ID: 1107604026

View in Genome Browser
Species Human (GRCh38)
Location 13:42040806-42040828
Sequence CAGGAGCCCCGGCGCAGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107604021_1107604026 -2 Left 1107604021 13:42040785-42040807 CCGCGGCGAGGGAAGCGCATCCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1107604026 13:42040806-42040828 CAGGAGCCCCGGCGCAGCGGCGG 0: 1
1: 0
2: 0
3: 34
4: 263
1107604014_1107604026 29 Left 1107604014 13:42040754-42040776 CCGGGGCGGCGGCGGCGGCGGCC 0: 4
1: 40
2: 220
3: 511
4: 1384
Right 1107604026 13:42040806-42040828 CAGGAGCCCCGGCGCAGCGGCGG 0: 1
1: 0
2: 0
3: 34
4: 263
1107604020_1107604026 8 Left 1107604020 13:42040775-42040797 CCGAGAGGGACCGCGGCGAGGGA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1107604026 13:42040806-42040828 CAGGAGCCCCGGCGCAGCGGCGG 0: 1
1: 0
2: 0
3: 34
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107604026 Original CRISPR CAGGAGCCCCGGCGCAGCGG CGG Intronic
900168757 1:1255898-1255920 CAGGAGCCCCGAGGCAGGGGAGG - Intronic
900349282 1:2227315-2227337 CACCGGCCACGGCGCAGCGGGGG + Intergenic
900476620 1:2879233-2879255 CAGGCCCCCCGGTGCAGCCGGGG + Intergenic
900659018 1:3773694-3773716 CAGGAGCCAGGGTGCAGCAGGGG - Intronic
900669120 1:3838934-3838956 CAGGAGCCCAGACGGAGTGGAGG - Intronic
900685224 1:3944036-3944058 CAGGAGTGGCGGGGCAGCGGAGG - Intergenic
900689711 1:3973312-3973334 CAGGAGCCCCTGAGCTGCAGTGG - Intergenic
901490985 1:9596091-9596113 CATGAGCCCCGGGGCAGGGCAGG - Intronic
902044636 1:13515116-13515138 CAGGAGCCCTGGGGAAGAGGCGG + Intergenic
902238639 1:15073941-15073963 CAGGAGCCCAAGGGCAGGGGTGG - Intronic
902585671 1:17437791-17437813 GCGGCGCCCGGGCGCAGCGGCGG + Intronic
903776815 1:25799135-25799157 CAGGTGCCCCTGCGCTGGGGGGG + Intergenic
905092446 1:35440460-35440482 CAGGTGACCCAGCCCAGCGGAGG + Intronic
905779033 1:40691783-40691805 CAGAGGCCCAGGCGCGGCGGAGG - Exonic
905960088 1:42035902-42035924 GAGGAGCCGTGGCGCGGCGGCGG + Intronic
906492368 1:46278562-46278584 CAGGAACCCAGGGGCAGGGGAGG + Exonic
906650387 1:47508594-47508616 AAGGAGCCCCGGCTCAGCCTCGG - Intergenic
907050517 1:51326945-51326967 CAGGAGCTCTGGCACAGTGGTGG + Intronic
907267411 1:53271376-53271398 CAGGAGCCCAGGAGGAGTGGGGG + Intronic
912471761 1:109911344-109911366 CAGGAGCCCCCGCTCAGCCAGGG + Intronic
912670436 1:111619851-111619873 CAGGAGCCACGGCCGAGAGGAGG + Exonic
913547755 1:119886292-119886314 CAGGAGACCTGTCGCAGCGTGGG - Intergenic
913960398 1:143334511-143334533 CCGGAGCCCGAGCACAGCGGTGG - Intergenic
914054754 1:144160084-144160106 CCGGAGCCCGAGCACAGCGGTGG - Intergenic
914124392 1:144806277-144806299 CCGGAGCCCGAGCACAGCGGTGG + Intergenic
919125560 1:193388768-193388790 CAGCAGCTCCAGCCCAGCGGTGG - Intergenic
921861488 1:220046509-220046531 CAGTAGCTGCGGCGCAGGGGCGG - Exonic
922215388 1:223516059-223516081 CAGGAGCCCCGAGGCAGTGTGGG - Intergenic
922586323 1:226737238-226737260 GAGGAGCCCCGGAGCCCCGGGGG - Exonic
922648828 1:227318843-227318865 CCGGGGCCACGGCGCGGCGGTGG - Intergenic
922717570 1:227885284-227885306 CAGGGGCCCAGGTGCAGCAGAGG + Intergenic
922747236 1:228051177-228051199 CAGGAGCCCCGGCAGAGCCCAGG + Intronic
922831435 1:228556465-228556487 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922831913 1:228608419-228608441 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922832474 1:228610660-228610682 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922833034 1:228612901-228612923 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922833595 1:228615142-228615164 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922834154 1:228617383-228617405 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922834712 1:228619624-228619646 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922835263 1:228621839-228621861 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922835822 1:228624059-228624081 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922836381 1:228626301-228626323 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922836939 1:228628540-228628562 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922837498 1:228630782-228630804 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922838059 1:228633023-228633045 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922838617 1:228635263-228635285 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922839175 1:228637488-228637510 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922839735 1:228639729-228639751 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922840296 1:228641960-228641982 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922840856 1:228644201-228644223 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
922841419 1:228646432-228646454 CAGGAGCCCCTGTGCGGCGAGGG - Intergenic
924423131 1:243927973-243927995 CAGGAGCCACGGGGCTGAGGTGG + Intergenic
1062971767 10:1653990-1654012 CAGGACCCCCGGGGCAGCTGTGG - Intronic
1064645444 10:17454600-17454622 CAGGTGACCCCGCGCGGCGGCGG - Intergenic
1065712548 10:28532467-28532489 CAGCAGCCCCTGCCCCGCGGAGG + Intergenic
1071055342 10:81503132-81503154 CAGGAGCCCAGGCGGCGGGGAGG - Intergenic
1072635430 10:97174596-97174618 CAGGAGCCCAGGCGCAAGGGTGG - Intronic
1073088710 10:100913392-100913414 CAGTAGCCCCTGCGCGGAGGCGG - Intronic
1074169773 10:110920115-110920137 CGAGGGCCCGGGCGCAGCGGCGG + Intronic
1075699757 10:124461787-124461809 CAGGCGCCCCTGCGCGGCCGCGG + Intergenic
1075727714 10:124619029-124619051 CAGGAGCCCCAGGACAGCAGTGG - Intronic
1076615564 10:131752032-131752054 TAGGAGCACAGGCGCTGCGGGGG + Intergenic
1076721978 10:132396861-132396883 CACGAGCCCGGGGGCGGCGGGGG - Intergenic
1076734771 10:132453673-132453695 CAGGACCCCAGGCACAGAGGTGG + Intergenic
1076793794 10:132789310-132789332 CAGGAGCCCGGGCCCAGGCGGGG + Intergenic
1077477361 11:2796802-2796824 CAGGAGGGACGGCGCAGCAGTGG - Intronic
1080458890 11:32436869-32436891 CAGCAGCGACGGCGCAGCGTGGG + Intergenic
1084112559 11:67023420-67023442 CTGGAGCCCAGCCGGAGCGGCGG + Intronic
1085405123 11:76257138-76257160 CACGAGCCCCGGCGGGGAGGAGG - Intergenic
1085470232 11:76752947-76752969 CAGGCAGCCCGGCCCAGCGGAGG - Intergenic
1089729466 11:120511533-120511555 CGGGAGCCCAGGCGCGGGGGCGG - Intergenic
1090608802 11:128451877-128451899 CAGAAGTCCCCGCTCAGCGGGGG + Intergenic
1091616357 12:2053625-2053647 AGGGAGCCCCGGCGAGGCGGCGG - Intronic
1092124032 12:6063353-6063375 CAGGTGCCCTGGAGCAGAGGGGG + Intronic
1092923946 12:13257166-13257188 CAGGGGCCCCGGGGCAGTGAAGG - Intergenic
1093125388 12:15322544-15322566 GAGGACCCCGGGCGCAGAGGAGG + Exonic
1096392271 12:51238743-51238765 CTGGAGGCCCGGAGCAGGGGCGG + Intronic
1097250929 12:57632064-57632086 CAGGAGCCCCAGCGAGGCGCAGG + Exonic
1101904497 12:108814697-108814719 CAGGAGCCACGGCCCACCTGTGG - Intronic
1102255985 12:111415307-111415329 CAGGGGCCCAGGCCCAGCGAGGG + Intronic
1104376540 12:128268398-128268420 CAGGAGCCGCGGGGCAGGCGGGG + Intronic
1104379180 12:128291909-128291931 CAGGAACCCCGGCTGACCGGAGG + Intronic
1104951032 12:132440181-132440203 CAGGAACCACCGCGCAGGGGCGG + Intergenic
1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG + Intergenic
1107604026 13:42040806-42040828 CAGGAGCCCCGGCGCAGCGGCGG + Intronic
1107940444 13:45377470-45377492 CAGGACCCCCATCGCAGGGGGGG - Intergenic
1107940551 13:45377788-45377810 CAGGACCCCCATCGCAGGGGGGG - Intergenic
1107941141 13:45380332-45380354 CAGGACCCCCATCGCAGGGGGGG - Intergenic
1107941559 13:45381792-45381814 CAGGACCCCCATCGCAGGGGGGG - Intergenic
1107941615 13:45381950-45381972 TAGGACCCCCATCGCAGCGGGGG - Intergenic
1107941670 13:45382110-45382132 CAGGACCCCCATCGCAGGGGAGG - Intergenic
1108053027 13:46464162-46464184 CAGGACCCCCATCGCAGGGGAGG + Intergenic
1109545623 13:63837897-63837919 TAGGAGCCCCATCGCAGAGGCGG + Intergenic
1113775663 13:112943597-112943619 CAGGCGCCCAGGCGCAGAGGAGG + Intronic
1113926920 13:113946856-113946878 CAGGAGCCCCAGCTCTGCTGTGG - Intergenic
1114455267 14:22849721-22849743 CAGGAGCCCTGGAGAAGGGGAGG - Intergenic
1116326854 14:43541001-43541023 CTGGAGCCCGGGCGTAGCTGAGG + Intergenic
1117135409 14:52730369-52730391 AAGGAGGGCCGGCGGAGCGGAGG - Exonic
1118748346 14:68789890-68789912 CAGCAGCCCGGTGGCAGCGGCGG + Exonic
1120862494 14:89267334-89267356 CAGGATCCCTGGCGCTGCAGTGG + Intronic
1122615242 14:103013217-103013239 CAGGAGCCACGGGGCAGCTCAGG + Intronic
1122719653 14:103715224-103715246 CGGGAGCCCCGCCGCAGCTCGGG - Intronic
1122744673 14:103890738-103890760 CAGGAGCCCCGGCCCAGGGTCGG - Intergenic
1122824701 14:104363989-104364011 CAAGAGCCCCGGGGCTGCTGTGG + Intergenic
1122858493 14:104571626-104571648 CAGCAGCCCCGGTGCAGTGGTGG + Intronic
1122975486 14:105169050-105169072 CAGGAGCCCAGGCGGAGGAGGGG - Intergenic
1123019071 14:105389171-105389193 CAGGAGCCGCGGGGCCGCTGAGG - Intronic
1123043276 14:105499285-105499307 GAGGAGCCCCTGGGCAGTGGTGG + Intronic
1124346335 15:28923870-28923892 GAGGAGCCCCGGGGGGGCGGTGG - Intronic
1125517725 15:40332038-40332060 CAGGAGCCCAGGCACAGGGCTGG - Intronic
1126134628 15:45378405-45378427 CGGGAGCCGCGGCGCCGAGGCGG - Exonic
1126150826 15:45522558-45522580 GCGGAGCCCCGGCGGAGCGTCGG - Intronic
1127836211 15:62793091-62793113 CAGGAGCCCCTGGTCAGGGGAGG + Intronic
1130305326 15:82709426-82709448 CTGGAGCCCCGGCCCAGCGCGGG - Intronic
1130911595 15:88274766-88274788 CAGGAGCCCTGGGGGAGAGGTGG - Intergenic
1131119784 15:89814941-89814963 GAGGAGCCCGGGCGGAGCTGCGG - Intronic
1132055622 15:98648825-98648847 CCGGAGCCCCCGCGCAGAGCAGG + Intergenic
1132143836 15:99415218-99415240 CAGGAGCCCCGGAGCTGGGGTGG - Intergenic
1132608912 16:805458-805480 CAGAAGCCCCCGTGCAGAGGTGG + Exonic
1132622936 16:876220-876242 CAGGAGCCCACGCGCGGCCGCGG + Intronic
1132637430 16:958970-958992 CAGCATCCCCGGCACAGCGAGGG - Intronic
1132763176 16:1520895-1520917 CAGGCCCCTCGGCTCAGCGGCGG + Intronic
1132889540 16:2196905-2196927 TGGGAGCCCCGACGCGGCGGCGG + Intergenic
1135821772 16:25692057-25692079 CAGAAGCCGCGGCGGAGCCGGGG + Exonic
1136401153 16:30019710-30019732 CACGAGCCCTGGCCCAGCGTCGG + Intronic
1142111151 16:88332409-88332431 CAGGAGAGCCGGCACAGAGGGGG - Intergenic
1142302696 16:89268002-89268024 CAGGAGCCCCATCCCAGCCGTGG - Exonic
1142762580 17:2050686-2050708 CAGGAGGGCCGGGGAAGCGGGGG + Intergenic
1145197620 17:20908591-20908613 CCTGAGCCCCAGCGCAGCGCAGG + Intergenic
1145303583 17:21656999-21657021 CAGGAACCCCGGGCCAGCTGAGG - Intergenic
1146055080 17:29576888-29576910 CAGGAGCCCCTGCGCAGCACCGG - Exonic
1146842221 17:36163993-36164015 CAGGAGCCCCGGACGAGGGGAGG - Intergenic
1146854531 17:36251952-36251974 CAGGAGCCCCGGCCGAGGGGAGG - Intronic
1146866088 17:36336424-36336446 CAGGAGCCCCGGCCGAGGGGAGG + Intronic
1146870432 17:36375844-36375866 CAGGAGCCCCGGACGAGGGGAGG - Intronic
1146877789 17:36426925-36426947 CAGGAGCCCCGGCCGAGGGGAGG - Intronic
1146956130 17:36937274-36937296 AAGGAGCCCGGGCGCAGGGAGGG + Intronic
1147068958 17:37937036-37937058 CAGGAGCCCCGGCCGAGGGGAGG + Intergenic
1147073315 17:37976468-37976490 CAGGAGCCCCGGCCGAGGGGAGG - Intergenic
1147080482 17:38016573-38016595 CAGGAGCCCCGGCCGAGGGGAGG + Intronic
1147084836 17:38056006-38056028 CAGGAGCCCCGGCCGAGGGGAGG - Intronic
1147096429 17:38140533-38140555 CAGGAGCCCCGGCCGAGGGGAGG + Intergenic
1147100784 17:38179972-38179994 CAGGAGCCCCGGCCGAGGGGAGG - Intergenic
1147564308 17:41527366-41527388 CAGGAGGCCCTACGCTGCGGTGG + Intronic
1148063702 17:44853569-44853591 CAGGAGCCCCTGCACCGGGGCGG - Exonic
1148563468 17:48619513-48619535 CGGGAGCCCCGGCCCAGCTGCGG + Intronic
1148578438 17:48727229-48727251 CAGGAGCCAAGGCTGAGCGGTGG - Intronic
1148853620 17:50566822-50566844 CAGGAGCCCCAGCTCAGCAGGGG + Intronic
1149654761 17:58304466-58304488 CAGGTGGCCCTGCGCAGGGGTGG + Intronic
1150083717 17:62263019-62263041 CAGGAGCCCCGGCCGAGGGGAGG - Intergenic
1150924233 17:69515756-69515778 CAGGAGACCTGGGGCAGCTGTGG + Intronic
1152404670 17:80089961-80089983 CAGGAGCCCCGGGAGAGCCGAGG - Intronic
1152617818 17:81345976-81345998 CAGGAGCCCCGGGGCGGGAGGGG + Intergenic
1152655411 17:81517167-81517189 CAGAAGGCCTGGAGCAGCGGGGG - Intronic
1152908503 17:82983740-82983762 CAGGGGCCCCGGGGCGGAGGAGG + Intronic
1152980028 18:268038-268060 CAGGCGCCGCAGCGCAGTGGCGG - Intronic
1153942232 18:9988255-9988277 CAGGGGCCTCGGCGCAGGTGGGG + Intergenic
1157492948 18:48136765-48136787 CAGGAGCTCCGGCGAGGCTGGGG + Intronic
1160919546 19:1513282-1513304 TAGCAGCCCCGGGGCAGAGGAGG - Intronic
1161087309 19:2341055-2341077 CAGGAGCCCTGGTGCACCCGAGG - Exonic
1161224352 19:3136254-3136276 CAGGAAGCCCGGCTCGGCGGTGG - Exonic
1161251419 19:3282379-3282401 CACGAGGCCAGGCACAGCGGTGG - Exonic
1161384832 19:3985337-3985359 CTGGTGCCCCGGAGCGGCGGCGG - Intronic
1161615631 19:5268680-5268702 CAGCATCCCAGGCGCAGCGCAGG + Intronic
1162470920 19:10871651-10871673 CCTGGGCCCGGGCGCAGCGGCGG + Exonic
1162528519 19:11221932-11221954 CAGTGGCCTCGGCGTAGCGGGGG + Exonic
1164992198 19:32692438-32692460 CAGGAGGCCAGGCCCGGCGGTGG - Exonic
1165424745 19:35739677-35739699 GAGGAGCCCCGGGGCAGGGAAGG - Intronic
1165448307 19:35868762-35868784 TGGGAGCCCCGGCGCGGCCGAGG + Exonic
1165829555 19:38723759-38723781 CACCAGCCCCGGGGCAGCAGGGG - Intronic
1166666338 19:44682666-44682688 CAGGAGCCCCGAAGCCGGGGTGG + Intronic
1166996674 19:46722809-46722831 CTGGAGTCCCGGGGCAGCAGCGG - Exonic
1167104526 19:47422189-47422211 CATTAGCCACGGCTCAGCGGTGG + Intergenic
1168332705 19:55579326-55579348 CAGGCGGCGCAGCGCAGCGGGGG + Exonic
1168337723 19:55605755-55605777 CGGGGGCCCGGGTGCAGCGGGGG + Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
1202694235 1_KI270712v1_random:112762-112784 CCGGAGCCCGAGCACAGCGGTGG - Intergenic
926077357 2:9951866-9951888 CAGGAGTCCGGCCGCCGCGGGGG + Intronic
927159225 2:20242391-20242413 CCGGACCCGCGGCGCAGGGGAGG + Intergenic
928606400 2:32947757-32947779 CAGGAGACCCAGAGCGGCGGAGG + Exonic
929593303 2:43160611-43160633 CAGGAGCCCTGGCTCAGCACTGG + Intergenic
929936364 2:46297163-46297185 CAGGAGGCGGGGCGCAGCGCGGG + Intronic
930096404 2:47570130-47570152 CGAGAGCCCCGGCGAGGCGGAGG - Exonic
931882168 2:66578647-66578669 CAGGAGCCCAGGGGCTCCGGGGG - Intergenic
932621861 2:73269436-73269458 CGGGAACCCCGAGGCAGCGGCGG + Exonic
932892477 2:75609035-75609057 CAGGAGCCCCAGGGCAGCGCAGG - Intergenic
934567876 2:95350585-95350607 CAGGGGGCCCGGAGCAGCAGGGG + Intronic
935324111 2:101920478-101920500 CAGGAGCTCCGACCCAGAGGCGG - Intergenic
935956634 2:108383409-108383431 CAGGAGCCCCAGCACACTGGAGG - Exonic
937230626 2:120396258-120396280 CAGGAGCCCTGGCGGAGGGCGGG + Intergenic
937895998 2:126977140-126977162 CAGGTGACCCGGGGGAGCGGTGG - Intergenic
939900461 2:147844447-147844469 CTGGAAGCCAGGCGCAGCGGAGG - Intergenic
942046556 2:172102438-172102460 CAGCAGCCCCCGAGCGGCGGCGG - Exonic
942748520 2:179263927-179263949 CAGGAGCCTCGGCGCAGCCCTGG + Intronic
948805770 2:240453007-240453029 CGGGACCCCCTTCGCAGCGGCGG - Intronic
948868226 2:240785895-240785917 CAGGAGGCCCAGGGCAGCAGAGG + Intronic
1169073737 20:2749521-2749543 CAGGACCCCCGGCCCAGCCCCGG + Intronic
1170893300 20:20393837-20393859 CAGCAGCCCTGGGGAAGCGGGGG - Intronic
1171521104 20:25774684-25774706 CAGGAACCCCGGGCCAGCTGAGG - Exonic
1171555822 20:26081795-26081817 CAGGAACCCCGGGCCAGCTGAGG + Intergenic
1172206007 20:33163360-33163382 AAGGAGCCCCAGTCCAGCGGAGG + Intronic
1172876068 20:38165136-38165158 CAGGGGCCCCGGGGCATTGGGGG - Intronic
1175963004 20:62646490-62646512 CAGTAGCCGAGGCACAGCGGGGG + Intronic
1176084846 20:63291186-63291208 CAGGAGTCCAGGAGCAGGGGCGG + Intergenic
1176418924 21:6499024-6499046 CAGGCGGGCCGGCGCGGCGGTGG - Intergenic
1178916406 21:36707873-36707895 CAGGAGCCCCCGGGCAGCGCGGG - Intronic
1179506914 21:41847246-41847268 CATGAATCCCGGCGCAGCGGAGG + Intronic
1179631268 21:42680104-42680126 CCTGAGCCCGGGGGCAGCGGAGG - Intronic
1179694417 21:43107346-43107368 CAGGCGGGCCGGCGCGGCGGTGG - Intronic
1181029641 22:20143596-20143618 CCGGGGCCCCGGCCCAGCAGTGG + Exonic
1181175412 22:21032238-21032260 CAGGAGCCGCGGCTCTGCGTCGG + Intronic
1181634366 22:24167559-24167581 CCAGAGGCCCAGCGCAGCGGTGG - Intronic
1181831749 22:25565244-25565266 CACCCGCCCCGGGGCAGCGGAGG - Intronic
1182516475 22:30861888-30861910 CAGGAGCCCCAGGACAGAGGTGG - Intronic
1184272494 22:43392685-43392707 CAGGTGCCCAGGCTCAGCCGGGG + Intergenic
1185037931 22:48489457-48489479 CCGGGGCCCGGGCGCGGCGGCGG + Exonic
1185320662 22:50198907-50198929 CAGGAGCGTCGGCCCAGGGGCGG + Exonic
949884320 3:8681693-8681715 TAGGACCCCCATCGCAGCGGGGG + Intronic
955291027 3:57692728-57692750 CAGCCGCCCCGGCGCAGGGGAGG + Intronic
955349689 3:58184292-58184314 CAGCAGACCCGGCGCAGGAGAGG + Intergenic
955916384 3:63912309-63912331 CAGGGGACCCAGCGCCGCGGTGG + Intronic
959961442 3:112303058-112303080 GAGGAGTCCCGGGGCAGGGGAGG + Intergenic
961446264 3:126983148-126983170 GCGGAGCCCGGGCGCGGCGGCGG + Intergenic
961602389 3:128071949-128071971 CAGGCGCCCTGGCTCAGCGGAGG - Intronic
962249764 3:133828804-133828826 CAGGAGCCCCCGGCCAGCGAGGG - Exonic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
968188067 3:196646769-196646791 CACGAGCCCCGGTACAGCGCAGG + Intronic
968965344 4:3766556-3766578 CTGGAGCCGGGGCGCAGCCGCGG - Exonic
969341025 4:6541451-6541473 CAGGAGCGCTGGAGCAGAGGTGG + Intronic
969392817 4:6902267-6902289 CGGGAGCCCAGGGGCAGCCGGGG + Intergenic
970394709 4:15654880-15654902 CGGGAGTCCCAGCGCGGCGGTGG + Intronic
972321648 4:37977625-37977647 CTGGAGGCCAGGCGCGGCGGGGG + Intronic
976386997 4:84471761-84471783 CAGGAGGACTGGCGCAGCTGAGG - Intergenic
982702404 4:158671651-158671673 CAGGAGCAGCGGCCCAACGGTGG - Exonic
986692861 5:10328173-10328195 CAGGAGCCCCAGCTCAGCCTGGG - Intergenic
992105871 5:73448495-73448517 CGGCAGCCCCGGCGCAGCTCCGG - Intergenic
993384946 5:87252186-87252208 CAGGAGCCCCGCCCAAGAGGCGG - Intergenic
993457258 5:88141295-88141317 CAGGAGCGCGGGCGCGGCCGGGG + Intergenic
993844807 5:92927795-92927817 CAGGAGCCAGGGTGCAGTGGAGG + Intergenic
997367225 5:133333760-133333782 CAGGAGGCCCTGCGCAGTGCAGG - Intronic
997384087 5:133458880-133458902 CAGGAGCTCTGGAGCAGCAGGGG + Intronic
998208389 5:140175493-140175515 CAGGAGCCCCAGAGTAGCCGCGG - Intronic
998378582 5:141708086-141708108 CAGGAGCCCCTGGGAAGCAGAGG + Intergenic
999300202 5:150486154-150486176 GAGCTGCCCCGGCGCAGCGCCGG + Intronic
999366595 5:151027609-151027631 CAAGAGCCCAGGAGCAGGGGAGG - Intronic
1000014688 5:157266433-157266455 GCGGAGCTCCGGCGCGGCGGCGG + Intronic
1001407016 5:171483631-171483653 CAGGAGTCCAGGCCCAGCTGTGG - Intergenic
1002050247 5:176566538-176566560 CAGGAGCCCGGACGGAGCTGTGG + Intronic
1002574071 5:180161659-180161681 CAGGAGCCGCGGGGCTGGGGAGG - Intronic
1003086343 6:3064168-3064190 CAAGAGCCCCGGGGAGGCGGTGG + Intronic
1012551085 6:100465175-100465197 CAGGAGGCCGCGAGCAGCGGCGG - Intergenic
1012598891 6:101070540-101070562 CAGGAGCCACGGTGCAGGGGAGG - Intergenic
1012996566 6:105981415-105981437 CAGGCGGCCCCGCGTAGCGGTGG + Intergenic
1014999018 6:128191388-128191410 CAGGAGCACCGGGGCAGGGCAGG + Intronic
1018686506 6:166308052-166308074 CCGGAGGCCCTGCGCCGCGGGGG - Exonic
1019198462 6:170295982-170296004 AAGGAGCCGCGGCGCAGAGGAGG - Intronic
1019460189 7:1154113-1154135 CAGGAGCCCTGGGACAGTGGAGG + Intronic
1019641809 7:2107297-2107319 CAGCAGCCCTGGGGCAGAGGGGG + Intronic
1019729866 7:2623828-2623850 CTGGAGACCCGGCTCAGCGTGGG - Intergenic
1020192295 7:6009459-6009481 CAGGAGCTACGGCCCAGCGCCGG + Exonic
1021231060 7:18086744-18086766 CGGGAGCCCCAGCGCCGCGGAGG - Intergenic
1021868186 7:24979583-24979605 CAGGGGCCGCGGCGCAGGTGCGG - Intronic
1025777309 7:64570411-64570433 CCGGGCCCCGGGCGCAGCGGGGG + Intergenic
1029971694 7:104795994-104796016 CAGAAGCCCCGGCACTGGGGTGG - Intronic
1030820194 7:114085019-114085041 CCGGAGCCCCAGCCCAGAGGGGG - Intergenic
1032091920 7:128915413-128915435 CAGGTGCCCGGGAGCAGAGGCGG - Intergenic
1033757022 7:144403939-144403961 CAGGAGCCCAGGCCCAGGTGCGG + Intronic
1034355078 7:150445122-150445144 CAGGGGCCCCGTCACAGCTGCGG + Intergenic
1034560624 7:151877328-151877350 CTGGGGCCGCGGCGCGGCGGGGG - Intergenic
1035316848 7:158001903-158001925 CAGGAGTCCCAGTGCAGCAGCGG - Intronic
1035729847 8:1846144-1846166 CGGGAGCCCGGGAGCCGCGGAGG + Intronic
1035747906 8:1974536-1974558 CCGCACCCCGGGCGCAGCGGCGG - Intronic
1036787981 8:11700626-11700648 CCGGCGCCCAGGCCCAGCGGGGG + Intronic
1037336839 8:17800887-17800909 CGGCAGCGCCGGCGGAGCGGAGG - Intronic
1037820093 8:22131187-22131209 CAGGCGCCCGGGTGCCGCGGGGG - Exonic
1038037877 8:23702078-23702100 CAGCAGCCCCGGGGCATCGGCGG - Intergenic
1045231347 8:100309965-100309987 GAGGCGCCTCGGCGCATCGGAGG - Intronic
1049169033 8:141147015-141147037 CAGGAGACCCGGAGCAGCGCTGG - Intronic
1049372770 8:142275576-142275598 CAGGAGCGCAGGCACAGCCGGGG + Intronic
1049399814 8:142419976-142419998 CGGGAGCCCCTGGGCAGTGGAGG + Intergenic
1049460921 8:142727339-142727361 CAGCAGCCCCAGCATAGCGGCGG - Exonic
1049469345 8:142768531-142768553 CAGGAGCCCTGGTGCAGGGAAGG + Intronic
1049694089 8:143975239-143975261 CAGCGGAGCCGGCGCAGCGGGGG - Intronic
1049799121 8:144509626-144509648 CAGCAACCCCGCCACAGCGGCGG - Exonic
1056965469 9:91160573-91160595 CAGGAGCCCCCGCACTGCGGGGG + Intergenic
1057173011 9:92975157-92975179 CAGAGGCCCCGGCTCTGCGGGGG - Intronic
1057298111 9:93861030-93861052 CAGGAGCCGGGGCGGTGCGGAGG + Intergenic
1057448349 9:95134831-95134853 CAGGCGCCACCGCGCAGGGGAGG + Intronic
1061191462 9:129085086-129085108 CAGGAGCCACGGCCCTGTGGAGG + Exonic
1061193390 9:129094909-129094931 CAGGAGCACAGCCGCAACGGAGG + Exonic
1062230946 9:135480830-135480852 GAGGAGCCCCGGTGCAGGAGCGG - Intronic
1203782131 EBV:106488-106510 CGGGAGCTCAGGCGCAGCGGGGG - Intergenic
1185468636 X:369839-369861 CAGGAGCCCCCGCTCTGCAGCGG + Intronic
1190285301 X:48957467-48957489 CCGGCGCCGCGGCGCGGCGGAGG - Exonic
1191250556 X:58258153-58258175 CAGCAGCCCCTGCGCAGGGCTGG + Intergenic
1195668349 X:107449915-107449937 CGGCAGCGGCGGCGCAGCGGCGG - Intergenic
1198534695 X:137574500-137574522 CCGGAGCCACGGGGAAGCGGGGG - Intronic
1199335862 X:146619111-146619133 CAGGAGCCCCATCCCAGCCGTGG - Intergenic