ID: 1107603952

View in Genome Browser
Species Human (GRCh38)
Location 13:42040582-42040604
Sequence CCCGTGGGAGGCTGCGGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1291
Summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 1212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107603941_1107603952 14 Left 1107603941 13:42040545-42040567 CCGGGGGCGGAGGAAGGAGCGAG 0: 1
1: 0
2: 4
3: 54
4: 555
Right 1107603952 13:42040582-42040604 CCCGTGGGAGGCTGCGGCGGTGG 0: 1
1: 0
2: 4
3: 74
4: 1212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107603952 Original CRISPR CCCGTGGGAGGCTGCGGCGG TGG Intronic