ID: 1107607168

View in Genome Browser
Species Human (GRCh38)
Location 13:42070729-42070751
Sequence TTGTCTAAAGTGCTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107607168 Original CRISPR TTGTCTAAAGTGCTGGAGCA GGG (reversed) Intronic
900857123 1:5195143-5195165 TTCTCTTATGTGGTGGAGCAGGG - Intergenic
902096010 1:13946590-13946612 TTGTCCTAGGTACTGGAGCAGGG - Intergenic
904816159 1:33201089-33201111 TTGTCTATAGTGCTGTATTATGG + Intergenic
905326682 1:37157744-37157766 TAGTCTAGAGTTCAGGAGCAGGG - Intergenic
905482840 1:38273373-38273395 TTGTCTGAAGTCCCAGAGCAAGG + Intergenic
906605200 1:47164675-47164697 TTGTCTAAATTTCTGGAATATGG + Intergenic
910069947 1:83200913-83200935 TTTTCTAATGTGGTGGAGCCTGG - Intergenic
911329047 1:96505231-96505253 ATTCCCAAAGTGCTGGAGCAAGG + Intergenic
911895443 1:103428064-103428086 TTGTCTTCACTGCTGGACCAAGG + Intergenic
912347978 1:108982676-108982698 TTTTAATAAGTGCTGGAGCAGGG - Exonic
912591341 1:110824251-110824273 TTGGCAAAAGTGCTGCAGCAGGG + Intergenic
912937597 1:114017429-114017451 GTGTCTAAATTGCTGGAGGAAGG + Intergenic
918930009 1:190842852-190842874 TCCTCTAAAGTGCAGGAGAATGG - Intergenic
924238905 1:242022638-242022660 TTGAGCAAAGTGCTGGAGAATGG - Intergenic
1064276959 10:13915318-13915340 ATGTGTTAAGTGCTGGTGCATGG + Intronic
1064605482 10:17034529-17034551 TGGTCTCAAGTGCTGGACCAGGG + Intronic
1068375142 10:56168252-56168274 TTGTGTATGGTGCTGGAGAAAGG - Intergenic
1070504617 10:77102236-77102258 TTGTCTAGTGTGCCAGAGCATGG - Intronic
1070971049 10:80567566-80567588 CTATATACAGTGCTGGAGCAGGG + Intronic
1071275283 10:84048674-84048696 TTGTCTAAAGATCTGGAGGTGGG + Intergenic
1071963937 10:90833200-90833222 TTCTCTACAGTGGTGGAGTAGGG - Intronic
1073337507 10:102720857-102720879 TTGTCTGAAGAGCTGGAAGATGG - Intronic
1073364872 10:102931260-102931282 TTGGCCATAGAGCTGGAGCAGGG + Intronic
1073403720 10:103278472-103278494 TTGTTTGAAGGGCTGGGGCAGGG - Intronic
1073901840 10:108231534-108231556 TTTTCTAGAGTCCTGGAGCAAGG - Intergenic
1074338983 10:112607386-112607408 ATGTCTTAAGTGCTGTAACAGGG - Intronic
1075061113 10:119257421-119257443 ATTTCAAAAGTGCTGGGGCAGGG + Intronic
1076984083 11:223003-223025 ATGTCCAAAGCACTGGAGCAGGG + Intronic
1078791651 11:14548939-14548961 TTGTCTACAGAGCAGTAGCAAGG - Intronic
1079470701 11:20774644-20774666 TTGTCCACAGTGCTGGTTCAGGG + Intronic
1080178381 11:29394076-29394098 TAGTCAAAGTTGCTGGAGCAAGG + Intergenic
1080283148 11:30581868-30581890 TTGTTTAAAATGCCAGAGCACGG - Intronic
1082953577 11:58844986-58845008 TTGTCTAAAGTGGAGCAACAGGG + Intronic
1084566326 11:69930999-69931021 TGGTCCAAAGCCCTGGAGCAGGG + Intergenic
1088946823 11:114522280-114522302 TGGTCTAAAGTGCTGGCCAAAGG + Exonic
1092855241 12:12667052-12667074 TTATCTAAATTAATGGAGCAGGG - Intronic
1093511632 12:19936122-19936144 TGGTCTAAAGCACTGGAGCATGG - Intergenic
1093617065 12:21238571-21238593 TGGTGTAAGGTGCTGGAGAAGGG + Intronic
1094208985 12:27870589-27870611 CTCTCTGAAGTGCTGGAGCCCGG - Intergenic
1095470802 12:42534857-42534879 TTGTCTAAAGCCATGGAGTAAGG + Intronic
1096201145 12:49684143-49684165 TTGTGTTAAGAGCTGGAGAAAGG - Intronic
1096503278 12:52078441-52078463 TTGTCCATGGTCCTGGAGCAGGG + Intergenic
1100385534 12:94101923-94101945 TTGTCTTGGGTTCTGGAGCACGG + Intergenic
1100994744 12:100292713-100292735 TGGTTTTAAGTGCTGGAGCTAGG + Intronic
1104748080 12:131222248-131222270 TTGTCTAAAGTCTTGGAGTCAGG - Intergenic
1107607168 13:42070729-42070751 TTGTCTAAAGTGCTGGAGCAGGG - Intronic
1108756240 13:53505613-53505635 TTGTCTAAATTTCTGGAAGATGG + Intergenic
1116157536 14:41226396-41226418 TTGTCAAATGTGGTAGAGCAGGG + Intergenic
1118502010 14:66370737-66370759 TTCTTTACAGGGCTGGAGCAAGG + Intergenic
1119635804 14:76272292-76272314 TTCTCTACAGTGCTGGAGGCTGG + Intergenic
1119638629 14:76297022-76297044 TTGTGTAAAGTGCTGCAAAATGG + Intergenic
1120141631 14:80936055-80936077 TGCTCTGAAGTGCTGGAGCAGGG - Intronic
1120605678 14:86574208-86574230 ATATTTAAAGGGCTGGAGCATGG + Intergenic
1126770024 15:52046803-52046825 TTGGCTAATGTGCTGGAGCAGGG + Exonic
1127707411 15:61561016-61561038 TCTTCCAAAGTGTTGGAGCAGGG + Intergenic
1128009087 15:64274273-64274295 TTGTCTAAATTTCTGAAACATGG - Intronic
1131955658 15:97732767-97732789 TTTTCTTAAGTTCTTGAGCAGGG - Intergenic
1136554494 16:30999870-30999892 TTCTCCAAAGAACTGGAGCAAGG + Intronic
1137608316 16:49801808-49801830 TTGTCAAAAGTCATGGAGCTAGG + Intronic
1138859541 16:60740029-60740051 TTGTCAGAAGTCGTGGAGCAAGG - Intergenic
1146597185 17:34179672-34179694 TTGTTTTAATTGCTGAAGCAAGG + Intergenic
1152451520 17:80384261-80384283 CTGTCCACAATGCTGGAGCATGG + Intronic
1153496086 18:5701592-5701614 TTGTCCCAAGTGGTGGGGCAAGG + Intergenic
1156474719 18:37398232-37398254 TTCTCTAAAGTTCTGGAGTTTGG + Intronic
1159514692 18:69443370-69443392 TTGCCGGAAGTGCTGGAGCTGGG - Intronic
1160507892 18:79437433-79437455 GTGGCCAAGGTGCTGGAGCAGGG - Intronic
1162360913 19:10219939-10219961 TTGTCTCAACTGCTAGAGAAGGG + Intronic
1164606005 19:29598614-29598636 CTGTCTGAAGTGCTGGGACATGG - Intergenic
927531617 2:23810402-23810424 TGTGCAAAAGTGCTGGAGCAAGG + Exonic
930043090 2:47144239-47144261 TTGTCCAAAGTCCTAGAGAAAGG - Intronic
930641427 2:53858100-53858122 TTATCTAAAGTGGTGGAACATGG + Intronic
932667580 2:73709326-73709348 TTTTGTAAGGTGCTGGTGCAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
935391359 2:102556471-102556493 ATGTCTAAAATTCTGGAGTAAGG - Intergenic
938404977 2:131027154-131027176 TTGGCTGTACTGCTGGAGCAGGG - Intronic
943292062 2:186086070-186086092 TTATATAAATTGCTGGAGCCGGG - Intergenic
944066075 2:195620222-195620244 ATGTCTAAAGTCCTGGAGGCAGG - Intronic
945415581 2:209567104-209567126 TTGTATGTAGTGCTGCAGCATGG - Intronic
948110179 2:235448590-235448612 TTGGCTATAGTGATGGATCAGGG - Intergenic
948818130 2:240523921-240523943 TTGTCGAAGCTGCTGGTGCACGG + Exonic
1169381297 20:5109854-5109876 TTTTCTTAAGAGCGGGAGCAGGG - Intronic
1169472982 20:5904348-5904370 TTCTCACAAGTGCTGGAGGAGGG + Intergenic
1170729550 20:18961332-18961354 TTGTCACAAATTCTGGAGCAAGG - Intergenic
1170930484 20:20765817-20765839 TTGACTAAATTTCTGGAGAAAGG + Intergenic
1182727685 22:32461050-32461072 TTGGCCACAGTCCTGGAGCAGGG + Intronic
1184927921 22:47657180-47657202 TGGTGAAAAATGCTGGAGCACGG + Intergenic
950866828 3:16196306-16196328 ATGTGTAAAGTGCTGCACCAGGG - Intronic
951032954 3:17903309-17903331 ATGTCTAAAGTGCTGGTTCCAGG + Intronic
955321512 3:57977912-57977934 TTGTGTAAAAAGGTGGAGCAAGG - Intergenic
955614078 3:60787275-60787297 ATGTGTAAAAAGCTGGAGCAGGG - Intronic
957570012 3:81935062-81935084 TTCTCCAAAGTGCTGGAGGAGGG - Intergenic
960051430 3:113242406-113242428 TTTCCTCCAGTGCTGGAGCAGGG + Intronic
960163936 3:114380657-114380679 CTGTCTAAAGTTCTGGGACAGGG - Intronic
961666377 3:128495710-128495732 TTGTCTGAAGCACAGGAGCAGGG + Intergenic
963383599 3:144562061-144562083 CTGTCTCAAGGGCTCGAGCATGG - Intergenic
968328022 3:197838122-197838144 TTGTTTAAAGTGGTGTAGCTTGG + Intronic
974154158 4:58048787-58048809 TTGTCTCCTGTGCTGGAGTAGGG + Intergenic
976165904 4:82254373-82254395 CAATCTACAGTGCTGGAGCATGG + Intergenic
980935610 4:139222722-139222744 TTGTCTAAAGTGCAGGGCCCAGG - Intergenic
981856161 4:149295445-149295467 TTGTCTCAAGTTCTGGAGGTTGG - Intergenic
983980424 4:173989156-173989178 TTGTCTAAATTTCTGTAGCTAGG - Intergenic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
984239444 4:177200011-177200033 CTCTCAAGAGTGCTGGAGCAGGG - Intergenic
984953369 4:185022443-185022465 TTCTATGAAGTGATGGAGCATGG + Intergenic
985327950 4:188794511-188794533 TATTCTACAGTGATGGAGCATGG - Intergenic
986534013 5:8767647-8767669 TTGTCTAAAGTGAAGGAGTTAGG + Intergenic
987912099 5:24160976-24160998 TTGTAAACAGTGCTGCAGCATGG - Intronic
988767416 5:34395219-34395241 TTGTATAAATTGCTGTATCATGG + Intergenic
989626619 5:43435693-43435715 TTTTCAAAAGTGCTTGCGCATGG + Intergenic
992524398 5:77593732-77593754 GTGACTTAAGTGATGGAGCAAGG + Intronic
996519731 5:124413542-124413564 TTGTCCAATAGGCTGGAGCATGG + Intergenic
996740506 5:126794488-126794510 TTCTCTAAAGGTCTGGAGCATGG + Intronic
997238665 5:132291386-132291408 ATCTCTAAAGTTCTGGAGCAAGG + Intronic
997395532 5:133556967-133556989 TTGGCTAAAGTGCTAAAGAAAGG + Intronic
999200717 5:149814405-149814427 TTGTATCAAATGCTTGAGCAGGG + Intronic
1003865568 6:10359464-10359486 TTGTCTAAAGTCATGCAGCTAGG + Intergenic
1007053681 6:38859790-38859812 TTGGCTATAGTGCTGGTGCAGGG + Intronic
1022514142 7:30964763-30964785 TGGGCTAGAGCGCTGGAGCACGG + Intronic
1026072756 7:67137172-67137194 TTCTAGAAAGTGCTGGAGGAAGG - Intronic
1026704127 7:72675036-72675058 TTCTAGAAAGTGCTGGAGGAAGG + Intronic
1026813232 7:73487094-73487116 TTGCTTAAAGTGCTGGAAGATGG - Intronic
1027287719 7:76666072-76666094 TTTTCTAATGTGGTGGAGCCTGG - Intergenic
1027415141 7:77966508-77966530 TTTGCTAAAGTGATGGGGCATGG - Intergenic
1029024588 7:97402702-97402724 TTGTCTAGAGTGAGTGAGCAGGG - Intergenic
1032736217 7:134694893-134694915 ATGTATAAAGTGCTCAAGCAGGG - Intergenic
1038167394 8:25099012-25099034 ATGACCACAGTGCTGGAGCAGGG - Intergenic
1040393691 8:46974260-46974282 CTAGCTAATGTGCTGGAGCAGGG - Intergenic
1041010451 8:53537401-53537423 TTGGCTAATGTGCTGGAGCAGGG + Intergenic
1050286323 9:4106107-4106129 TTGTCTAAGGTGTTGGTGGAAGG - Intronic
1051026230 9:12615062-12615084 TTGTCTAAGGTCATGGAGCTAGG - Intergenic
1054962214 9:70981551-70981573 GTGCCTAAAGTGATGGAGCCAGG - Intronic
1055786081 9:79870140-79870162 TTTTCTACAGTTCTGGAGCCTGG - Intergenic
1056976622 9:91262591-91262613 GTGTATAAAGTGCTTGAGAATGG - Intronic
1059166298 9:112079355-112079377 TTGGCAAAACTGCAGGAGCAAGG + Intronic
1059759138 9:117321853-117321875 TTGTCACAACTGGTGGAGCAGGG - Intronic
1060207057 9:121688406-121688428 CCATCTAAGGTGCTGGAGCAGGG - Intronic
1060246787 9:121953258-121953280 ATCTCTAAATTGGTGGAGCATGG - Intronic
1187415472 X:19089603-19089625 GTGTGAAAAGTGCTTGAGCATGG + Intronic
1187485753 X:19701550-19701572 TTGTGTTAGGTGCTGGAGGAAGG - Intronic
1199905357 X:152223187-152223209 GTGTCTAAAATTCTGGAGAAAGG - Intronic