ID: 1107608477

View in Genome Browser
Species Human (GRCh38)
Location 13:42087111-42087133
Sequence CTTGAAGCTCATACAGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107608475_1107608477 4 Left 1107608475 13:42087084-42087106 CCTCAGAACAGAGTAGGCACAAC 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1107608477 13:42087111-42087133 CTTGAAGCTCATACAGAACTAGG 0: 1
1: 0
2: 1
3: 9
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107608477 Original CRISPR CTTGAAGCTCATACAGAACT AGG Intronic
900921667 1:5675904-5675926 CTTGAACCTCCCACAGAACCAGG - Intergenic
900929206 1:5725823-5725845 CTTGAAGCACAGATAGGACTTGG + Intergenic
901881075 1:12194150-12194172 CCTTAAGCTCCTACAGAACAAGG - Intronic
903334744 1:22617355-22617377 CTCGGAGGTCAGACAGAACTCGG - Intergenic
907613756 1:55901892-55901914 CTCAAAGCTCATATAGAGCTGGG - Intergenic
907641132 1:56191493-56191515 TTTGAAGCTCAAACAGCAGTTGG + Intergenic
908036329 1:60057964-60057986 AGTGAGGCTCACACAGAACTGGG + Intronic
909787398 1:79632426-79632448 CTTGAAGATCATAAACAAATAGG + Intergenic
913345663 1:117807481-117807503 CATGCAGCTAAAACAGAACTTGG + Intergenic
915307606 1:154989632-154989654 GTTGAAGCCCACACAGAGCTGGG - Exonic
916345030 1:163778358-163778380 CTTAGAGCTCATAGACAACTGGG + Intergenic
920808595 1:209259277-209259299 CTTGAAGGACAGACAGAATTTGG + Intergenic
922163936 1:223099382-223099404 CTGGAACCTCATACATAGCTGGG + Intergenic
923255821 1:232220527-232220549 CTAGAAGCTCATATAGAAATAGG + Intergenic
924019927 1:239770234-239770256 CTTGGAGCCCATTCAGATCTAGG - Intronic
1065587547 10:27234370-27234392 CTTGAAGATAATAAATAACTAGG - Intronic
1068414070 10:56694112-56694134 CTTGAAGCTAAAACAGAAGTTGG + Intergenic
1068645728 10:59464946-59464968 CTTCAATCTTAAACAGAACTGGG - Intergenic
1069124022 10:64606678-64606700 ATTGAAGCTCATACTAAATTTGG + Intergenic
1069607000 10:69745257-69745279 CTCGAAACTCATACAGAAAAAGG + Intergenic
1071619055 10:87102253-87102275 CTTGAAACTTATACATAAATAGG - Intronic
1072465835 10:95661766-95661788 CTTGAAAGTCAGACAGAATTGGG - Intergenic
1074346259 10:112689241-112689263 CTGGAAGGTAATACTGAACTTGG + Intronic
1074959470 10:118428108-118428130 CTGGAAGTTAATACAGAGCTGGG + Intergenic
1078154351 11:8785988-8786010 ATAGAAGCTATTACAGAACTCGG + Intronic
1080669284 11:34361444-34361466 CTTTACGCTCATACTGACCTAGG - Intergenic
1081934503 11:46895625-46895647 CTTTAAGGTCATGCAGACCTGGG + Intronic
1084726131 11:70943411-70943433 CTTGAAGCACCTTGAGAACTAGG + Intronic
1086896436 11:92318367-92318389 TTTGTAGCTCATACAGTTCTGGG + Intergenic
1091290286 11:134435697-134435719 CTTCAACCTCACACAGATCTGGG + Intergenic
1097837322 12:64286322-64286344 CTTGAAGATCATCCAGAAGCAGG + Intronic
1098813887 12:75131785-75131807 CGTGAAGCTCATTCAGATGTTGG - Intronic
1099975739 12:89543918-89543940 CTTGAAGCTCTTACAGTAGATGG + Intergenic
1103212008 12:119174129-119174151 CTTAAAGTTCAGACAGACCTGGG + Intergenic
1107258280 13:38457281-38457303 GCTGAAGCTCACACAGAATTGGG - Intergenic
1107608477 13:42087111-42087133 CTTGAAGCTCATACAGAACTAGG + Intronic
1109408542 13:61934087-61934109 CTTGAATCTCTTCAAGAACTAGG + Intergenic
1111930744 13:94510758-94510780 CTTGGAGCTCAAAAAGAAGTAGG - Intergenic
1113009345 13:105746168-105746190 GTTCAAGCTCACAAAGAACTGGG + Intergenic
1116683587 14:48009791-48009813 CTTGAAGAGAAGACAGAACTGGG + Intergenic
1118084310 14:62398128-62398150 CCTGAAGCTAGTACAGTACTGGG + Intergenic
1118254707 14:64195448-64195470 CTTCAAGGTCATACGGTACTAGG - Intronic
1120229550 14:81828125-81828147 CTTGTATCTGATTCAGAACTGGG - Intergenic
1126015767 15:44348708-44348730 CCTGAAGCCAATACAGCACTGGG - Intronic
1129800350 15:78409219-78409241 CATGAAGCTCATACAGCCTTAGG + Intergenic
1131208116 15:90468941-90468963 TTTGAAGCTCCCAAAGAACTTGG + Intronic
1132439060 15:101841086-101841108 CGTGAAGCTAGTACAGCACTGGG + Intergenic
1133960669 16:10490263-10490285 CTTAAAGCACTTACAGAACCAGG + Intergenic
1134971423 16:18534279-18534301 CTTGCAGTTCATACACAAATGGG - Intronic
1135941398 16:26825141-26825163 CGTGAAGCACTTTCAGAACTCGG + Intergenic
1135952060 16:26923852-26923874 CTTGAAGCTCAGACAGAAATAGG + Intergenic
1136907942 16:34119503-34119525 CTTGAACCTCCCACAGAACCAGG - Intergenic
1140648637 16:77063476-77063498 CATGAACCTCATACACAAATGGG - Intergenic
1144378035 17:14665124-14665146 CTTGAGGGTCATACTGTACTGGG + Intergenic
1146440077 17:32886126-32886148 GTTCAAGGTCATACAGACCTAGG - Intergenic
1148226015 17:45898124-45898146 CTTGAAGCTCATACATTCCTTGG + Intronic
1152310089 17:79544739-79544761 CTCGAAGCTCTTACATAACTCGG + Intergenic
1155868307 18:30993707-30993729 GTTGCAGCTCATAAAGAATTGGG - Exonic
1157092755 18:44655416-44655438 GTTGAATCTTATACATAACTGGG + Intergenic
1160411474 18:78677989-78678011 CTTGAGGTTAATACAGACCTGGG - Intergenic
1165330029 19:35136361-35136383 CTTGGAGGTCATGCAGATCTGGG + Intronic
1166787930 19:45380361-45380383 CTTGGAGGTGACACAGAACTTGG - Intronic
927373367 2:22383623-22383645 GTCGAAGCTGACACAGAACTTGG + Intergenic
927594634 2:24385859-24385881 CCTGAAGCCAGTACAGAACTGGG + Intergenic
928583949 2:32738807-32738829 CTTGACTCTCATAAAGCACTTGG - Intronic
930848893 2:55936599-55936621 CTTGAAGGTCATACAGTCATTGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933523791 2:83410113-83410135 CCTGAAGCTATTACAGCACTGGG + Intergenic
940079071 2:149779668-149779690 CTTAAAGCTCACACAGAAACAGG - Intergenic
942391690 2:175502066-175502088 CCTGAAGCCAATACAGCACTGGG + Intergenic
942548419 2:177089439-177089461 CTTGAACCTCCTAAAGGACTAGG + Intergenic
943055089 2:182967306-182967328 CTTGCAGATCACAGAGAACTTGG - Exonic
944923185 2:204436616-204436638 TTTGAAATTCAAACAGAACTGGG - Intergenic
1169674086 20:8133999-8134021 CTGGAAGCGCAAACGGAACTTGG + Intronic
1171815058 20:29778652-29778674 CTTGAACCTCCCACAGAACCAGG + Intergenic
1171903380 20:30878068-30878090 CTTGAACCTCCCACAGAACTAGG - Intergenic
1172954055 20:38742903-38742925 AGTGAAGCTCATACTGAAGTAGG + Intergenic
1174938649 20:54899061-54899083 CCTGAAGTTAATACAGCACTGGG - Intergenic
1174940897 20:54925795-54925817 CATGAAGCTCATGCAGTACCAGG - Intergenic
1175158895 20:56993479-56993501 CTAGAAGCTTATAAAAAACTGGG - Intergenic
1176939827 21:14911287-14911309 CTTGAAGCCAACACAGCACTCGG + Intergenic
1177250192 21:18582585-18582607 CTTGAATGTCCTACAGATCTTGG + Intergenic
1180318493 22:11299206-11299228 CTTGAACCTCCCACAGAACCAGG + Intergenic
1180336775 22:11584026-11584048 CTTGAACCTCCCACAGAACCAGG - Intergenic
1182311791 22:29414473-29414495 CTTGAAGTACTTACAGAACCAGG - Intronic
1182688482 22:32138830-32138852 CTTGAAGTACTTACAGAACCAGG + Intergenic
953346148 3:42177689-42177711 GTTGAAGCTCAGACAGAAACTGG + Intronic
954957338 3:54533200-54533222 CTTAGAGCTCTTACAGAAATTGG + Intronic
955836969 3:63066567-63066589 CTTGAAGATCAGCCAGACCTGGG + Intergenic
960603084 3:119477733-119477755 CTTGAAGATCTTACAGAGCATGG + Intronic
963692360 3:148519935-148519957 CCTGAAGCTCCCACAGCACTGGG - Intergenic
964887365 3:161499990-161500012 CTTTAAGCACTTACAGAACCAGG - Intronic
965743142 3:171897789-171897811 CTTGATGCCCATACAGCAATTGG - Intronic
966237102 3:177714065-177714087 CTTGAGGAGCATACAGCACTTGG + Intergenic
969551593 4:7871776-7871798 CTGGAGGCTAACACAGAACTTGG + Intronic
970535914 4:17029615-17029637 CTTGAAGCTCTGGCAGAACCAGG + Intergenic
970759297 4:19464959-19464981 CTTGAAGCTCAGGGAGAACAAGG - Intergenic
971198097 4:24488456-24488478 CTTGAATCACAGACAGAACAAGG + Intergenic
975238102 4:72024766-72024788 CTTGCAGCTCAGACAGATTTTGG + Intergenic
976837879 4:89396440-89396462 CCTGAAGCTCACACAGAGCTGGG - Intergenic
977338332 4:95726184-95726206 CTTTAAGCTGACACAGATCTGGG + Intergenic
978220509 4:106268082-106268104 CTTTAAGCTCATCAAGACCTTGG + Intronic
979413561 4:120407476-120407498 CTTGAAGCTAGCACAGCACTGGG - Intergenic
979851140 4:125572844-125572866 CCTGAAGCTGGTACAGCACTCGG + Intergenic
980952472 4:139395219-139395241 CTTTTAGGTCAGACAGAACTAGG + Intronic
981195478 4:141915226-141915248 CTTGAAACTCCCACAGACCTCGG + Intergenic
983197075 4:164818630-164818652 CTTTAAGCTCATAAAGAACATGG + Intergenic
984631263 4:182064017-182064039 CTTGAAGACCAAACAGACCTGGG + Intergenic
987766492 5:22238098-22238120 CTTGAAGCTCCTTCAGGAGTTGG - Intronic
990148197 5:52787368-52787390 ATTGAATCTAATAAAGAACTCGG - Intergenic
991083447 5:62625702-62625724 CTTGAATGTCATTCAGAGCTTGG + Intronic
994988650 5:106969897-106969919 GCTGTAGCTCATGCAGAACTGGG + Intergenic
995842441 5:116455795-116455817 CTTTGAGCTCATAAAGACCTGGG + Intronic
995974997 5:118023831-118023853 CTTCAAGTTTAGACAGAACTTGG - Intergenic
996863552 5:128091690-128091712 CTTGGAGCTGGTAGAGAACTTGG + Intronic
996931562 5:128895715-128895737 CTTGAAGCAAACACAGCACTGGG + Intronic
998071297 5:139199820-139199842 CTAGAAGCTCATAGAGTACATGG - Intronic
1000837369 5:166172499-166172521 GTTGAAGCTTAGACAGAAATAGG - Intergenic
1001508081 5:172296330-172296352 ATTGAAGCTAATTCATAACTTGG - Intergenic
1003302294 6:4894401-4894423 CTTGCAGGTCATACAAAACCAGG - Intronic
1006055690 6:31382974-31382996 CTTCCAGCTTATACAGAGCTTGG + Intergenic
1007206788 6:40159239-40159261 CTGAAAGCTCTTATAGAACTTGG - Intergenic
1008822705 6:55652670-55652692 CTTGAAACTCATACAGCTCACGG + Intergenic
1010974226 6:82294761-82294783 CTTGAAAGTCAGACTGAACTGGG + Intergenic
1013357840 6:109362411-109362433 CTTGGAGCTCACACAAAGCTAGG + Intergenic
1015008504 6:128313520-128313542 CTTAAAGGACAAACAGAACTTGG + Intronic
1015429156 6:133110105-133110127 CTTGAAGCCCAGACAGGACAGGG + Intergenic
1015441773 6:133256126-133256148 CTTGAAACTCATATAGTAATCGG + Intronic
1016702944 6:147074308-147074330 CTTTAAGCTCATTCAGAGCTTGG + Intergenic
1016824884 6:148378912-148378934 CTAGAAGCTCATCCAGCCCTTGG - Intronic
1018328177 6:162697209-162697231 CTTGAAGGTTATACAGAAGCAGG - Intronic
1018439633 6:163798788-163798810 CTGAATGCTCATACAGGACTGGG + Intergenic
1018657537 6:166053869-166053891 TTTGTAGCTCACACAGGACTTGG - Intergenic
1020591214 7:10139701-10139723 CTTGAACATCAAACAGAACCAGG + Intergenic
1021026723 7:15677027-15677049 CTTGAGCCTCTTACATAACTTGG + Intronic
1021361363 7:19716769-19716791 CTTGCAGCTAATACAACACTTGG + Intergenic
1023866360 7:44240264-44240286 GCTGCAGCTCATCCAGAACTTGG + Intronic
1024170379 7:46778688-46778710 CATGAAGCTAACACAGGACTGGG - Intergenic
1027947141 7:84761656-84761678 TCTGAAGCTAATACAAAACTAGG + Intergenic
1030373318 7:108725685-108725707 CCTGAAGCTCATACAAGACAAGG - Intergenic
1030615051 7:111729960-111729982 CTGGCAGTTCATAAAGAACTAGG + Intronic
1030630026 7:111885608-111885630 CTTGAAGCTGCTACTGGACTGGG + Intronic
1033598649 7:142873861-142873883 GATGAGGCTCATACAAAACTAGG - Intronic
1036041372 8:5085407-5085429 TTTGAAGTTCTTAGAGAACTAGG + Intergenic
1037430261 8:18804851-18804873 CTAGAAGCTCATTCTGAAATGGG - Exonic
1038622845 8:29160747-29160769 CCAGAAGCTCATTCAGAGCTGGG + Exonic
1039518638 8:38153147-38153169 CTTGGAGCCCATATAGAACAGGG + Intergenic
1040447999 8:47515634-47515656 CTAGAATTTCATACAGTACTGGG - Intronic
1043484537 8:80686158-80686180 CTTGAGGCTCAGGCAGATCTGGG + Intronic
1044241463 8:89893151-89893173 CTTGAAGCTAGTACAGCACTGGG - Intergenic
1046624495 8:116562377-116562399 CTTTGGGCTCATAAAGAACTTGG + Intergenic
1049961070 9:738671-738693 CTTGAAGTTTAAACAAAACTGGG + Intronic
1050680931 9:8110655-8110677 CTTGTAGGTCATACAAAAATGGG + Intergenic
1051873396 9:21765336-21765358 CTTGAGGGTCATACAAAAATAGG - Intergenic
1052109106 9:24558430-24558452 CTTGGGGCTCAGACAGATCTGGG - Intergenic
1054931111 9:70636309-70636331 CTTGCAGCCCATACAGAAACAGG + Intronic
1056077600 9:83057679-83057701 CTTGAACCTCATCTAGGACTTGG + Intronic
1056142472 9:83696799-83696821 CCTGAAGTTCTTACAGTACTCGG + Intronic
1056223762 9:84475140-84475162 TGTGAAGCTCAAACAGAACAAGG + Intergenic
1056705592 9:88950083-88950105 CTGGAAGCTTCTTCAGAACTGGG - Intergenic
1058061264 9:100498961-100498983 CTTGAACCCCATAAAGAAATTGG + Intronic
1058710536 9:107675186-107675208 CTAGAAGGTCAGAGAGAACTGGG + Intergenic
1059474446 9:114533097-114533119 CTCGGAGTTCACACAGAACTAGG + Intergenic
1059938204 9:119332809-119332831 CTTGAAGCTCATGCATCAGTGGG - Intronic
1185986186 X:4837092-4837114 CATGAAGGTCATCCAGAGCTGGG - Intergenic
1186995483 X:15117098-15117120 TTTAAAGCACATACAGTACTTGG + Intergenic
1187789650 X:22935828-22935850 CCTGAAGGTCAAACAAAACTGGG + Intergenic
1191069320 X:56383121-56383143 ATTGAACCTCTTAAAGAACTAGG - Intergenic
1193280255 X:79640877-79640899 CTTGAAGCCAACACAGCACTAGG + Intergenic
1195769136 X:108330369-108330391 ATTAAAGCTCATAGAGTACTTGG - Intronic
1196497624 X:116340300-116340322 CTTGAACCTCAAATAAAACTCGG + Intergenic
1196538870 X:116882090-116882112 CCTGAAGCAAATACAGCACTGGG + Intergenic
1196947285 X:120840362-120840384 CTTGAAACTCATATTGCACTTGG - Intergenic
1197828585 X:130616607-130616629 CATCAAGCTCCTAAAGAACTTGG - Intergenic
1198456490 X:136822724-136822746 GGAGATGCTCATACAGAACTGGG + Intergenic
1201071958 Y:10155260-10155282 CTTGAACCTCCCACAGAACCAGG - Intergenic
1202059565 Y:20872277-20872299 AGTGAAGCTCATCCAGAAATGGG + Intergenic