ID: 1107607154

View in Genome Browser
Species Human (GRCh38)
Location 13:42070566-42070588
Sequence TAGGCGACTTTGGTCTTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 1, 2: 2, 3: 1, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107607154_1107607158 20 Left 1107607154 13:42070566-42070588 CCGTGCAAGACCAAAGTCGCCTA 0: 1
1: 1
2: 2
3: 1
4: 47
Right 1107607158 13:42070609-42070631 GTATTAATGAAAAGATTAGTTGG 0: 2
1: 1
2: 2
3: 35
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107607154 Original CRISPR TAGGCGACTTTGGTCTTGCA CGG (reversed) Intronic
907543266 1:55235937-55235959 TAGGCTGCTTTCGTTTTGCAGGG + Intergenic
907687246 1:56623889-56623911 TAGTGGGCTTTGGACTTGCATGG + Intronic
911086243 1:93979732-93979754 TATCCGTCTTTGGTTTTGCAAGG + Intergenic
923349835 1:233093225-233093247 TAGAAGACAATGGTCTTGCATGG + Intronic
1064960125 10:20954620-20954642 CAGGGGACTCTGGCCTTGCAGGG - Intronic
1065159694 10:22907185-22907207 AAGGTGAGTTTTGTCTTGCATGG + Intergenic
1070762461 10:79032953-79032975 TATGAGACTTTGGCCTGGCATGG + Intergenic
1085861895 11:80244681-80244703 TATTGGATTTTGGTCTTGCATGG + Intergenic
1086008781 11:82072987-82073009 TAGGCGACTTTGCACAGGCAAGG + Intergenic
1095579623 12:43782345-43782367 TATCTGACTTTGGCCTTGCACGG + Exonic
1097157034 12:57019652-57019674 TAGGGGAGTTTTGTCTTACAAGG + Intronic
1107607154 13:42070566-42070588 TAGGCGACTTTGGTCTTGCACGG - Intronic
1108629549 13:52268587-52268609 CAGGCGACTGGGGTCTTGAATGG - Intergenic
1108656509 13:52537901-52537923 CAGGCGACTGGGGTCTTGAATGG + Intergenic
1126770039 15:52046966-52046988 TAGGTGACTTTGGTCTTGCACGG + Exonic
1130791537 15:87160766-87160788 TATTGGACTTTGGACTTGCATGG + Intergenic
1142906576 17:3047042-3047064 TATTTGCCTTTGGTCTTGCAGGG - Intergenic
1153033500 18:736842-736864 TAGCAGACTTTGGTTTAGCAAGG - Exonic
1159767613 18:72509379-72509401 TACTGGATTTTGGTCTTGCATGG - Intergenic
1162677511 19:12310890-12310912 CTGGCAACTTTGGTCTTGTAGGG - Intergenic
929288627 2:40164434-40164456 TAGGAGGCTTTTGTTTTGCAGGG - Intronic
931983828 2:67722357-67722379 TATGGGAATTTGGACTTGCATGG + Intergenic
946483394 2:220077916-220077938 TAGACGATTTAGGTCTTCCAAGG - Intergenic
948174545 2:235932898-235932920 TAGGCGACTTTAGTCTCACATGG - Intronic
1170079370 20:12455219-12455241 TATGCTACTTGTGTCTTGCATGG + Intergenic
1178338690 21:31766703-31766725 TATTGGACTTTGGACTTGCATGG + Intergenic
1182330092 22:29545591-29545613 TACTGGATTTTGGTCTTGCATGG - Intronic
1185171379 22:49296503-49296525 AAGGGGACTTTGGTCTACCATGG - Intergenic
951719434 3:25682242-25682264 TATGCGACTGAGGTCTTGAAAGG - Intergenic
968798255 4:2723759-2723781 TAGGAGACTCTGGTTTTGGAGGG + Intronic
971111661 4:23592266-23592288 TATTGGACTTTGGACTTGCATGG + Intergenic
972407281 4:38758816-38758838 CAGGCTACCTTGGTCTTGGATGG - Intergenic
974742186 4:66021418-66021440 TACTGGACTTTGGACTTGCATGG - Intergenic
975361231 4:73474650-73474672 TATTGGATTTTGGTCTTGCATGG - Intergenic
982488372 4:155997477-155997499 GAGTTGACATTGGTCTTGCAGGG + Intergenic
990108151 5:52289955-52289977 TAGGCCACTTTTCTCTTTCACGG - Intergenic
992048602 5:72923360-72923382 TGGGAGACATTGGTCTTGCTAGG + Intergenic
994090022 5:95801687-95801709 TAGCCAAATTTGGTGTTGCAAGG - Intronic
1004419474 6:15455232-15455254 TTTGTGACTTTGGTCTTGCGTGG + Intronic
1011347767 6:86390288-86390310 TATTGGACTTTGGACTTGCATGG + Intergenic
1019555932 7:1631360-1631382 AAGGCAACTTAGGTCTTGGAAGG - Intergenic
1021027826 7:15689898-15689920 TAAGCTACTTAGCTCTTGCAGGG + Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1035157109 7:156923255-156923277 CAGGCAGCTGTGGTCTTGCACGG + Intergenic
1035157116 7:156923315-156923337 CAGGCAGCTGTGGTCTTGCACGG + Intergenic
1038019195 8:23538763-23538785 CAGGCGACTCTTGTCTTGAAAGG - Intronic
1038421936 8:27439081-27439103 TGGGGGACTTTGGTCTTTCCCGG + Exonic
1039546536 8:38414818-38414840 TAGCAGACTTTGGCCTCGCACGG - Exonic
1040393679 8:46974097-46974119 TATGTGACTTTGGTCTTGCACGG - Intergenic
1041010465 8:53537564-53537586 TAGGTGACTTTAGTCTTGCACGG + Intergenic
1042158519 8:65868873-65868895 AGGGTGACTTTGGTGTTGCATGG - Intergenic
1059435025 9:114270834-114270856 GAGGAGACTTAGGTCTTGGATGG - Intronic