ID: 1107605848

View in Genome Browser
Species Human (GRCh38)
Location 13:42055852-42055874
Sequence CTGGAAACACATTTGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107605848 Original CRISPR CTGGAAACACATTTGTAGCT GGG Intronic
901398804 1:9002025-9002047 CTGCAAACACATTTTTAACAAGG - Intergenic
910097766 1:83543155-83543177 ATGGAAACACACTTGCTGCTAGG - Intergenic
910569133 1:88681027-88681049 CTCTAAACACATTTGTAAATAGG + Intergenic
911028651 1:93462226-93462248 CTGTAGACAAATTTATAGCTTGG - Intronic
912552982 1:110496480-110496502 CTGGAATTACATTTTGAGCTAGG + Intergenic
912786234 1:112606562-112606584 GTGGAAACAGCTTTGGAGCTGGG - Intronic
913684459 1:121218259-121218281 CTGGAAACACCTTCTTATCTGGG + Intronic
914036298 1:144005874-144005896 CTGGAAACACCTTCTTATCTGGG + Intergenic
914153158 1:145062071-145062093 CTGGAAACACCTTCTTATCTGGG - Intronic
915940579 1:160116012-160116034 CTGTACACACATTGGTAGTTTGG - Intronic
916990504 1:170238888-170238910 CTGGAAACACCTTTGTCCTTAGG + Intergenic
917492803 1:175512768-175512790 CTGGAAACGCATTAGTTCCTGGG + Intronic
917614780 1:176731028-176731050 CTGGGCACACATTTTTACCTTGG - Intronic
918883020 1:190151356-190151378 CTGGAGAAACATTAGTACCTTGG + Intronic
918939721 1:190976893-190976915 CTTCAAAGACAATTGTAGCTAGG + Intergenic
920471767 1:206236772-206236794 CTGGAAACACCTTCTTATCTGGG + Intronic
920854328 1:209651116-209651138 CAGCAGATACATTTGTAGCTTGG + Exonic
922577404 1:226671374-226671396 TTGGCATCACATTTGTAGCAAGG - Intronic
923643021 1:235784818-235784840 CTGGAAACAAATTTGCTGATTGG + Intronic
924420474 1:243904762-243904784 CTGGAAAACCTTTTGTACCTAGG + Intergenic
1062836004 10:636073-636095 CTGGAAACACACATGTAGTGTGG - Intronic
1064103936 10:12485458-12485480 CAGCAGACACATTTGCAGCTGGG - Intronic
1065084641 10:22162733-22162755 CTGGAAACAGAATTCTAGATTGG - Intergenic
1067273367 10:44811871-44811893 CTGGAAACCCATTTGAAGTCTGG + Intergenic
1068056509 10:52018410-52018432 CAGGAAACTAATTTGTATCTTGG - Intronic
1068314427 10:55322419-55322441 GTGGAAGCACATTTGGAACTGGG + Intronic
1068531547 10:58193108-58193130 CTGAAAATACATTTGTTTCTAGG - Exonic
1072046648 10:91663727-91663749 ATGGAAATACATTTGTATATGGG + Intergenic
1072275104 10:93815325-93815347 CTGGAATCACCTTTGCTGCTTGG + Intergenic
1074378380 10:112957726-112957748 TAGGAAACACATCTGTGGCTAGG - Intronic
1075223364 10:120603309-120603331 CAGCAAACAGATTTGAAGCTGGG - Intergenic
1075337163 10:121616883-121616905 CTGGTAGCGCATTTGGAGCTGGG + Intergenic
1080456111 11:32420952-32420974 CAGGAAACCTATTAGTAGCTTGG - Intronic
1080971690 11:37285097-37285119 CTAGAACCAAATTTGAAGCTAGG + Intergenic
1085759672 11:79231141-79231163 CTGGCAAAATATTTGTAGCATGG + Intronic
1087742083 11:101899393-101899415 TTGGAAACAAATTTGGGGCTGGG - Intronic
1088117583 11:106329991-106330013 CTGGAAACACTTTCTTAACTTGG - Intergenic
1089655216 11:119942159-119942181 CTGAAGACAGATATGTAGCTGGG - Intergenic
1090064423 11:123491035-123491057 CTTAAAAGACATTTGTGGCTGGG + Intergenic
1090983820 11:131748399-131748421 TTGGAAAGACATTAGGAGCTTGG + Intronic
1091440321 12:507782-507804 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440327 12:507818-507840 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440344 12:507890-507912 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440352 12:507926-507948 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440360 12:507962-507984 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1092329049 12:7565986-7566008 CTGGAAACAAATTACTTGCTGGG - Intergenic
1098096422 12:66961393-66961415 TTGGAAACATATTTGTAGGTGGG - Intergenic
1099003998 12:77215785-77215807 GTGGAAGCACATTTGGAACTGGG + Intergenic
1099833762 12:87880051-87880073 CCGGAAGCACATTTATAACTGGG + Intergenic
1101550501 12:105757008-105757030 CTGAAAACACATTTTTCCCTTGG - Intergenic
1102168182 12:110822480-110822502 CTGGAAACAGCTTTGTCCCTGGG + Intergenic
1104416548 12:128600564-128600586 TGGGAAACACCTTTGCAGCTGGG + Intronic
1106125735 13:26898552-26898574 GAGGAGACACATATGTAGCTGGG + Intergenic
1107605848 13:42055852-42055874 CTGGAAACACATTTGTAGCTGGG + Intronic
1107631686 13:42349547-42349569 CTTGAAACACATTTTTCTCTTGG + Intergenic
1108119160 13:47164569-47164591 CTGGAAACACATATGTTGGTTGG - Intergenic
1112268541 13:97947904-97947926 CTGAAAAAATATTTTTAGCTGGG - Intergenic
1112858990 13:103807618-103807640 GTGGAAACAAATTTGGAACTGGG + Intergenic
1114007392 14:18329987-18330009 CTAAAAACACATTTGCAGCCAGG - Intergenic
1114860653 14:26516558-26516580 ATGTAAACAAATTTGTATCTTGG - Intronic
1114914969 14:27251879-27251901 CTGGAAATGCATTGATAGCTAGG - Intergenic
1115744171 14:36418915-36418937 CTGGAAATACACTTCTAGCTTGG + Intergenic
1115903072 14:38175750-38175772 CTTGAAACACATTTTTCACTTGG + Intergenic
1116102142 14:40452898-40452920 CTGGAAACACTTTTCTCACTGGG + Intergenic
1116126677 14:40797249-40797271 CTGGAAGCACCTTTGGAACTGGG - Intergenic
1116440520 14:44946647-44946669 CAGGAGAATCATTTGTAGCTAGG - Intronic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1117438934 14:55742584-55742606 CAGGAAACACATTCCTGGCTAGG + Intergenic
1120222062 14:81745602-81745624 CTAGCAATAAATTTGTAGCTGGG - Intergenic
1121675132 14:95746345-95746367 CTGGAAACACTTGGGTTGCTTGG - Intergenic
1121770905 14:96537420-96537442 CTGGAAACTCATTAATTGCTAGG + Intronic
1122478244 14:102027315-102027337 CTGCACACACATCTGTTGCTGGG - Intronic
1123391314 15:19876653-19876675 CTAAAAACACATTTGCAGCCAGG - Intergenic
1126780549 15:52135613-52135635 CTGGAAACACCTTCGTGTCTGGG - Exonic
1126904092 15:53345953-53345975 GAGGAATCACATTTGTGGCTAGG - Intergenic
1128686123 15:69687041-69687063 CTAGAAACACATCTGGAGTTGGG + Intergenic
1130342899 15:83014108-83014130 CTGGAAACCTAGGTGTAGCTGGG + Intergenic
1131454651 15:92573873-92573895 CTGGAAACAAATATGTTGCGTGG + Intergenic
1132222639 15:100116586-100116608 CTGCAACCCCATTTGTAGCGAGG - Intronic
1133644326 16:7749152-7749174 CTTTAGACACATTTGTAGCTAGG + Intergenic
1133723546 16:8516995-8517017 CTGGAACCATCTTTGTGGCTGGG + Intergenic
1136355183 16:29740444-29740466 CTGCAAACACATTTTTAACAAGG - Intergenic
1137305536 16:47195988-47196010 CTGGATACAGAATTGTAGGTTGG + Intronic
1138272964 16:55709517-55709539 GTGAAAACACAGTGGTAGCTGGG - Intergenic
1146166701 17:30595208-30595230 CTGCAAACACATTTTTACCAAGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147248482 17:39138240-39138262 CTGGAATTACATTTGAGGCTAGG + Intronic
1149610809 17:57956481-57956503 ATGGAAACACATTGGTGTCTGGG - Intergenic
1153293709 18:3525813-3525835 CTGGAAACAGATCTGTTCCTAGG - Intronic
1153774372 18:8439809-8439831 CTGAAAACACATTTACAGATGGG + Intergenic
1154530080 18:15333954-15333976 CTAAAAACACATTTGCAGCCAGG + Intergenic
1154983405 18:21523533-21523555 CTGGAAACACATTTAAAGAGTGG - Exonic
1157337691 18:46753678-46753700 CTGGAAAATTATTTGTTGCTGGG + Intronic
1158062819 18:53366717-53366739 CATGAAACCCATTTTTAGCTGGG - Intronic
1159447188 18:68555558-68555580 TTGCAATTACATTTGTAGCTTGG - Intergenic
1159909623 18:74133336-74133358 CTGGAATCAGATTTGGAGCATGG - Intronic
1162599904 19:11660811-11660833 CTGGAAAAAAATTTTAAGCTGGG + Intergenic
1163434573 19:17287721-17287743 CTGGTAACACTTTGGCAGCTTGG + Intergenic
1166936623 19:46337382-46337404 CTGGGACTACACTTGTAGCTGGG + Intronic
1167820251 19:51921355-51921377 CTGCAAACACATTTTTACCAAGG - Intronic
925339097 2:3122681-3122703 CTGGAAACACTTATCTAGCATGG - Intergenic
925420488 2:3706718-3706740 CTGGCCACCCATTTGTACCTGGG + Intronic
926727356 2:16008954-16008976 CTGGGCACACATTTGCAGTTTGG - Intergenic
927808926 2:26171487-26171509 CTGGAATTACATATGTAGCTGGG - Intergenic
929606303 2:43236540-43236562 CTTAAAACACACTTGTTGCTTGG - Intronic
930741396 2:54836130-54836152 CTGGAGACAGATTTGCAGCCAGG + Intronic
932458319 2:71864247-71864269 ATGGAAAGGCATTTGTGGCTTGG - Intergenic
937276522 2:120687962-120687984 CTAGAAACATAATGGTAGCTAGG + Intergenic
938261930 2:129902855-129902877 CTGGACACGGATTTGTAACTGGG + Intergenic
938529176 2:132165396-132165418 CTAAAAACACATTTGCAGCCAGG + Intronic
942363455 2:175197181-175197203 CTGGAAATACATTTCCAGGTTGG + Intergenic
942949632 2:181707780-181707802 CTGGAATTAAATTTGTACCTGGG - Intergenic
944688095 2:202135601-202135623 ATGTAAACACATTTTTAGATAGG - Intronic
946577647 2:221093705-221093727 CTGGAAACAGAGTTGTCTCTGGG - Intergenic
946947998 2:224842532-224842554 CCAGAAAGGCATTTGTAGCTTGG + Intronic
947026482 2:225743427-225743449 GTGGAAACACATTTGGATGTTGG + Intergenic
1170831227 20:19842535-19842557 CTGTAAACAGATGTGTGGCTGGG - Intergenic
1171243310 20:23588388-23588410 CTGGAGATATATTTGTAGCCAGG - Intergenic
1173055357 20:39606884-39606906 GTGAAAATACATTTGTAGTTTGG - Intergenic
1173089545 20:39957189-39957211 CAGGAAGCATATTTGTAGCCAGG - Intergenic
1173431968 20:42996142-42996164 CTGGAAGCACACTTGGTGCTGGG - Intronic
1173629741 20:44503223-44503245 CTGCAAAAAAATATGTAGCTGGG - Intronic
1173694491 20:44997077-44997099 GTGGAATTACATTTGAAGCTTGG - Intronic
1174231877 20:49052159-49052181 CTGGAAACTCATGTTTTGCTGGG + Intronic
1174701465 20:52613287-52613309 CTGGACAAACTTTTGTAACTAGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1176767331 21:13034520-13034542 CTAAAAACACATTTGCAGCCAGG - Intergenic
1178264401 21:31129283-31129305 CTTGAAACACATGAGTAGCAGGG - Intronic
1180431899 22:15260795-15260817 CTAAAAACACATTTGCAGCCAGG - Intergenic
1180856770 22:19052119-19052141 GTGAAAACACATTTGCAGCCAGG + Intronic
1180858117 22:19060874-19060896 CTGCACACACATTTGAAGTTGGG - Intronic
1183627292 22:39012278-39012300 CTGCAAACACATTTTTACCAAGG + Intergenic
949134050 3:541203-541225 AAGAAAACACATTTGTAGTTTGG - Intergenic
949690655 3:6633743-6633765 CTGCAAACACAGCTGTAACTAGG + Intergenic
949807476 3:7971805-7971827 CAGGAAACATAGTTGTGGCTGGG - Intergenic
949811092 3:8007036-8007058 CTCAAAACACATGTGTAGGTTGG - Intergenic
950671492 3:14528973-14528995 TTTGAAAAACATTTGTGGCTGGG + Intronic
951571557 3:24068945-24068967 ATTGAAACACATTTGTAATTTGG + Intergenic
952858972 3:37796444-37796466 CTGCAGACACATTTGTTGGTTGG + Intronic
953678261 3:45020195-45020217 CTGGATACACAGTTGTAGATAGG - Intronic
955200696 3:56849766-56849788 CTGAAAACACATTTTCATCTAGG + Intronic
955857390 3:63287774-63287796 CTGGAAACAATTGTTTAGCTTGG + Intronic
957796629 3:85017480-85017502 CTGGAGAAACATTTATATCTTGG - Intronic
957828509 3:85484152-85484174 CTGGAAAAAAGTTTGTAGCCTGG - Intronic
959407774 3:105981472-105981494 CTGTAAACACACTTCTAGCAAGG - Intergenic
959559569 3:107764151-107764173 CTGGAAACACAAAATTAGCTGGG - Intronic
959712478 3:109398846-109398868 CTGGGTAAACATTTGTACCTGGG + Intergenic
960303242 3:116030083-116030105 CTGGTGACACATGTGTAGCGTGG + Intronic
962763028 3:138534627-138534649 CTTGAAACACTTTTGTTCCTTGG + Intronic
965917412 3:173867247-173867269 CAGGGAACACATTTCTTGCTCGG - Intronic
967548106 3:190756705-190756727 CAGGAGACAGAATTGTAGCTTGG + Intergenic
967683951 3:192398301-192398323 CAGGAAAAACATTTGTGACTGGG - Intronic
968004137 3:195227922-195227944 CTGGTATCACATGTGAAGCTGGG - Intronic
970186280 4:13457182-13457204 ATGGAAAGACATGTGAAGCTGGG - Intronic
971139330 4:23906639-23906661 ATGGAAACACAGTTGTAGCATGG - Intergenic
971735031 4:30437312-30437334 CTGGAAATGGATTTTTAGCTGGG + Intergenic
974194931 4:58561022-58561044 CTCAGAACACATTTGTGGCTGGG + Intergenic
974370414 4:61009742-61009764 CAGAAAACACATTTTTGGCTGGG + Intergenic
978865240 4:113499838-113499860 CTGAACACACATTTGCAGTTAGG - Intronic
979019175 4:115473584-115473606 CTGGTAACAGAATTATAGCTGGG + Intergenic
979402699 4:120268609-120268631 TTGGAGACACATTGGTAGATGGG + Intergenic
981714459 4:147738885-147738907 TTGAAAACACATTGGTGGCTGGG + Intronic
983013869 4:162584364-162584386 TTGGAAACATATTTGTATATTGG - Intergenic
986018861 5:3782076-3782098 CTGTATACACATTTGCAACTTGG + Intergenic
986493807 5:8321006-8321028 CTTGAAACTAATTTCTAGCTAGG + Intergenic
988197120 5:28018250-28018272 CTTAAAACACATGTGTAGTTTGG - Intergenic
989228713 5:39062342-39062364 TTGGAAACACATTTTGAGGTAGG - Intronic
992135174 5:73737215-73737237 CTGGAAACACTTTTGTAAAAAGG - Intronic
992512406 5:77450872-77450894 CTGGATAGAGATTTGTAGTTTGG - Intronic
996481006 5:123974737-123974759 CTGGAAGCAGCTTTGGAGCTGGG - Intergenic
997275027 5:132578409-132578431 ATGGAAAGACAATGGTAGCTTGG - Intronic
997727708 5:136135475-136135497 CTGAAAACAGATTTGTAACTTGG + Intronic
998770774 5:145542315-145542337 CTGGAAATACAATTGTAACTAGG - Intronic
998886074 5:146695142-146695164 CTGCAAACTCTTTTGTAACTAGG - Intronic
1000712837 5:164601874-164601896 CTGCAAACAGATTTCTATCTTGG - Intergenic
1001182599 5:169534560-169534582 CTGGACACACATTCGGAGTTTGG + Intergenic
1001929000 5:175659303-175659325 CAGGAAACTCATTAGTAGGTAGG - Intronic
1003250233 6:4421820-4421842 CTGGATACATAATTGTAGGTTGG - Intergenic
1003893501 6:10584698-10584720 CTGCAAACACATTTTTACCAAGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005327416 6:24716449-24716471 CTGAAAACACATTTTCAGATAGG + Intronic
1005571563 6:27150307-27150329 GTGGAAACACATTTTAGGCTGGG + Intergenic
1005626448 6:27666947-27666969 CGGGAAACACAATTGAAGGTGGG + Intergenic
1006102220 6:31692719-31692741 GAGGACACACACTTGTAGCTAGG - Intronic
1007540623 6:42640334-42640356 TTTGAAACACATTTTTAGTTTGG + Intronic
1012205578 6:96456914-96456936 CTGGGAACTCATTTAAAGCTGGG - Intergenic
1012367341 6:98458235-98458257 GTGGTATCACATTGGTAGCTTGG - Intergenic
1012435663 6:99212508-99212530 ATGGAAACACATTCTTAGCTGGG + Intergenic
1013174662 6:107667237-107667259 ATGGAAAAACATTTGGAGGTTGG - Intergenic
1015307232 6:131723146-131723168 CTACAAACACATTTGGAACTTGG - Intronic
1018118280 6:160610290-160610312 TTGGAAACCCATTTGATGCTTGG + Intronic
1020197528 7:6053452-6053474 CTGGAAAATCATTTGAACCTGGG - Intronic
1020749163 7:12118026-12118048 CAGAAAACAAATTTGTAGCTGGG + Intergenic
1021542228 7:21772595-21772617 TTGGAAATATATTTGTATCTGGG + Intronic
1021910325 7:25379330-25379352 CTGGCAACACTTTTGAAGCAAGG + Intergenic
1023317228 7:38951939-38951961 CTTGACACACATTTGAATCTTGG - Intergenic
1025833336 7:65073925-65073947 CTTGAAACTCATTTGAAGCTTGG - Intergenic
1025903099 7:65763426-65763448 CTTGAAACTCATTTGAAGCTTGG - Intergenic
1027380687 7:77606113-77606135 CTGAAAACACATAATTAGCTGGG - Intronic
1028549035 7:92036445-92036467 CTACAAAAACATTTGTAGCTGGG - Intronic
1030232659 7:107224479-107224501 CTGGAAGCTCATTTCCAGCTAGG - Intronic
1031105555 7:117537898-117537920 CTGCAAACACATATATAGCAAGG + Intronic
1031116971 7:117679529-117679551 CTTGAAACACATTCTTAACTTGG - Intronic
1032567179 7:132958566-132958588 CTGGAGATACATTTGTTACTTGG + Intronic
1036981376 8:13473517-13473539 GTGGAAACATATTTGGAACTGGG + Intronic
1037387096 8:18354773-18354795 CTGGATACACAATTGTAGATTGG + Intergenic
1039019961 8:33194425-33194447 CTGGAGACACCTTTGCAGCATGG + Intergenic
1042114269 8:65414248-65414270 CTAGAAACATATTTGCAGGTAGG + Intergenic
1044104037 8:88179330-88179352 CTGGATACAGATTTCTAGGTTGG - Intronic
1044577878 8:93791177-93791199 ATAAAAATACATTTGTAGCTGGG - Intronic
1047024800 8:120812837-120812859 CTGGAAGAACATTTGTCCCTGGG - Intronic
1050169090 9:2796758-2796780 CTGGAACTGCATTTGAAGCTTGG - Intronic
1050197139 9:3097427-3097449 CTGGAAATATAATTGTAGTTAGG - Intergenic
1050538850 9:6652679-6652701 ATGGGAACATGTTTGTAGCTTGG + Intergenic
1051194487 9:14547992-14548014 GTGGAAACAGCTTTGGAGCTGGG - Intergenic
1051267068 9:15319302-15319324 CTGGAAACACATTTAAAAGTTGG + Intergenic
1052158045 9:25219395-25219417 CTAGAAACACATTTATAGAAAGG + Intergenic
1052980733 9:34447204-34447226 CTGGAATCACATCTTGAGCTAGG - Intronic
1053398493 9:37797559-37797581 CTACACACACATTTGTAGATTGG - Intronic
1053707775 9:40771728-40771750 CTAAAAACACATTTGCAGCCAGG + Intergenic
1054417685 9:64892512-64892534 CTAAAAACACATTTGCAGCCAGG + Intergenic
1054916847 9:70502364-70502386 CTGGAGAGACATTGTTAGCTGGG + Intergenic
1055230680 9:74061254-74061276 CTATAAACACTTTTGCAGCTGGG + Intergenic
1056316253 9:85393413-85393435 TTTAAATCACATTTGTAGCTTGG - Intergenic
1186524454 X:10235642-10235664 ATAGAAACCCATTTGTAGCTAGG - Exonic
1188734631 X:33697009-33697031 CTGTAAACACGCTTGTATCTAGG + Intergenic
1188760670 X:34025517-34025539 CTGTAAACACATTCGTTGCCAGG - Intergenic
1190071414 X:47282979-47283001 CTGGAAACCCACTGGGAGCTTGG - Intergenic
1191723159 X:64251721-64251743 CTGGACACAAATTTCTAGATTGG + Intergenic
1197042136 X:121949759-121949781 GTGGAAACAGATTTGGAACTGGG - Intergenic
1199474128 X:148227473-148227495 CTGGAAACAGATTTGAAGCAAGG - Intergenic
1202232968 Y:22673956-22673978 CTTGAAACACATCTGCTGCTCGG + Intergenic
1202310188 Y:23522202-23522224 CTTGAAACACATCTGCTGCTCGG - Intergenic
1202560613 Y:26148391-26148413 CTTGAAACACATCTGCTGCTCGG + Intergenic