ID: 1107595716

View in Genome Browser
Species Human (GRCh38)
Location 13:41961033-41961055
Sequence CGGGGACGGCGAGGGGGCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 417}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107595702_1107595716 6 Left 1107595702 13:41961004-41961026 CCGGGATTGCATGGCGCCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 71
Right 1107595716 13:41961033-41961055 CGGGGACGGCGAGGGGGCTCGGG 0: 1
1: 0
2: 2
3: 43
4: 417
1107595696_1107595716 21 Left 1107595696 13:41960989-41961011 CCCGAGGAGTAGAAGCCGGGATT 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1107595716 13:41961033-41961055 CGGGGACGGCGAGGGGGCTCGGG 0: 1
1: 0
2: 2
3: 43
4: 417
1107595695_1107595716 22 Left 1107595695 13:41960988-41961010 CCCCGAGGAGTAGAAGCCGGGAT 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1107595716 13:41961033-41961055 CGGGGACGGCGAGGGGGCTCGGG 0: 1
1: 0
2: 2
3: 43
4: 417
1107595692_1107595716 29 Left 1107595692 13:41960981-41961003 CCGGGTGCCCCGAGGAGTAGAAG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1107595716 13:41961033-41961055 CGGGGACGGCGAGGGGGCTCGGG 0: 1
1: 0
2: 2
3: 43
4: 417
1107595710_1107595716 -10 Left 1107595710 13:41961020-41961042 CCGGGGGGGCTGTCGGGGACGGC 0: 1
1: 0
2: 1
3: 9
4: 204
Right 1107595716 13:41961033-41961055 CGGGGACGGCGAGGGGGCTCGGG 0: 1
1: 0
2: 2
3: 43
4: 417
1107595697_1107595716 20 Left 1107595697 13:41960990-41961012 CCGAGGAGTAGAAGCCGGGATTG 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1107595716 13:41961033-41961055 CGGGGACGGCGAGGGGGCTCGGG 0: 1
1: 0
2: 2
3: 43
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107595716 Original CRISPR CGGGGACGGCGAGGGGGCTC GGG Exonic
900096688 1:942747-942769 CCGGGACGGGGTGGGGGGTCCGG - Exonic
900500830 1:3003744-3003766 TGGGGACCTGGAGGGGGCTCAGG - Intergenic
900513077 1:3069467-3069489 CGGGCTCGGCGCGGAGGCTCGGG + Intronic
901072130 1:6526315-6526337 CAGGGACTGCGAGTGGGCTCTGG - Intronic
901433872 1:9234704-9234726 CGGGGGCGGGGCGGGGGCGCCGG - Intergenic
901737136 1:11319730-11319752 CAGGGACTGAGTGGGGGCTCTGG + Intergenic
902809537 1:18880322-18880344 CTGGGAGGGCGAGCGGGCTCGGG - Intronic
903034294 1:20484788-20484810 CGGGGAAGGCTAGGGTGTTCGGG - Intronic
903468394 1:23568205-23568227 GGGGGGCGGAGAGGGGGCGCCGG - Intergenic
903686327 1:25134962-25134984 TGGGGATGGGGAGGGGGCTTGGG - Intergenic
904005417 1:27360875-27360897 CGCGGAGGGCGAGGGGCCGCGGG - Intronic
904128563 1:28259629-28259651 CGGGAACGGCGAACGGCCTCGGG - Exonic
904623738 1:31790667-31790689 CGGGCTGGGCCAGGGGGCTCTGG + Exonic
906211276 1:44013499-44013521 CGGGGTTGGCGACGGGGCTCTGG + Intronic
907012684 1:50978079-50978101 CGGGGAGGGGGAGCGGGCGCCGG + Intergenic
910884644 1:91951773-91951795 TGGGGAAGGTGAGGTGGCTCAGG + Intronic
912595763 1:110874237-110874259 TGGGGACGGGGAGAGGGCTCTGG + Intronic
913186359 1:116373536-116373558 CGCGCCCGGGGAGGGGGCTCGGG + Intronic
913209394 1:116570615-116570637 GGGGGCCGGCGGGGGGGCGCAGG + Intronic
915528487 1:156490258-156490280 CGGGGACAGAGAGGGGGCAGAGG - Intronic
916107657 1:161442741-161442763 CGGGGGCGGCGATGGGGAACGGG - Intergenic
916109241 1:161450159-161450181 CGGGGGCGGCGATGGGGAACGGG - Intergenic
916110827 1:161457540-161457562 CGGGGGCGGCGATGGGGAACGGG - Intergenic
916112414 1:161464950-161464972 CGGGGGCGGCGATGGGGAACGGG - Intergenic
916113999 1:161472331-161472353 CGGGGGCGGCGATGGGGAACGGG - Intergenic
917975631 1:180235766-180235788 CGGGGAAGGCGAGGTGGCGCGGG + Intronic
919465738 1:197920237-197920259 AGGGGACGGAGAGGGGATTCCGG - Intronic
923007903 1:230067035-230067057 CGGAGGCGGCGAGGGGGGTCAGG - Intronic
1062843892 10:690015-690037 CGGGGGCGGGTTGGGGGCTCGGG + Intergenic
1062930427 10:1348953-1348975 GGGGGAAGGAGAGAGGGCTCAGG + Intronic
1062931322 10:1354599-1354621 GGGCGAAGGAGAGGGGGCTCAGG + Intronic
1063108625 10:3015744-3015766 CTGTGACGGCGAGAGCGCTCTGG + Intergenic
1065024377 10:21526585-21526607 CGGGGGCGTCGAGGGCTCTCGGG - Intergenic
1065186613 10:23174906-23174928 GGGGGCCGGGGAGGGGCCTCCGG + Intergenic
1068845161 10:61663230-61663252 CGGGGCCGGCTGGGGGGCGCCGG - Intronic
1068978006 10:63032671-63032693 CGGGCAGGGCGCGGTGGCTCAGG - Intergenic
1070032653 10:72692326-72692348 CGGGGAGGGCGGGGCGGCGCTGG + Intronic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1070906564 10:80078604-80078626 CGGGGATGGCGAGGGAGCGCGGG + Intergenic
1071085321 10:81862779-81862801 CGGGCACGGTGGGGAGGCTCAGG + Intergenic
1071527491 10:86366736-86366758 CCGGGCCGGCGTGGCGGCTCTGG + Intergenic
1072731675 10:97850512-97850534 CGCGGACAGCTTGGGGGCTCAGG - Intronic
1073491448 10:103855616-103855638 AGGGGACGGGGCGGGGGCCCCGG + Intergenic
1075519764 10:123136483-123136505 CGGGGACGGGGCGGGCGCGCAGG - Intronic
1075603486 10:123787850-123787872 CGGGGATGGCGGAGGGGCTGGGG + Intronic
1075728679 10:124623523-124623545 CGTGGCGGGCGAAGGGGCTCTGG + Exonic
1075769027 10:124917461-124917483 CGGGGACGGCCCGGGGGCTGTGG + Intergenic
1076649767 10:131979928-131979950 CCGGGACGGAGCGGTGGCTCAGG - Intronic
1076649828 10:131980207-131980229 CTGGGAGGTGGAGGGGGCTCCGG - Intronic
1076699717 10:132265160-132265182 CCAGGGCGGCGAGGTGGCTCTGG + Intronic
1076778615 10:132711567-132711589 CGGGGGCTGGGCGGGGGCTCAGG - Intronic
1076895361 10:133308836-133308858 CGGGGGCTGCGCGGGGGCTGTGG - Exonic
1077106033 11:843048-843070 GGGGTCCGGCGCGGGGGCTCGGG + Intronic
1077158446 11:1101937-1101959 CGGGGAGGGCCTGGGGGCCCCGG - Intergenic
1077230849 11:1457595-1457617 CTGGTACGGCGTGGGGGCGCTGG + Intronic
1078422090 11:11220826-11220848 CGGGGTCGGGGAGTGGGGTCTGG + Intergenic
1078526412 11:12104887-12104909 GGGGGACAGCGAGGAGGCTGAGG - Intronic
1079128928 11:17736338-17736360 CCGCGACGCCGAGGAGGCTCTGG + Exonic
1079730013 11:23928835-23928857 CGGGGAGGGAGAGGGGACTGGGG - Intergenic
1081636772 11:44727043-44727065 CGGGGCCGGGGCTGGGGCTCGGG - Intronic
1081786493 11:45751378-45751400 CTGGGAAGGGGAGAGGGCTCAGG - Intergenic
1082025109 11:47565815-47565837 CGGGGACGGGGCAGGGGCCCGGG - Intronic
1083303271 11:61749835-61749857 CGGGGGCGGTGAGGGAGCTGCGG + Intergenic
1083592768 11:63904982-63905004 CAGGGCCGGCGGGGGGCCTCTGG + Exonic
1083795442 11:65014180-65014202 CGGCGGCCGGGAGGGGGCTCCGG + Exonic
1084191997 11:67503669-67503691 ATGGGAGGGCGAGGAGGCTCTGG - Intronic
1084527058 11:69704170-69704192 CGGGCCCGGGGAGGGGGCTGGGG - Exonic
1084602808 11:70156183-70156205 CGGGGACGGGGGTGGGGCTCTGG + Intronic
1084762412 11:71282532-71282554 GGGGGACGGGGACGGGGCCCAGG - Intergenic
1084973049 11:72781736-72781758 CCGGGGCCGCGCGGGGGCTCTGG + Intronic
1085011079 11:73142145-73142167 CGGAGACGGCGAGGGGGCGGGGG + Exonic
1085307699 11:75497478-75497500 CCTGGACAGTGAGGGGGCTCTGG + Intronic
1085521869 11:77143833-77143855 TGGGGACGACGGGAGGGCTCAGG + Intronic
1087773457 11:102236385-102236407 GGGGCACGGCGTGGTGGCTCAGG - Intergenic
1088332175 11:108665347-108665369 CGGCGCTGGGGAGGGGGCTCGGG + Intronic
1088481684 11:110301029-110301051 CGGAGAAGGCGGGGAGGCTCAGG + Intergenic
1091550051 12:1530277-1530299 CGGGGGCGGGGAGGAGGCGCGGG + Intronic
1091558701 12:1594492-1594514 GGCGGGCGGCGAGGGGGCCCCGG + Intronic
1091587814 12:1826395-1826417 CGGGGGGGGGGGGGGGGCTCTGG - Intronic
1091694263 12:2617377-2617399 TAGGGAGGGCCAGGGGGCTCTGG + Intronic
1093894687 12:24562738-24562760 CGGGGGCGGGGGGGGGGCGCGGG + Intergenic
1094839986 12:34338860-34338882 CAGGGATGGCGTGGGGGCTGCGG - Intergenic
1096078396 12:48818600-48818622 CGGGGGCGGCGAGGGGGCGGCGG - Intronic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096253748 12:50050789-50050811 CGGGGAGGGGGAGGGGGCGAGGG - Intergenic
1096656680 12:53096786-53096808 CGGGGATGGGGAGGGGGGTGGGG + Intergenic
1096843667 12:54393565-54393587 CAGGGAGGGGGAGGGGGCTCAGG - Intergenic
1097155062 12:57006420-57006442 CGGCGGCGGCGATGGTGCTCGGG - Exonic
1097787858 12:63780318-63780340 CGGGGACGGCGTGTGAGATCTGG - Intronic
1098487543 12:71039379-71039401 TGGGGACAGCTAGGGGACTCAGG - Intergenic
1101387819 12:104273310-104273332 CGGGCAGGGCGGGGTGGCTCAGG + Intronic
1101469933 12:104986587-104986609 CGGGGACTGCTGCGGGGCTCCGG + Intronic
1102026009 12:109714637-109714659 CGGGGGCCGCGCGGGCGCTCAGG - Exonic
1102997423 12:117361083-117361105 TGGGGACGGAGAAGGGGCGCGGG + Intronic
1103973692 12:124688366-124688388 GGGGGAGGAGGAGGGGGCTCTGG - Intergenic
1104545194 12:129704650-129704672 GGGGGACGGTGAGGATGCTCTGG - Intronic
1104826230 12:131711364-131711386 CCGGGACGACGAGCGGGCCCTGG + Exonic
1104939240 12:132387096-132387118 CTGGGATGGGGAGAGGGCTCTGG + Intergenic
1104961235 12:132489636-132489658 CGAGGAGGACGAGGGGCCTCCGG - Exonic
1105031528 12:132887519-132887541 CGCGGCTGGCGAGGGGGCTGCGG - Intronic
1105071333 12:133235853-133235875 CGGGGCTGGCGAGGAGGCGCTGG + Exonic
1105557245 13:21459017-21459039 CGGGGACTGCGGCGGGGCGCGGG - Intronic
1105918803 13:24941590-24941612 CGGGGGAGGGGAGGGGGCCCGGG - Intergenic
1105975400 13:25468602-25468624 CGGGGACGGCGGGGGCGCCAAGG - Intronic
1107595716 13:41961033-41961055 CGGGGACGGCGAGGGGGCTCGGG + Exonic
1108615724 13:52129798-52129820 CAGGGACGGGGAGGGGGCGGCGG - Intergenic
1110249589 13:73366671-73366693 CAAGGCCGGCGAGGTGGCTCAGG + Intergenic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1111957761 13:94776578-94776600 CGGGGAAGAGCAGGGGGCTCGGG - Intergenic
1112310858 13:98316511-98316533 CCTGGATGGGGAGGGGGCTCCGG - Intronic
1113800996 13:113086141-113086163 CAGGAACTGCGAGGGGGCTGAGG + Exonic
1113809475 13:113129655-113129677 CGGGGCCAGCGAGGGCGCTGTGG - Intronic
1114651175 14:24285385-24285407 CTGGGAAGGGGTGGGGGCTCTGG + Intergenic
1116817832 14:49599707-49599729 CCGGGACGGGGAGAGGGCGCGGG + Intronic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1118809216 14:69261212-69261234 CGGGGGCGGCGGCGGGGCTGCGG + Intronic
1118932427 14:70255059-70255081 CGGGGAGGGGGTGGGGGCTCAGG - Intergenic
1118932442 14:70255091-70255113 CGGGGAGGGGGTGGGGGCTCAGG - Intergenic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1121080141 14:91101294-91101316 AGGGGTCGGGGAGGGGGCTAAGG - Intronic
1121279114 14:92687112-92687134 CGGGGAAGGCGAGGCCGCTCCGG + Intronic
1122081645 14:99271114-99271136 AGGGGCCGGAGATGGGGCTCCGG - Intronic
1122418547 14:101561529-101561551 CGGAGAGGGCGAGGGGTCCCAGG + Exonic
1122421437 14:101579871-101579893 GGGGGACAGCCAGGGAGCTCAGG - Intergenic
1122464134 14:101918638-101918660 CGAGGGGGGCGAGGGGGGTCAGG - Intronic
1122782630 14:104150120-104150142 GGGGGACGGGGAGGGGGACCAGG - Intronic
1122809637 14:104281628-104281650 CAGGGAGGGCTTGGGGGCTCAGG - Intergenic
1122817752 14:104321892-104321914 CTGGGAGGGCGAGTGGCCTCGGG + Intergenic
1123025068 14:105420326-105420348 CGGGGGTGGCGGGGGGGCGCGGG + Intronic
1123051912 14:105548096-105548118 GGGGGGCGGCGGGGAGGCTCAGG - Intergenic
1124100336 15:26687032-26687054 CAGGGATGGCGAGCTGGCTCTGG + Intronic
1124848009 15:33310695-33310717 CGGGGGCGGTGCGGGGGCCCTGG - Intergenic
1125200597 15:37098211-37098233 CGGGAAGGGGGAGGGGGCGCAGG + Intronic
1126736621 15:51737542-51737564 CGGCGGCGGCGAGGGGGCCGAGG + Exonic
1126786213 15:52179688-52179710 CGGGGACGGCGGGGGCGGTGGGG - Intronic
1127893784 15:63277466-63277488 CGGGGACGGGGGCGGGGCTCGGG - Intronic
1128078308 15:64841814-64841836 CGGGGCCGGGGAGGGGGCGGTGG - Intergenic
1128153550 15:65377868-65377890 CGGGGCCGGGGCTGGGGCTCCGG + Exonic
1129661718 15:77556465-77556487 CGAGGGCAGCCAGGGGGCTCTGG - Intergenic
1131250276 15:90825739-90825761 TGGGGAGGGGGAGGAGGCTCAGG - Intergenic
1132523502 16:402100-402122 CGGGGACCACGTGGGGGCGCCGG - Intronic
1132609962 16:810720-810742 CCGGGACGTCCAGTGGGCTCTGG + Intronic
1132683399 16:1152885-1152907 CGGGGGCGTGGAGGGGGCGCGGG + Intergenic
1132828895 16:1918138-1918160 GGGGGCCGGCGCGGGGGCGCGGG + Exonic
1132934579 16:2474210-2474232 CGGGGACGGGGCGGCGGCCCAGG - Intergenic
1133362624 16:5186456-5186478 CGGAGGCGGCGGGGAGGCTCAGG + Intergenic
1133770891 16:8866878-8866900 CGGGGCCTGGGAGGGGGCTCTGG - Intronic
1134821661 16:17251927-17251949 TGGGGACAGGGAGGGGGCTGGGG + Intronic
1136236133 16:28914646-28914668 AGGGCACGGCCAGGGGGCGCTGG - Intronic
1136242687 16:28954111-28954133 TGTGGAGGGCGAGGGGGCTGAGG - Intronic
1137576988 16:49606552-49606574 TGGGGATGCCCAGGGGGCTCAGG + Intronic
1137708012 16:50548605-50548627 CGGCGACGGCGGCGGGGCCCGGG - Intronic
1138360580 16:56424880-56424902 CGGGGAGGGGGAGGGGGCCGCGG - Intronic
1138507710 16:57486423-57486445 CGGGGACGGCGAGGGAGGCGCGG + Exonic
1139960382 16:70714138-70714160 GGGGGTCGGGGAGGGGGCTGGGG + Intronic
1140442544 16:74998976-74998998 GGGGGAGGGGGAGGGGGCGCGGG + Intronic
1141972264 16:87492282-87492304 CGGGGGCGGCCGGGGGGCGCCGG + Intergenic
1141972366 16:87492497-87492519 CGGGGGCGGCGAGCGGCCTCGGG + Intergenic
1142049961 16:87951673-87951695 CGGGGACGGGGAGCGGGGCCCGG - Intronic
1142287557 16:89177569-89177591 AGGGGACGGGGAGAGGGCACAGG + Intronic
1142304482 16:89277900-89277922 CCAGCACGGCGAGGGGCCTCAGG + Intronic
1142567582 17:850630-850652 GGGGGGCGGCGTGGGGGCCCCGG + Intronic
1142592529 17:1012609-1012631 CGGGGAGGGCTGGGGGGCCCGGG + Intronic
1142690763 17:1605123-1605145 CAGAGGCGGCGAGGGGGCTGTGG - Intronic
1142795412 17:2303520-2303542 GGGGGAAGGGGCGGGGGCTCCGG + Intronic
1142808696 17:2385324-2385346 CTGGGCCGGCGAGGGGGCCGGGG - Exonic
1143485563 17:7251860-7251882 CGGGGAGGGGGAGGCCGCTCCGG - Intronic
1143519357 17:7436898-7436920 AGGAGGCGGCGAGGGGGCTCAGG - Exonic
1143706538 17:8701542-8701564 CGTGGACAGCAAGGGGGCCCTGG - Intergenic
1143708621 17:8718169-8718191 CGGTGGCGGCGGGGAGGCTCAGG + Intergenic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1146371263 17:32266557-32266579 CAGCGGCGGGGAGGGGGCTCCGG - Intronic
1146925276 17:36740170-36740192 CTGGGACGGCAAGGGGACTGGGG - Intergenic
1147970905 17:44218875-44218897 CGGGGACGGCGAAGGGAGCCCGG - Intronic
1148048781 17:44759282-44759304 CGGGGGCAGGGAGGGGGCGCCGG - Intronic
1148183968 17:45627887-45627909 GGGGGCCGGAGAGGGGGATCAGG + Intergenic
1148437317 17:47694395-47694417 CGGGGCCGGGGAAGGGGCTCCGG - Intronic
1149659084 17:58325017-58325039 CAGGGACAGGGAGGGGACTCAGG + Intronic
1149772409 17:59331989-59332011 CGGGGACGGGGAGCGGCCGCCGG + Intronic
1150108323 17:62478345-62478367 GGGGGCCGGCGAGGCGGATCCGG + Intronic
1151169928 17:72237385-72237407 CGGAGATGGAGAGGGGGCACAGG + Intergenic
1151460092 17:74249247-74249269 CAGGGACGGGGAGGGAGGTCTGG + Intronic
1151728061 17:75895835-75895857 TGTGGAGGGCGAGGGGGCTATGG - Intronic
1151894172 17:76969039-76969061 CGGGGAGGGCGTCGGGGGTCGGG + Intergenic
1152015339 17:77746971-77746993 TGGGGAGGCGGAGGGGGCTCTGG - Intergenic
1152362993 17:79840921-79840943 TGGGGACCGCACGGGGGCTCGGG + Intergenic
1152462595 17:80449382-80449404 CGGGGACGGCAGCGGGGCCCTGG + Intergenic
1152502408 17:80721140-80721162 CTGGGAGTGCGAGGGGGCTCTGG + Intronic
1152638213 17:81438835-81438857 CGGGGATGGTGGGGTGGCTCAGG + Intronic
1152690740 17:81716630-81716652 CGGGGCGGGCGAGGTGGCTGTGG + Intronic
1152870445 17:82751000-82751022 CGGGGACGGAGATGGGGGACGGG - Exonic
1152900009 17:82935467-82935489 TGGGGGCGGGGAGGGGGCACTGG - Intronic
1153457319 18:5295567-5295589 GCGGGCCGGCGAGCGGGCTCGGG - Intronic
1155053906 18:22169337-22169359 AGGGGACGGCGAGGGGGGAGGGG - Intergenic
1158137616 18:54224288-54224310 CGGGGACGGGGACGGGGCCGGGG - Exonic
1160508390 18:79439975-79439997 CGGGGAAGGCGTGTGGCCTCTGG + Intronic
1160697065 19:489772-489794 CAGGGACGGAGAGCGCGCTCGGG + Intronic
1160698851 19:496917-496939 CGGGAGAGGGGAGGGGGCTCGGG + Intronic
1160698970 19:497280-497302 CGGGAGAGGGGAGGGGGCTCGGG + Intronic
1160718733 19:588553-588575 CGGGGCCGGCGTGGGGGCGCAGG + Intergenic
1160726796 19:620982-621004 GGGGGAGGGCGCGGGGGCGCCGG + Intronic
1160763546 19:797522-797544 CGGGGAGGGCGGTGGGGCGCGGG - Intronic
1160768925 19:821789-821811 CGAGGAGGGCGGGGGGTCTCCGG + Intronic
1160773470 19:844064-844086 GGGGCACGGCCAGAGGGCTCCGG + Intronic
1160886844 19:1354137-1354159 GGGGGCTGGCGAGGTGGCTCAGG + Intergenic
1160930503 19:1567761-1567783 CGCGGACGGCGGGGCGGCTCCGG - Exonic
1160997055 19:1887497-1887519 CTGGGACGGAGCGGGGGCTGCGG - Intergenic
1161042740 19:2118672-2118694 CGGGGAGGCAGAGGGCGCTCAGG - Exonic
1161349398 19:3783781-3783803 CAGGGACGGGGTGGGGCCTCTGG + Intronic
1161461434 19:4400150-4400172 CGGGGGCGACGAGGTGGCCCAGG - Intronic
1161800727 19:6415639-6415661 CGGGGCCGGGGACGGGGCCCGGG + Exonic
1162069849 19:8147190-8147212 CGGGGACAGCGAGATGGGTCTGG + Intronic
1162145508 19:8610655-8610677 CGGCGACGGCGCGGAGGCCCCGG - Intronic
1162535910 19:11262632-11262654 TGGGGACGGAGAGGAGGCCCCGG + Intergenic
1162817920 19:13207543-13207565 CGGGGGCGGCGAGGAGGCCATGG - Exonic
1163117970 19:15199916-15199938 CTGGGCCGGGGAGGGGGCTGCGG - Intronic
1163206594 19:15807830-15807852 CGGAGACGGAGAGGGCGCACAGG + Exonic
1163466447 19:17470785-17470807 CGGGGACGGCTTGGAGGGTCCGG + Intronic
1163632573 19:18424876-18424898 TGGGGAAGGGGTGGGGGCTCAGG + Intronic
1163748930 19:19064039-19064061 CCGGGCCGGTGAGGGGGCGCGGG + Exonic
1163820472 19:19493731-19493753 GGGGGGCGGGGAGGGGGCGCGGG - Intronic
1163861960 19:19747459-19747481 CTGGGACGGGGACTGGGCTCTGG + Intergenic
1165227463 19:34365107-34365129 CGGGGGCGGGGCCGGGGCTCAGG + Intronic
1165274284 19:34734398-34734420 CGGGGGCGGCGGCGGGGCTCAGG + Intronic
1165353973 19:35292380-35292402 CTGGGGCAGCGATGGGGCTCTGG + Intronic
1165995502 19:39840706-39840728 CGTGGAGGCCGAGGGGGCTTTGG - Exonic
1166306946 19:41940521-41940543 CAGGAAAGGGGAGGGGGCTCAGG + Intergenic
1166364002 19:42269454-42269476 CAGGGACGGGGAGGGGGTACAGG + Intronic
1166569450 19:43784588-43784610 GGGGGAGGGCGAGGTGACTCAGG + Intergenic
1166871343 19:45872797-45872819 CGGGGAAGATGTGGGGGCTCTGG + Exonic
1166892097 19:46000079-46000101 CGGGAGGGGAGAGGGGGCTCAGG + Intronic
1167077045 19:47256582-47256604 CGCGGACGCCGCGGGGTCTCCGG + Exonic
1167492913 19:49802219-49802241 CGGGGGCGGGGGAGGGGCTCAGG - Intronic
1167494301 19:49808864-49808886 CGGGGCCGGCGGGGGAGGTCGGG + Intronic
1167596796 19:50432317-50432339 CGGGGAGGGCGCCGCGGCTCTGG - Intergenic
1168241949 19:55092902-55092924 CAGGCACCGAGAGGGGGCTCTGG - Intronic
925012699 2:497400-497422 CGGGGCCAGGGAGGGGGCGCAGG + Intergenic
925448545 2:3949300-3949322 TGGGGACCGCGAGGAGCCTCAGG + Intergenic
926581492 2:14635149-14635171 CGGGAACGGGGAAGGGGCTGAGG + Exonic
929526367 2:42706976-42706998 CGGGGAGGAGGAGGGGGCTGGGG - Intronic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
930700749 2:54456492-54456514 CGGGGATGGGGTGGGGGCGCCGG - Exonic
931309637 2:61066032-61066054 GCGAGACGCCGAGGGGGCTCGGG + Intronic
931710881 2:64988806-64988828 CGGGCGCGGTGAGGGGGCCCGGG - Intronic
931728227 2:65130600-65130622 CGGGGGCGGGGAGGGGGCCGGGG + Intergenic
932835023 2:75028070-75028092 CTGGGGCAGCCAGGGGGCTCTGG + Intergenic
934933225 2:98445139-98445161 CGGGGACGGACAGCGGGCGCGGG + Intronic
934993186 2:98935863-98935885 CGGGGTGGGCGCGGGGGCACCGG - Intronic
935029934 2:99312023-99312045 CTGGGAGGCTGAGGGGGCTCAGG + Intronic
935265192 2:101387547-101387569 CAGGGGCGGGAAGGGGGCTCGGG - Exonic
935763488 2:106342780-106342802 CGGGGACGCCTGGGAGGCTCTGG - Intergenic
935820223 2:106886677-106886699 CGCGGAGAGGGAGGGGGCTCTGG - Intronic
937099473 2:119257738-119257760 AGGGGAGGGTGATGGGGCTCAGG - Intronic
937224901 2:120363159-120363181 TGGGGAAGGTGAGGGAGCTCTGG - Intergenic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
938548014 2:132352842-132352864 CTGGGAGCGCGAGCGGGCTCGGG - Intergenic
939900516 2:147844633-147844655 CGGTGGCGGCGAGGCGGCTGCGG - Exonic
941476088 2:165953595-165953617 CGGGGGCGCGGAGGGAGCTCGGG - Intronic
942565714 2:177264006-177264028 GGGGCGCGGCGAAGGGGCTCCGG + Intronic
946182571 2:217957367-217957389 CCAGGAAGGAGAGGGGGCTCTGG - Intronic
947593097 2:231396024-231396046 GGGGGACGTCGAGGGGTCTCGGG + Intronic
947744876 2:232502293-232502315 CGGGCAAGGGGAGGGGGCTGCGG + Intergenic
948460630 2:238128432-238128454 AGGGGACGGGGAGGGACCTCTGG + Intronic
948716964 2:239871437-239871459 CGGGGATGGGGAGGGGGATGGGG - Intergenic
948809132 2:240466035-240466057 CTGGGAAGGAGAGGAGGCTCCGG - Intronic
1168760484 20:347060-347082 CGGGGCGGGGGAGGGGGCGCCGG - Exonic
1169264720 20:4160923-4160945 CGGGGAGGGGGTGGGGTCTCCGG - Intronic
1170617855 20:17968631-17968653 CGGGGACTGGGAGGCTGCTCTGG - Intronic
1171876880 20:30585614-30585636 CTGGGAGCGCGAGCGGGCTCGGG - Intergenic
1172359546 20:34302801-34302823 CAGGGACGGCGAGGGCACCCCGG - Intronic
1172474570 20:35226999-35227021 CGGGGCCGGGGCGCGGGCTCGGG + Intronic
1172941043 20:38654947-38654969 TGGGGAGAGAGAGGGGGCTCTGG - Intergenic
1174064085 20:47852204-47852226 CGGGGGCAGTGAGGAGGCTCTGG + Intergenic
1174172684 20:48627244-48627266 AGGGCACGGGGCGGGGGCTCAGG + Intronic
1174357828 20:50010113-50010135 CGGCGGCGGCGAGGGGGCGGCGG + Intergenic
1175215909 20:57391623-57391645 CGGGGGCGGCCAGGGGCCGCGGG - Exonic
1175718407 20:61270826-61270848 CGGGGAGGTCGAGGCAGCTCTGG + Intronic
1175771631 20:61627936-61627958 TGGGGAAGGCCAGGGGGCCCAGG - Intronic
1176005667 20:62861211-62861233 CGGGGACGGAGCGAGGGCCCGGG - Exonic
1176128965 20:63488219-63488241 CGGGGGCGGGGCGGGGGCCCGGG + Exonic
1176148008 20:63574067-63574089 CGGGGGCGGAGGGGGGGGTCCGG - Intronic
1176157159 20:63627554-63627576 CGTGGAGGGCGAGGGGCATCCGG + Intergenic
1176178880 20:63740474-63740496 CGGGGGCGGCGGCGGGGCCCCGG + Exonic
1176373429 21:6075910-6075932 TGGGGAGGGCAAGGGGGCCCAGG + Intergenic
1176550258 21:8217850-8217872 CGGGGACACCGGGGGGGCGCCGG - Intergenic
1176569186 21:8400888-8400910 CGGGGACACCGGGGGGGCGCCGG - Intergenic
1176577100 21:8445120-8445142 CGGGGACACCGGGGGGGCGCCGG - Intergenic
1179150575 21:38805643-38805665 CGGAGGCGGCGAGGGAGCGCGGG - Intronic
1179674948 21:42974830-42974852 AGGGGGCGGGGAGGGGGCGCGGG + Intronic
1179750048 21:43462333-43462355 TGGGGAGGGCAAGGGGGCCCAGG - Intergenic
1179882666 21:44300043-44300065 CGGGGACGGCGACGCGGCGCAGG + Exonic
1180095462 21:45553991-45554013 GGGGGACTGGGAGGGGGCGCGGG - Intergenic
1180095480 21:45554032-45554054 GGGGGACTGGGAGGGGGCGCGGG - Intergenic
1180095606 21:45554295-45554317 GGGGGACTGGGAGGGGGCGCGGG - Intergenic
1180762268 22:18219841-18219863 CGGGTGCGGGGAGGGGGCGCAGG - Intergenic
1180773399 22:18404767-18404789 CGGGTGCGGGGAGGGGGCGCAGG + Intergenic
1180804750 22:18654316-18654338 CGGGTGCGGGGAGGGGGCGCAGG + Intergenic
1180805994 22:18715094-18715116 CGGGTGCGGGGAGGGGGCGCAGG - Intergenic
1181192495 22:21151700-21151722 CGGGTGCGGGGAGGGGGCGCAGG + Intergenic
1181216944 22:21340875-21340897 CGGGTGCGGGGAGGGGGCGCAGG - Intergenic
1181531839 22:23521604-23521626 CGGGGTCGCCGAGGGGACGCGGG - Intergenic
1181902760 22:26169608-26169630 GGCGGACGGCGAGGGAGCTGGGG - Exonic
1182678778 22:32061864-32061886 TGGGGACAGAGATGGGGCTCAGG + Intronic
1183035950 22:35141259-35141281 AGGGTACAGCGAGGGGGCCCTGG - Intergenic
1183273636 22:36877664-36877686 CCGGGACGCTGAGGGGGATCTGG + Exonic
1183942407 22:41302798-41302820 CGGGGAAGACTAGGGGGCTAGGG + Intronic
1184046759 22:41976873-41976895 CGGGGAGGGCGCGGCGGCGCGGG + Exonic
1184071541 22:42150433-42150455 TGGGGTCGGAGAGGGTGCTCTGG - Intergenic
1184153153 22:42649817-42649839 CGCCGCCGGCGAGGAGGCTCCGG - Intergenic
1184168279 22:42743463-42743485 CGGGGAAGGTGAGAGGGCGCAGG - Intergenic
1184413280 22:44338021-44338043 CGGGCAGGGTGAGGGGGCTCCGG + Intergenic
1184471030 22:44696518-44696540 AGGGGCCGGGGAGGGGGCTCTGG - Intronic
1184580490 22:45413412-45413434 CTGGGACGGCGGAGGCGCTCCGG + Intronic
1184924565 22:47627795-47627817 CGGGGGCGGGGAGAGGGCTGGGG + Intergenic
1184944906 22:47796076-47796098 CAGGGAAGGAGAGAGGGCTCAGG + Intergenic
1185232939 22:49693747-49693769 AGGGAACGGCGGGGGGGGTCTGG + Intergenic
1203235229 22_KI270731v1_random:145749-145771 CGGGTGCGGGGAGGGGGCGCAGG + Intergenic
1203255153 22_KI270733v1_random:134188-134210 CGGGGACACCGGGGGGGCGCCGG - Intergenic
1203263209 22_KI270733v1_random:179267-179289 CGGGGACACCGGGGGGGCGCCGG - Intergenic
950708942 3:14801696-14801718 CAGGGACTTCGTGGGGGCTCAGG + Intergenic
952473917 3:33685802-33685824 TGGGGAGGGGGAGGGGGCGCCGG + Intronic
953969704 3:47337546-47337568 GGGTAACGGCCAGGGGGCTCTGG - Intronic
954076833 3:48187913-48187935 CGGCGGCGGTGCGGGGGCTCCGG + Exonic
954366846 3:50151013-50151035 GGGGGCTGGAGAGGGGGCTCGGG - Intergenic
954468920 3:50675147-50675169 CGGGGACGGTCAGGCGGCGCGGG - Intergenic
954680407 3:52342964-52342986 TGGGGAAGACGAGGGGTCTCAGG + Intronic
956322087 3:68008115-68008137 CAGGGAAGGCGAGGGGGCGCTGG + Intronic
956534673 3:70262494-70262516 TGGGGATGGCTTGGGGGCTCTGG + Intergenic
956825810 3:72996390-72996412 CGAGGCCGGGCAGGGGGCTCAGG - Intronic
957078623 3:75619592-75619614 TGGGGACGGCGAGGAGGCGGAGG - Intergenic
960902212 3:122564393-122564415 TCGGGAGGGCGCGGGGGCTCCGG - Exonic
966595395 3:181720606-181720628 GGGGGGCGGCCAGGGGCCTCGGG - Intergenic
966911414 3:184562240-184562262 CGGCGGCGGCGGGCGGGCTCTGG - Exonic
967891231 3:194365864-194365886 CAGGGACTGGGAGGGGCCTCTGG + Intronic
967939782 3:194756930-194756952 CAGGGACGGCCAGAGGGCTGCGG - Intergenic
968225436 3:196969519-196969541 CGGGGTCGGCGACGGCGCGCGGG + Intergenic
968556226 4:1247762-1247784 CGGGGAGGGGGGGGGGGCTCGGG + Intronic
968645762 4:1739858-1739880 CAGGGATGGCGAGGGGGATGGGG - Intronic
968698532 4:2043995-2044017 CGGGGGCGACGCAGGGGCTCTGG - Intergenic
968729094 4:2261430-2261452 CGGGGGCGGGGAGCGGGCGCGGG + Intronic
968746955 4:2365149-2365171 GGGGGACGGGGAGGGGGCAGGGG + Intronic
968756407 4:2418420-2418442 CTGCGACAGCGCGGGGGCTCCGG - Exonic
968775386 4:2536836-2536858 CGGGGAAGGCGGGGAGGCTGAGG - Intronic
969240383 4:5893128-5893150 CGGGGCCGGGGCGGGGCCTCTGG + Intergenic
969561403 4:7950511-7950533 CGGGGACAGGGAGGGGGCCGAGG - Intergenic
971757452 4:30721366-30721388 GGGGGGCGCCGAGGGGGCTGTGG + Exonic
972621325 4:40750337-40750359 TGGGGACGCGGACGGGGCTCCGG + Intronic
976475269 4:85475643-85475665 GGGGGGCGGGGAGGGGGCTGCGG + Intronic
976475281 4:85475664-85475686 GGGGGGCGGGGAGGGGGCTGCGG + Intronic
976475293 4:85475685-85475707 GGGGGGCGGGGAGGGGGCTGCGG + Intronic
976475305 4:85475706-85475728 GGGGGGCGGGGAGGGGGCTGCGG + Intronic
978366628 4:107989802-107989824 CGGGGACGCCGGGGGCGCGCGGG + Exonic
981128440 4:141132818-141132840 CGGGGGCGGGGAGGGGGCCCCGG - Exonic
981474995 4:145179755-145179777 CGGGGACGGCCCGGCGGGTCTGG - Intronic
984337750 4:178415037-178415059 TGGGGGCGGGGAGGGGGCGCGGG + Intergenic
984995451 4:185426038-185426060 CGCGGACGGCGAGGCGGGGCGGG + Intergenic
985520961 5:373758-373780 CGGGGTCCGCGCGGGCGCTCCGG - Intronic
987050491 5:14143815-14143837 CGGTGCCGGCGAGGGGGCAGAGG + Exonic
987132491 5:14872073-14872095 CGGGGACGGTCTGGGGGCTTGGG + Intergenic
990557776 5:56952288-56952310 CGGGGGCGGCGAGGGGCGCCGGG - Intronic
990955320 5:61333343-61333365 CGGGGCGGGGGAGGGGGCGCGGG + Intronic
997322554 5:132990634-132990656 CAGGGAAGGTGAGGTGGCTCAGG + Intergenic
997370813 5:133358466-133358488 CAGGGAGGGCGAGGGGGCCTGGG + Intronic
997445263 5:133935655-133935677 TGGGGAGGGCGAGGGGCCTGAGG - Intergenic
997521380 5:134526332-134526354 CCGGGCCGGCGAGGGGGCGCGGG + Intronic
997580096 5:135011783-135011805 GGGGGACGGGGAGTTGGCTCTGG - Intergenic
1001395899 5:171419593-171419615 CGCGGGCGGCGAGGGGGCGGGGG - Intergenic
1001647802 5:173295194-173295216 CGGGGTGGGCAAGTGGGCTCAGG + Intergenic
1002696893 5:181098087-181098109 CGTGCACGGCGAGGCTGCTCGGG - Intergenic
1002697729 5:181101286-181101308 CGTGCACGGCGAGGCTGCTCGGG + Intergenic
1002927780 6:1614758-1614780 CGGGGACGGGGACGGGGCGGGGG + Intergenic
1006300723 6:33192488-33192510 CGGGGGCGAGGTGGGGGCTCTGG - Exonic
1006301642 6:33196547-33196569 TGGGGATGGGGAGGGGGCTGGGG - Exonic
1006317440 6:33298840-33298862 CGGGGACGCGCAGGGTGCTCAGG + Intronic
1006338653 6:33433697-33433719 CGGGGGCGGGGGGGGGGGTCCGG + Intronic
1006339344 6:33438040-33438062 TCGGGAGGGGGAGGGGGCTCGGG + Exonic
1006634281 6:35451279-35451301 TGTGGAGGGCGGGGGGGCTCTGG - Intergenic
1007485627 6:42178888-42178910 CGGGGATGGTGAGGGGGCCGAGG + Exonic
1007902542 6:45423846-45423868 AGGGGACGGGGCGGGAGCTCGGG + Intronic
1009905631 6:69867351-69867373 CGGGGACGGCGGCGGCGCTGTGG - Intronic
1011640435 6:89412185-89412207 CGGGGCGGGGGAGGGGGCTTCGG - Exonic
1012676092 6:102114994-102115016 CAGGAAGGGCGAGGTGGCTCAGG + Intergenic
1015795677 6:137008634-137008656 TGAGCACGGCGAGGGGGCCCTGG + Exonic
1015999512 6:139028978-139029000 AGGGGGCCGGGAGGGGGCTCAGG + Intronic
1017913920 6:158818310-158818332 CGGGCATGGGGAGGGGGCACGGG + Intronic
1019475105 7:1240651-1240673 TGGGGACGGGGCGGGGGCTGTGG + Intergenic
1019556544 7:1634305-1634327 CGGGGATGGAGAGGGAGATCCGG - Intergenic
1019925086 7:4186530-4186552 TGGGGAAGGCGAGCCGGCTCCGG - Intronic
1022207772 7:28180273-28180295 GGGGGGCGGGGAGCGGGCTCGGG - Intronic
1022459903 7:30595083-30595105 CATGGACGGCGCGGGGGCTGAGG + Exonic
1022489400 7:30805160-30805182 CCGGGAAGGCAAGTGGGCTCTGG + Intronic
1023842373 7:44104619-44104641 CGGGGAGGGCGCGGGGGGTCAGG - Exonic
1024682361 7:51705922-51705944 CGGGGAGGGGGAGGGAGCTGGGG + Intergenic
1026864615 7:73815711-73815733 CGGGGACGGCAAGGGGACAGAGG - Intronic
1029227439 7:99038351-99038373 CGGGGACGGCCAGGTGCCTGGGG - Intronic
1029238697 7:99143674-99143696 CGGGGCGGGCGAGGGGGCGCCGG + Intronic
1029449584 7:100633365-100633387 CGGGGAGGGGGACGCGGCTCGGG - Intronic
1029494087 7:100887992-100888014 CGGGGGCGGGGAGGGGGATACGG - Intronic
1029708062 7:102285972-102285994 AGGGCACAGCGCGGGGGCTCTGG - Intronic
1030688617 7:112510543-112510565 CAGGGAAGGTGAGGGGGCTCAGG + Intergenic
1032021567 7:128409687-128409709 CGAGGAGGGCGCGGCGGCTCCGG - Intronic
1032344748 7:131107527-131107549 GGGGGACGGCGAGGGGGCCCCGG + Intergenic
1034349652 7:150407650-150407672 GGGGGACGGGGAGGAGGGTCTGG + Intronic
1035389666 7:158496553-158496575 CAGGGAAGGGGAGGGGGCGCAGG - Intronic
1035389887 7:158497081-158497103 CAGGGAAGGGGAGGGGGCGCAGG - Intronic
1035389912 7:158497140-158497162 CAGGGAAGGGGAGGGGGCGCAGG - Intronic
1035389921 7:158497159-158497181 AGGGAAGGGGGAGGGGGCTCAGG - Intronic
1035553265 8:545359-545381 CGGGGGCCGGGTGGGGGCTCGGG - Intronic
1036664793 8:10731119-10731141 CGGGGGCGTCGAGGGGTCTTGGG - Intronic
1037826845 8:22164983-22165005 CGCGCCCGGGGAGGGGGCTCGGG - Exonic
1037887352 8:22601994-22602016 CGGGGACGGTAAAGGGGCTCGGG - Exonic
1038265997 8:26040485-26040507 GGGGGACGTGGAGGGGGCTGTGG + Intronic
1039453913 8:37695930-37695952 CGGGGAGGGCGGGGGAGCACCGG - Exonic
1040471465 8:47738336-47738358 CAGGGCCGGGGAGGGGGCCCCGG - Exonic
1043577815 8:81678196-81678218 CGGGGATGGGGATGGGGCTGGGG - Intronic
1043591834 8:81842121-81842143 CGGGATCGCCGAGGGGGCTGAGG - Exonic
1044620734 8:94188449-94188471 AGGGGACGGGGAGGGGTCACGGG + Intronic
1045063500 8:98427075-98427097 CGGATCCGGAGAGGGGGCTCCGG + Exonic
1045211661 8:100106009-100106031 CGGCGACGGCGCGCGGGCTCCGG + Exonic
1045516329 8:102863732-102863754 GGGGGGCGGCTGGGGGGCTCCGG - Intronic
1045571287 8:103371442-103371464 CGGGCTCGGGGTGGGGGCTCGGG + Intergenic
1047100168 8:121667550-121667572 CGGGGGCGACGACGAGGCTCAGG + Intergenic
1049248241 8:141574313-141574335 AGGGGACTGAGCGGGGGCTCAGG - Intergenic
1049272625 8:141703977-141703999 TGGGGAGGGAGTGGGGGCTCTGG - Intergenic
1049431914 8:142569269-142569291 CTGGGAGGGCGAGTGGGCTGGGG - Intergenic
1049532021 8:143159663-143159685 TGGGGGCGGCGCGGGGGCTTGGG + Exonic
1049536057 8:143183080-143183102 GGGAGATGGGGAGGGGGCTCAGG - Intergenic
1049571788 8:143373079-143373101 AGGGGACGGTGCGGGGGCTTGGG + Intronic
1049571897 8:143373348-143373370 AGGGGACGGGGCGGGGGCTTGGG + Intronic
1049571960 8:143373501-143373523 AGGGGACGGGGCGGGGGCTTGGG + Intronic
1053198483 9:36137211-36137233 CCGGCACGGCGCGGGCGCTCAGG - Intronic
1053398998 9:37801036-37801058 CGGGGACAGCGATGGGGCGCCGG - Exonic
1053435168 9:38069303-38069325 CGGGGCGCGCGAGCGGGCTCCGG - Intergenic
1056439182 9:86603271-86603293 GGGGGACGGGGTGGGGGCTGGGG + Intergenic
1057152614 9:92808619-92808641 CGGGGAGTGCGGGCGGGCTCGGG - Intergenic
1061056307 9:128224690-128224712 CGAGGACAGGGAGGGGGCTCAGG - Intronic
1061248670 9:129414200-129414222 CGGGGACGCGGAGGGGACACGGG + Intergenic
1061541062 9:131278002-131278024 CGGGGCCGGCGAGCGGGCGGCGG - Intergenic
1062016261 9:134292785-134292807 CGGGGAGGGCGGGGGTGCTGAGG - Intergenic
1062097998 9:134712553-134712575 GGGGGACAGAAAGGGGGCTCAGG - Intronic
1062234347 9:135500831-135500853 CGGGGACGTGGAGGGGACCCGGG + Intronic
1062449467 9:136609461-136609483 GGGGGTTGGAGAGGGGGCTCAGG - Intergenic
1062484942 9:136770041-136770063 CAGGGAAGGGGAGGGGGCTCGGG - Intergenic
1203471551 Un_GL000220v1:117325-117347 CGGGGACACCGGGGGGGCGCCGG - Intergenic
1203479372 Un_GL000220v1:161297-161319 CGGGGACACCGGGGGGGCGCCGG - Intergenic
1185459735 X:328702-328724 GGGGGACGGGGAGGGGGGGCGGG - Intergenic
1185621484 X:1453405-1453427 CGGGGGCGGGGACGGGGCCCGGG - Intronic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1187648497 X:21374975-21374997 CGGGGAGGGTGAGGCGGCACTGG + Intronic
1189322644 X:40096096-40096118 CGGGGAGGGCGAGGCGCCGCGGG - Intronic
1189325738 X:40109635-40109657 CTGGGGAGGCGCGGGGGCTCCGG - Intronic
1190041816 X:47078248-47078270 CGGGGACGGGGCGGGGTCCCAGG + Intergenic
1192214686 X:69150221-69150243 CCGGCACGGGGAGGGGGCGCCGG + Intergenic
1192224894 X:69221542-69221564 CCGGCACGGGGAGGGGGCGCCGG - Intergenic
1200062615 X:153490268-153490290 CAGGGCCTGCGTGGGGGCTCCGG - Intronic
1200182941 X:154162271-154162293 GGGGGCCAGTGAGGGGGCTCTGG + Intergenic
1200188595 X:154199385-154199407 GGGGGCCAGTGAGGGGGCTCTGG + Intergenic
1200194244 X:154236526-154236548 GGGGGCCAGTGAGGGGGCTCTGG + Intergenic
1200200000 X:154274329-154274351 GGGGGCCAGTGAGGGGGCTCTGG + Intronic
1200306107 X:155027189-155027211 CGGGGACGGGGAGGGCGCTCGGG + Intronic
1200805106 Y:7425326-7425348 AGGGGACAGGGAGGGGCCTCAGG + Intergenic
1200829105 Y:7673357-7673379 CGGGGCCGGGGTGTGGGCTCAGG - Intergenic
1201416493 Y:13752927-13752949 CGGGGCCTGCGCGGAGGCTCTGG + Intergenic