ID: 1107598466

View in Genome Browser
Species Human (GRCh38)
Location 13:41988294-41988316
Sequence CTGTGGTTATGGCAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107598466_1107598472 16 Left 1107598466 13:41988294-41988316 CCTTCTACCTGCCATAACCACAG No data
Right 1107598472 13:41988333-41988355 TATTGCTCTATGAAGATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107598466 Original CRISPR CTGTGGTTATGGCAGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr