ID: 1107590124

View in Genome Browser
Species Human (GRCh38)
Location 13:41895134-41895156
Sequence CTGTTTACTGAGTGGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107590124 Original CRISPR CTGTTTACTGAGTGGGAACA TGG Intronic
900530987 1:3153100-3153122 TTTTCTTCTGAGTGGGAACAGGG + Intronic
907012917 1:50979734-50979756 CTGTCCACTGAGAAGGAACAGGG - Intergenic
907013642 1:50989596-50989618 CCGTTTACTGAGAGGAAACATGG - Intergenic
910159839 1:84260975-84260997 CTGTTTACAGAAGGGGAAAATGG - Intergenic
911405140 1:97427772-97427794 CTGTTGGCTGAGTGGGCAAAGGG - Intronic
913081641 1:115393813-115393835 TTGGTTACTGGGTGGGAATAAGG + Intergenic
913680251 1:121183668-121183690 GTATTTATTGAGTAGGAACAGGG + Exonic
914032086 1:143971319-143971341 GTATTTATTGAGTAGGAACAGGG + Exonic
914157359 1:145096648-145096670 GTATTTATTGAGTAGGAACAGGG - Exonic
915285492 1:154849469-154849491 GTGTGGACTGAGTGGGAACCCGG - Intronic
915630444 1:157150165-157150187 CAGTTTTTTGAGTGGGTACAAGG + Intergenic
916893826 1:169140524-169140546 CTAGTTTCAGAGTGGGAACATGG - Intronic
916897312 1:169178703-169178725 GTACTTACTAAGTGGGAACAGGG - Intronic
920298120 1:204972067-204972089 CTTTTCACTGAGTGGGGACCCGG + Intronic
920467563 1:206202203-206202225 GTATTTATTGAGTAGGAACAGGG + Exonic
921067146 1:211631157-211631179 CTGTTGAAAGAGTGGGAAGAGGG + Intergenic
922603347 1:226873253-226873275 CTCTTCACTGAGTGGGAGAATGG + Intronic
923329759 1:232911867-232911889 CTGTTCACTGTTTTGGAACAGGG - Intergenic
923588814 1:235300496-235300518 CTGTTTACAGATAGGGAAAATGG - Intronic
1063939321 10:11110627-11110649 CTGTTTGGTGAGTGGGGAGATGG + Intronic
1065261717 10:23930769-23930791 AAGTTAACTCAGTGGGAACATGG + Intronic
1069735440 10:70650881-70650903 CTGTTTGCTGGGTGGGTAGATGG + Intergenic
1070868703 10:79728455-79728477 CTATTTACTGAGTGGATACTTGG + Intergenic
1071635616 10:87250670-87250692 CTATTTACTGAGTGGATACTTGG + Intergenic
1071659624 10:87487304-87487326 CTATTTACTGAGTGGATACTTGG - Intergenic
1072929822 10:99652480-99652502 CTGTTTCAGGAGTGGGCACATGG - Intergenic
1077800866 11:5535099-5535121 CTCTTTATTGTGTGGTAACATGG + Intronic
1078187959 11:9068384-9068406 GTGTTTAATGAGTGGGTAAATGG - Intronic
1078543446 11:12229393-12229415 CCATTTACTCAGTGGGAACATGG - Intronic
1078652485 11:13208642-13208664 CTGTGTATTGAGTGAGAAAATGG - Intergenic
1080421379 11:32113938-32113960 CTTTTTACTGAGTGCTCACATGG + Intergenic
1081648716 11:44808484-44808506 GTGTTTCTAGAGTGGGAACATGG + Intronic
1081753731 11:45530198-45530220 CTGTTCACAGAGTGGTAAAAGGG - Intergenic
1084421435 11:69062568-69062590 CTGTGTCCTGGGTGGGCACAGGG + Intronic
1085361537 11:75892362-75892384 TTGTCTCCTGTGTGGGAACATGG + Intronic
1085631668 11:78122885-78122907 CTCTTTACTGAGTGGGGCAAGGG + Intronic
1085958137 11:81426465-81426487 CTTTCTACTGAGTGGGAACAAGG + Intergenic
1087316217 11:96606134-96606156 CTGTTTCCTTAGTAGCAACAGGG - Intergenic
1090649096 11:128790980-128791002 CTGTCTTCTGCCTGGGAACAGGG + Intronic
1090888610 11:130901962-130901984 CTGAATACTGAGTAGGAACAAGG + Intronic
1091602896 12:1928704-1928726 CTGTTTCCAGAGAGGGAACCGGG - Intergenic
1092319008 12:7451539-7451561 CTGTTTACTTTGAGGAAACAAGG - Intronic
1092647517 12:10592428-10592450 CTGTTCGATGAGTGAGAACAAGG + Intergenic
1097838737 12:64300642-64300664 TTGTTTAGGGTGTGGGAACAGGG - Intronic
1098020448 12:66150147-66150169 CTGATTTCTGTGTGGGAAGAGGG - Intronic
1098397192 12:70031845-70031867 CTAGTTAATGAGTGAGAACATGG - Intergenic
1102438001 12:112940232-112940254 CTGCTGACAAAGTGGGAACAGGG - Intronic
1103215166 12:119195997-119196019 CTGTTTACTGTGTGGCACCCAGG + Intronic
1103656410 12:122474654-122474676 CTGGTTACTGAGTGGGTGGAAGG + Intronic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1107590124 13:41895134-41895156 CTGTTTACTGAGTGGGAACATGG + Intronic
1110113724 13:71784273-71784295 CTGTTTACTGAGTGCCTACATGG - Intronic
1110542565 13:76722460-76722482 CTGTTTCCTCAGTTGAAACAAGG + Intergenic
1110810335 13:79805716-79805738 CTATTTTATAAGTGGGAACAAGG + Intergenic
1112669064 13:101613924-101613946 CTGTTTGCTCAGTGGGAAGTAGG - Intronic
1115058582 14:29162553-29162575 ATGTTTACTGAGTGAGAGGAAGG - Intergenic
1116922872 14:50599231-50599253 CTGTTTTCTGATTGGGAACCAGG - Intronic
1117249482 14:53922167-53922189 CTGTTTCCTAAGTGGTAAGATGG - Intergenic
1119268404 14:73279190-73279212 CAGTTAGCTGAGTGGGAACTAGG - Intronic
1119992205 14:79211525-79211547 CTGTTTCCTCATTGGTAACATGG - Intronic
1120828394 14:88975629-88975651 CTGTTTCCAGGGTTGGAACAGGG + Intergenic
1126574689 15:50185195-50185217 CTGTTAGCTGGGTGGGAAGAGGG - Intronic
1126896372 15:53261329-53261351 ATCTTTACTGAGTAGGACCATGG - Intergenic
1127660108 15:61092805-61092827 CTGTTGACTGGAGGGGAACAAGG - Intronic
1129469277 15:75741471-75741493 CAGTTTCCTGATTGGGAAAATGG + Intergenic
1132373929 15:101316048-101316070 GTGGTCACTGAATGGGAACAGGG + Intronic
1132687976 16:1170226-1170248 CTCTGCACTGAGTGGGAACAGGG - Intronic
1133616324 16:7480029-7480051 TTGTTTACTGAGTCAGCACATGG - Intronic
1135064209 16:19295707-19295729 TTGGTTACTGAGTGGAAAGAAGG + Intronic
1135324404 16:21517112-21517134 CTGCGTACTGCCTGGGAACATGG + Intergenic
1136792754 16:32983533-32983555 CAGTTCCCTGAGTGGGAGCAGGG + Intergenic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1137980233 16:53063207-53063229 CTGTTTGCTCAGTAGTAACATGG - Intronic
1140662088 16:77197846-77197868 CTGTTTGCTCATTGGGAACTGGG - Intronic
1140663698 16:77211008-77211030 CTGTGTAGAAAGTGGGAACAGGG + Intronic
1142036605 16:87866175-87866197 CTGCGTACTGCCTGGGAACATGG + Intronic
1142139264 16:88465463-88465485 CTGTCAAATGAGTGGGAGCACGG + Intronic
1145752686 17:27366713-27366735 CTGTTAAATGGGTGGGAACGTGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146781345 17:35675911-35675933 CTGTTTACTTTGTCTGAACAGGG + Intronic
1146995593 17:37317851-37317873 CTGTTTTCTGAATGGAAAGAAGG + Intronic
1147652748 17:42071676-42071698 CTGCCTGCTGAGTGTGAACAGGG - Intergenic
1147804663 17:43122355-43122377 ATGTTTATTGAGTGGCAACTAGG + Intronic
1147809564 17:43158679-43158701 ATGTTTATTGAGTGGCAACTAGG + Intergenic
1148845509 17:50527635-50527657 CTGCTCACTGAGAAGGAACAAGG - Intronic
1149623901 17:58066133-58066155 CTGTTTCCTGAGAGGCAATATGG - Intergenic
1149970300 17:61211203-61211225 CTGATTACAGAGTGGGGAAAGGG - Intronic
1150975514 17:70081949-70081971 CTGTTTACTGAGTGGCAGCATGG - Intronic
1157487498 18:48098880-48098902 CTGTTTACAAAGTGGCAAGATGG - Intronic
1158373031 18:56831254-56831276 ATGTGTATAGAGTGGGAACAGGG + Intronic
1159498104 18:69232103-69232125 CTTTTTACAGAGTGGCAACTGGG - Intergenic
1160570862 18:79816747-79816769 CTGTTTCCTGAGTGACACCACGG + Intergenic
1160626054 18:80206157-80206179 CTGTTTCCTGAGAGAAAACAAGG + Intronic
1161716713 19:5880390-5880412 CTGTTTACTGAGTGCCTACTGGG - Intronic
1162656555 19:12135685-12135707 CTGTTCATTGATTTGGAACATGG - Intronic
1163602959 19:18259670-18259692 CTGGTAACTGGGTGGGACCATGG + Intronic
1166376282 19:42329055-42329077 GAGTTTATTGAGTGGGAAAAGGG + Intronic
1166891201 19:45994898-45994920 CTGTTTTCTTAGTGGTAAAATGG + Intergenic
1168278424 19:55289854-55289876 CTGCTTACTTAATGGGTACAGGG - Intronic
925253959 2:2466366-2466388 CTCTCTACTGAGTGGGAGCGAGG - Intergenic
925608884 2:5686620-5686642 CTGTCTGCAGAGTGGAAACAGGG + Intergenic
925699974 2:6627029-6627051 CTGTTTAATGAAGGAGAACAGGG + Intergenic
928712267 2:34020395-34020417 CTGTTTATCTAGTGGGAAAAGGG - Intergenic
928787516 2:34907238-34907260 TTTATTACTGAGTGGGAAGATGG + Intergenic
931538404 2:63303001-63303023 CAGTTTTCTGAGTGGGGTCAGGG + Intronic
932611693 2:73204389-73204411 CTGTTTTCTTCGTGGGGACATGG - Intronic
933377128 2:81493939-81493961 CTGATTAATTAGTGGGAAAATGG + Intergenic
933469840 2:82707888-82707910 CTGTAGACTAAGTGGGATCATGG + Intergenic
934044921 2:88164909-88164931 CTGCTTACAGAGTGGGGAAAGGG + Intergenic
934144615 2:89079006-89079028 CTGTTTCCTGAGTGGCAGAAGGG + Intergenic
934224637 2:90121543-90121565 CTGTTTCCTGAGTGGCAGAAGGG - Intergenic
934741809 2:96729379-96729401 CTGTTTACTCACTGGTAAAATGG + Intronic
935182184 2:100701187-100701209 CTGGTTAATGAGTGGGGAGAGGG - Intergenic
937249824 2:120516311-120516333 CTGTTTATACAGTGGGAATAGGG - Intergenic
937297924 2:120820960-120820982 CTAGTTACTGAGTCGGCACATGG - Intronic
937997246 2:127703591-127703613 TTGTTTACTGATGGGGAACAAGG - Exonic
939008860 2:136821505-136821527 CTGGTGGCTGAGTTGGAACAGGG + Intronic
939133834 2:138271331-138271353 CTGTTTCCTGACTGGAAAGATGG + Intergenic
940004213 2:148996739-148996761 CTGTTTCCAGGATGGGAACACGG - Intronic
942870457 2:180728272-180728294 CTCCTATCTGAGTGGGAACAGGG - Intergenic
942953112 2:181744371-181744393 TTGTTTAGTGAGTGGGTAGAAGG + Intergenic
943545942 2:189277909-189277931 ATTTTTCCTGGGTGGGAACAAGG + Intergenic
945614134 2:212046333-212046355 CTGTTTACTATGTGCAAACATGG - Intronic
946145199 2:217725374-217725396 CTGTTTGCTGAGCTGGAAGAGGG - Intronic
948117291 2:235502881-235502903 CTATTATCTGAGTGAGAACAGGG - Intronic
948833367 2:240611827-240611849 CTGTTGAATGAATGGGAACAAGG + Intronic
1169765737 20:9146120-9146142 CTGTTTACAGAGTGGCCACAGGG - Intronic
1170704787 20:18735599-18735621 TTATTTACTGAGTGTGAAGATGG + Intronic
1171445369 20:25199027-25199049 CAGTGTACTGAGGGGGAAAACGG - Intronic
1172883925 20:38218865-38218887 CAGTTTACTCAGTGGTAAAATGG + Intronic
1175731643 20:61358262-61358284 CTGTGTGCTGAGTGGGGTCATGG + Intronic
1177022211 21:15876042-15876064 CTGTTGGGTGAGTGGGAAGAAGG + Intronic
1177368992 21:20177116-20177138 GGTTATACTGAGTGGGAACAGGG - Intergenic
1177763255 21:25426879-25426901 CTGTATACTAAGTAGGAATAAGG + Intergenic
1177884887 21:26735243-26735265 CTATTTACTGTGTGAGAAGATGG - Intergenic
1179771479 21:43621352-43621374 CTGTTTTCTTAGTGGAGACAGGG - Intronic
1180021110 21:45127681-45127703 CGGGTTTCTGAGTGGGAACCTGG - Intronic
1180682456 22:17638030-17638052 GTGTGTACTGAATTGGAACAAGG - Intronic
1182806063 22:33071615-33071637 CTGTTAACTGTGTGAGAACAGGG - Intergenic
1183350382 22:37331507-37331529 TTGGGTACTGAGAGGGAACAGGG - Intergenic
1185420602 22:50732287-50732309 CTGATTACTGAGTGGCCACCAGG + Intergenic
949673974 3:6431746-6431768 CTGTATTCTTAGTGGGAACTCGG + Intergenic
952142811 3:30498676-30498698 CTATTGACAGTGTGGGAACATGG - Intergenic
956968258 3:74489479-74489501 TTTTTTACTGATTGGGAAGAAGG - Intronic
957244102 3:77696473-77696495 CTTTTTTCTGTGTGAGAACATGG + Intergenic
959552271 3:107675405-107675427 TTGTTTACTAAGAGGGCACAAGG - Intronic
961078225 3:124001435-124001457 CTGCTTCATGAGTGGGCACAGGG - Intergenic
961387870 3:126534450-126534472 CTGTCTCCTGGGTGGGGACAGGG - Intronic
961387907 3:126534736-126534758 CTGTCTCCTGGGTGGGGACAGGG - Intronic
963768307 3:149361883-149361905 CTGTTCAGTGGATGGGAACACGG - Intergenic
968943053 4:3649105-3649127 CTGTATACCCAGTGTGAACAGGG + Intergenic
969401646 4:6959571-6959593 CTGCTGAGTGAGTGGGAACAAGG + Intronic
974194159 4:58549634-58549656 CTTTTTAATGAGTTGGAAAATGG - Intergenic
974825324 4:67120795-67120817 CTGTTTATTGAGTGAGAAAAGGG + Intergenic
975059298 4:69978081-69978103 CAGAGCACTGAGTGGGAACATGG - Intergenic
976349482 4:84044566-84044588 CTTTTTAGGGAGTTGGAACAGGG + Intergenic
977587950 4:98795655-98795677 CAGTTTACTGAGAGTAAACATGG - Intergenic
979129764 4:117028325-117028347 CTGTTCACTGACTGTGAAGAAGG + Intergenic
979637146 4:122969606-122969628 CAGTTTACTGGGTGGGGAGAAGG - Intronic
982951497 4:161702811-161702833 TTGTTTTTTGAGTGGGAAGAGGG - Intronic
983339204 4:166436104-166436126 CTGATTACTGAGTGGAAATTGGG + Intergenic
987284913 5:16446564-16446586 CTGTATATTTAGTGGGGACAGGG - Intergenic
988413999 5:30922694-30922716 CTGTTTACTAACTCAGAACAGGG + Intergenic
990156183 5:52880135-52880157 CTTTTTACTGAGAGGAAATAGGG + Intronic
993252886 5:85550559-85550581 CTGTTTACTGTGTGGCACCCAGG + Intergenic
994236163 5:97365551-97365573 CTGTGTTCAGAGTGGGAACAGGG + Intergenic
994293949 5:98066138-98066160 ATGTTAACTGAGAGGGAGCATGG - Intergenic
995086811 5:108120428-108120450 CTGTTTACTGAATGTGTACTTGG + Intronic
995599800 5:113783010-113783032 CTGTCTTCTGAGTGGCAACTTGG + Intergenic
999875029 5:155795082-155795104 CTTTTTACTGAGAGTGAAAATGG + Intergenic
1001781845 5:174375619-174375641 CTCTTCACTGAATAGGAACAAGG + Intergenic
1001892993 5:175355049-175355071 CTGTGAACTGAGTGTGAAGAGGG + Intergenic
1002019457 5:176353604-176353626 CTGTTTCCTTACTGGGAAGACGG + Intronic
1002818625 6:701653-701675 CTCTTTATTCAGTGGGAACAAGG + Intergenic
1004557826 6:16716859-16716881 CTGTGAACTGAATGGCAACAAGG - Intronic
1006125452 6:31834969-31834991 CTGTTGAGTGAGGGGGAGCAGGG + Exonic
1006433257 6:34011413-34011435 CTGTGTACTAAGTGGGACAATGG - Intergenic
1007117948 6:39356984-39357006 CTGCCTCCTGAGTGGGAAGAAGG - Intronic
1007413540 6:41678943-41678965 CTGGTGACAGAGTGGGCACAGGG - Intergenic
1009597970 6:65760782-65760804 CTGTTAACTGAGAGAGAAGAAGG - Intergenic
1010830972 6:80528471-80528493 CTTTTTTCTGAGTGCAAACAAGG - Intergenic
1012864117 6:104596989-104597011 CTGTTTTCTCAGTCGGAAAATGG - Intergenic
1013520108 6:110924794-110924816 CTGTTTACTGTGTGGCACCTGGG + Intergenic
1014591385 6:123276089-123276111 CTCTTTTGTGAATGGGAACAAGG - Intronic
1017072993 6:150592957-150592979 GTGTTTTCTGAGTGGTAAGAAGG - Intergenic
1017635340 6:156437592-156437614 CTGTTTACTTTCTGGGAAGAGGG - Intergenic
1018482239 6:164203112-164203134 ATGTTTACTGAGTGGGAACCTGG + Intergenic
1019871482 7:3767421-3767443 CAGTTTACAGTGTGAGAACATGG + Intronic
1022123396 7:27332310-27332332 CTGGGTACAGAGTGGGAACTGGG - Intergenic
1022495354 7:30849882-30849904 CTGTGTTTTGAGTGGGCACATGG - Intronic
1024252421 7:47516601-47516623 CTGCTTACTGAGTTGGAGCTGGG - Intronic
1028877522 7:95840765-95840787 CTGTTTCCTTAGTGGGCCCAGGG + Intronic
1029274461 7:99396046-99396068 CTGTTTACTGTGTGGCACCCAGG - Exonic
1029649389 7:101880482-101880504 CTGTATAAAGAGTGGGAACTGGG + Intronic
1033046099 7:137963270-137963292 GTGCTGACTAAGTGGGAACAGGG - Intronic
1034830247 7:154302709-154302731 CTCTTTACTGAGAAGGAAAATGG + Intronic
1035670900 8:1416489-1416511 CTGTTTCCTAAGTGAGGACATGG + Intergenic
1044833180 8:96270025-96270047 CTGTTTACTGAGGAGGAAACTGG + Intronic
1045061095 8:98411813-98411835 GTGTTCCCTGAGTGGGACCAAGG + Intronic
1047215751 8:122874673-122874695 CTGTTTTCTCAGTGGTAAAATGG - Intronic
1047528894 8:125657520-125657542 ATGTTTATTGAGTGTTAACAAGG - Intergenic
1047880281 8:129185501-129185523 CTGTTTACTGATAAGGAACCTGG - Intergenic
1048757242 8:137753465-137753487 CCTTTTACTGTGTGAGAACATGG + Intergenic
1049524329 8:143114110-143114132 CTTTTTTCTCAATGGGAACAGGG - Intergenic
1052045432 9:23788625-23788647 CTTTTTACTTAAAGGGAACATGG + Intronic
1052510195 9:29408028-29408050 CTGTTTATTTAGTGGGAAATAGG - Intergenic
1055177262 9:73335508-73335530 CTGTTTATTTTGTGGGAGCAGGG + Intergenic
1060869422 9:127027979-127028001 GTGTTTACTGAGTGTTAAAATGG - Intronic
1061135159 9:128729558-128729580 CTGTGTCCTCAGTGGGCACAGGG + Intergenic
1062050997 9:134447037-134447059 CTGATCACTCTGTGGGAACAAGG - Intergenic
1186126612 X:6421169-6421191 CTGTTTACTGAGACAGAAAATGG - Intergenic
1187034478 X:15523269-15523291 CTGATAACTGAGTGAGAAGATGG - Intronic
1188590319 X:31825434-31825456 ATGCTTACTGAGTGGAAAGATGG - Intronic
1189065197 X:37800263-37800285 CTGTTTCCTGAGTGCTACCATGG - Intronic
1190855899 X:54294643-54294665 CAGTTTGCTGAGCGGGAGCAAGG + Exonic
1192929269 X:75787749-75787771 CTGTTTCTTGAGTGGCATCATGG - Intergenic
1195760781 X:108244049-108244071 CTTTTTTCTGAGTGGGCATATGG + Intronic
1196070754 X:111518905-111518927 CTGTTGCCAGAGTGGGAAAATGG - Intergenic
1196129850 X:112143491-112143513 CTGTATCCTAATTGGGAACAAGG - Intergenic
1198003856 X:132471024-132471046 CTTTTTACAGATGGGGAACATGG - Intronic
1198426513 X:136526128-136526150 CTGTGCACAGAGTTGGAACATGG + Intergenic
1198776812 X:140188401-140188423 GTGTTAACAGGGTGGGAACAGGG - Intergenic
1199681044 X:150224927-150224949 CTGTCTCCTGCGTGGGAACAGGG - Intergenic
1200984616 Y:9292090-9292112 CTGTTTTCTCTGTGGGATCACGG - Intergenic
1201668190 Y:16483341-16483363 CTTTTGTCTGAGTGGGCACATGG + Intergenic
1202125829 Y:21568141-21568163 CTGTTTTCTCTGTGGGATCACGG + Intergenic
1202153172 Y:21861239-21861261 CTGTTTTCTCTGTGGGATCACGG - Intergenic