411441-5411463 CTTTATGGTACTGATTGTGTTGG + Intergenic
901119133 1:6876000-6876022 ATTGTTAGTACTGTTTCTGTAGG + Intronic
905441484 1:37999133-37999155 CTTCATAGAACAGCTCCTGTGGG + Exonic
906357779 1:45122140-45122162 CTTGATAATACTGTTTCTCTGGG - Intronic
908442350 1:64168007-64168029 CTTAATAGTTGTGCTTCTTTAGG + Intronic
919658984 1:200224578-200224600 CTTAACAGAACTGCTTTTGTGGG + Intergenic
921244461 1:213222487-213222509 CTTGATGGTGCAGCTTCTGATGG + Intronic
921816197 1:219566764-219566786 CTTGATAGTGCTGATCCTGAAGG + Intergenic
924073808 1:240311684-240311706 TTTGATAGTTATGCTTCTTTTGG + Intronic
924269431 1:242317640-242317662 TTTGTTAGTTCTGCTTCTGGTGG + Intronic
1066715471 10:38281134-38281156 TTTGTTAGTTCTGCTTCTGGTGG - Intergenic
1069345107 10:67459550-67459572 CTTCATAGTAACACTTCTGTTGG + Intronic
1070027457 10:72645693-72645715 CTTGATAGTATTGTTGCTGAAGG + Intergenic
1071540652 10:86480071-86480093 CTTGATAGTACAGATGCTGTTGG - Intronic
1074300677 10:112230893-112230915 CATGAGAGGACTGCTTCTGGTGG - Intergenic
1074348315 10:112709968-112709990 TTTGATTGTACTGCTCTTGTTGG + Intronic
1074895200 10:117771394-117771416 CTAGATCGTTCTGTTTCTGTGGG + Intergenic
1075359297 10:121815457-121815479 CTTGCTACCACTGCTTCTGAAGG + Intronic
1079214368 11:18494790-18494812 CCTGAAAGTACAGTTTCTGTAGG + Intronic
1080851291 11:36072495-36072517 CTGGACAGTTCTGCTCCTGTGGG + Intronic
1081250757 11:40830349-40830371 GTTGATAATACTGCTTTGGTTGG - Intronic
1087841218 11:102922863-102922885 CTTGTCTGTACTGATTCTGTGGG + Intergenic
1091329850 11:134723785-134723807 CTTTATAGAACTGATGCTGTAGG + Intergenic
1097516034 12:60607818-60607840 CCTGACAGCACTGCCTCTGTGGG + Intergenic
1100087212 12:90926274-90926296 CTTGATAGTCTTTCTTCTGCTGG + Intronic
1103104640 12:118212915-118212937 CTTAATAGTTCTGCTGATGTTGG + Exonic
1107587571 13:41868227-41868249 CTTGATAGTACTGCTTCTGTCGG - Intronic
1108709142 13:53016030-53016052 TTTGCTGGTGCTGCTTCTGTGGG + Intergenic
1111019755 13:82433908-82433930 CTTGAAAGTACTGCTCATATAGG + Intergenic
1114807987 14:25859815-25859837 ATTAAATGTACTGCTTCTGTGGG - Intergenic
1116273946 14:42806368-42806390 CTTAAAAGTACTGGCTCTGTTGG - Intergenic
1116393164 14:44417365-44417387 CTTAAAAGTACTGGCTCTGTTGG - Intergenic
1119681317 14:76594218-76594240 CTGGATAGTACTCCTTTTGCAGG + Intergenic
1119741488 14:77016533-77016555 CTTGATTGTCCTGCCTCTTTGGG - Intergenic
1120805968 14:88751089-88751111 CTTGAGAGTACTTTCTCTGTAGG + Intronic
1120813671 14:88830868-88830890 CTTCATAGTCCTGCTCCTGATGG + Intronic
1121623042 14:95363445-95363467 CTTGAAAGCACTGCTTTTGATGG - Intergenic
1121954639 14:98202753-98202775 CTTCATAGTACTGCCAATGTGGG + Intergenic
1124927383 15:34083604-34083626 CTTGATAGAACTTATTATGTCGG - Intergenic
1139141484 16:64268129-64268151 CTTCATAGAAGTGCTTCTTTGGG - Intergenic
1141246896 16:82316378-82316400 CTAGATAGTACTGATACAGTTGG + Intergenic
1142869770 17:2812510-2812532 CTTGATAGTGCTGACTCTGATGG + Intronic
1147493758 17:40896135-40896157 CTTGTTAGTACTTCTTCTGCCGG + Intergenic
1148056102 17:44796763-44796785 CTTGTTAGTTCTGATTATGTAGG + Intergenic
1149800959 17:59566892-59566914 CTTTATAGTCCCGCTTCTCTTGG + Intronic
1152765084 17:82132507-82132529 ATTTATAGTTCTTCTTCTGTGGG - Intronic
1153059966 18:984995-985017 CTTGATAGTTCTTCTTTTGGAGG + Intergenic
1155560287 18:27068744-27068766 CTTGCTAGTGCTGCATCTCTGGG + Intronic
1157092795 18:44656075-44656097 ATAGATAGTACTGCTCCTATGGG + Intergenic
1159237235 18:65692557-65692579 CATGATAGCACTGCTTCTGATGG + Intergenic
925688100 2:6493514-6493536 CTTGGTGGTACTCCTCCTGTAGG - Intergenic
929944542 2:46360713-46360735 GTTGACAGTACGGCCTCTGTTGG - Exonic
930198524 2:48530922-48530944 TAGGATTGTACTGCTTCTGTTGG + Intronic
930198583 2:48531497-48531519 CATGACAGTCTTGCTTCTGTGGG + Intronic
931257229 2:60584283-60584305 CTTGATTGTCCTGCTTCTGATGG + Intergenic
932441686 2:71741308-71741330 CTTGATAATACTCCTTTTATCGG - Intergenic
939295098 2:140252477-140252499 CTTATTAGTTCCGCTTCTGTGGG - Intronic
941158465 2:162007669-162007691 CTTGATATTAATTGTTCTGTTGG - Intronic
942745324 2:179225290-179225312 CTTAAGAGTAGGGCTTCTGTAGG - Intronic
945265887 2:207890809-207890831 CTTTATAGTATTGCTTTTGGAGG + Intronic
946445151 2:219733159-219733181 CCTAATATTTCTGCTTCTGTTGG + Intergenic
948183638 2:236002132-236002154 CTTGGTAGCACTGCTTGTGCGGG - Intronic
1173053914 20:39592672-39592694 CTTGAAATGTCTGCTTCTGTTGG - Intergenic
1174032232 20:47639067-47639089 CTGGATAGCCCTGTTTCTGTTGG + Exonic
1175323843 20:58109035-58109057 CTAGATAGCAGTGCTTCTGCTGG - Intergenic
1177571091 21:22888174-22888196 ATTAATAGTATTGCATCTGTAGG + Intergenic
1182658320 22:31907036-31907058 CAGGATGGGACTGCTTCTGTGGG - Intergenic
1182888615 22:33797449-33797471 TTTGATTGTACTGGTTGTGTAGG - Intronic
1184074394 22:42166943-42166965 TTTGAAAGGACTGTTTCTGTTGG - Intronic
952914967 3:38229688-38229710 CTTAATAGTTCTGCTGCTGTTGG - Exonic
957989051 3:87607942-87607964 CCTAATAATACTGCTTCTGAGGG - Intergenic
958768376 3:98397234-98397256 CTTGGGAGTGCTCCTTCTGTGGG - Intergenic
960048053 3:113215740-113215762 CATGATAGTATTACTTCAGTAGG + Intronic
962196338 3:133366961-133366983 CTGGATAGAACTGCATCTGCTGG + Intronic
964289596 3:155162710-155162732 CTTGATAGGAATGTTTATGTGGG + Intronic
974864053 4:67558324-67558346 TTTATTAGTACTACTTCTGTTGG - Intergenic
974896377 4:67944614-67944636 CATGATAGTACTCCTTTTTTTGG + Exonic
976959788 4:90956230-90956252 CTGTATAATAATGCTTCTGTAGG - Intronic
978125378 4:105129407-105129429 ACTGATAGTGCTGTTTCTGTTGG + Intergenic
979912247 4:126382098-126382120 TTTGATACTACTGCTTCAGAGGG + Intergenic
980889760 4:138801863-138801885 AATTAGAGTACTGCTTCTGTGGG + Intergenic
981819872 4:148873942-148873964 CTTCATAGTACTACTTTTCTGGG - Intergenic
982530902 4:156542512-156542534 CTTATTAGTCCTGCCTCTGTAGG - Intergenic
982668613 4:158294617-158294639 CTTAAAAGTACTGGCTCTGTTGG - Intergenic
982910115 4:161130033-161130055 CGTGATAGTACACATTCTGTAGG - Intergenic
987517401 5:18930585-18930607 CTTATTAGAACTGCATCTGTCGG + Intergenic
989520935 5:42399069-42399091 CTTGATACTGCTTCTTCTTTAGG - Intergenic
990088020 5:52003075-52003097 CTTGATACTACCTCTTCTGTAGG + Intergenic
992568981 5:78032530-78032552 CTTCATAGTAATGCTTGTGGGGG - Intronic
994303430 5:98174125-98174147 CTTGATAGTACATCTTTTATTGG - Intergenic
994561963 5:101385824-101385846 CTTGAAAACACTGCTTCTTTTGG + Intergenic
994656238 5:102596581-102596603 CTTTAGAGTACTTCTTCTTTAGG + Intergenic
995165234 5:109031941-109031963 ATTGCTAGCACTGCTTCTCTAGG - Intronic
1000700228 5:164440344-164440366 CTTGAGAGTTTTGCTTCTTTGGG + Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003641783 6:7881636-7881658 CTTGACAGTTGTGCTTCTCTAGG + Exonic
1008304951 6:49889608-49889630 CTTAAAAGTACTGGCTCTGTTGG + Intergenic
1009491802 6:64301015-64301037 TTTGAAAGTACTGGCTCTGTTGG - Intronic
1011771782 6:90681298-90681320 CTTGATATCATGGCTTCTGTTGG + Intergenic
1015970501 6:138738688-138738710 CTTGCTAGTACTTCTTATTTTGG - Intergenic
1022725721 7:32979754-32979776 CTGGGTAGTACTGCTTCTCTTGG - Intronic
1023061731 7:36334050-36334072 CTTGCTAGTCCTTCCTCTGTGGG + Exonic
1025047891 7:55707943-55707965 CTGGGTAGTACTGCTTCTCTTGG + Intergenic
1033291666 7:140090059-140090081 CTTCTTCGTACTGCTGCTGTTGG - Exonic
1037895593 8:22651641-22651663 CTTCCCAGTACTGCTGCTGTGGG + Intronic
1037935031 8:22909654-22909676 CTCCACAGTACTGCTTCTGGTGG - Intronic
1041492092 8:58444348-58444370 CTTTACAGCACTGCTGCTGTTGG + Intronic
1050476303 9:6044991-6045013 CTGGAGGGTACTCCTTCTGTGGG + Intergenic
1050539318 9:6656631-6656653 CTTTATAATTCTGCTTCTCTTGG - Intergenic
1050925531 9:11258784-11258806 CTTAAAAGTACTGGCTCTGTTGG + Intergenic
1052186833 9:25608038-25608060 CTTGATAGTATTGCCTGTGAAGG + Intergenic
1053274627 9:36773933-36773955 ATTGATAGTAATTCTTCTGGGGG - Intergenic
1056068121 9:82958162-82958184 TTTGAGATTACTGCTTCTGTCGG + Intergenic
1056083849 9:83125262-83125284 CTAGACAGTCCTGCCTCTGTGGG - Intergenic
1060377579 9:123130911-123130933 ATTGATAGTATTGCTACTGGAGG - Intronic
1190882409 X:54501253-54501275 CTTGATAGTAGTGGTTTTGGAGG + Intergenic
1191873846 X:65773735-65773757 CTTGATACTTTTGCTTCTGGAGG - Intergenic
1194676273 X:96797534-96797556 ATAGATACTTCTGCTTCTGTGGG + Intronic
1194810620 X:98383022-98383044 CTTAATAGTACTGTTACTGGTGG - Intergenic
1195198900 X:102527228-102527250 CTTTATAGTATTGCTTCTTATGG + Intergenic
1196785538 X:119418731-119418753 CTTGATAGAATGGCTTCTGGTGG + Intronic
1197952786 X:131916135-131916157 CTTTATAATATTGCTTCTGTGGG - Intergenic
1198415805 X:136418601-136418623 CTTGATTGTTCTGCTGCTGCTGG + Intergenic
1199618684 X:149679980-149680002 CTTAAAAGTACTGGCTCTGTTGG + Intergenic
1199623958 X:149723269-149723291 CTTAAAAGTACTGGCTCTGTTGG - Intergenic