ID: 1107610049

View in Genome Browser
Species Human (GRCh38)
Location 13:42104037-42104059
Sequence ACATACCTCTGAACTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107610049_1107610051 -10 Left 1107610049 13:42104037-42104059 CCAGTAACAGTTCAGAGGTATGT 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1107610051 13:42104050-42104072 AGAGGTATGTGGTCCTAAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 104
1107610049_1107610053 -6 Left 1107610049 13:42104037-42104059 CCAGTAACAGTTCAGAGGTATGT 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1107610053 13:42104054-42104076 GTATGTGGTCCTAAGCTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 94
1107610049_1107610052 -7 Left 1107610049 13:42104037-42104059 CCAGTAACAGTTCAGAGGTATGT 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1107610052 13:42104053-42104075 GGTATGTGGTCCTAAGCTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 107
1107610049_1107610054 -5 Left 1107610049 13:42104037-42104059 CCAGTAACAGTTCAGAGGTATGT 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1107610054 13:42104055-42104077 TATGTGGTCCTAAGCTGGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107610049 Original CRISPR ACATACCTCTGAACTGTTAC TGG (reversed) Intronic
902326706 1:15705570-15705592 CCATACCTCAGAACTGTTGCTGG + Intronic
906574684 1:46877184-46877206 ACATTCCTCTGAGCTGTCAGGGG - Intergenic
906597289 1:47090720-47090742 ACATTCCTCTGAGCTGTCAGGGG + Intronic
908724432 1:67159942-67159964 ACATTCTTATGAACAGTTACAGG - Intronic
911115192 1:94238884-94238906 ACATATCTTTGAACCCTTACAGG + Intronic
918173766 1:182024839-182024861 ACAGACCTCTCAATTTTTACTGG + Intergenic
918237914 1:182598257-182598279 ACTGACCCCTGCACTGTTACAGG + Intergenic
922312112 1:224404093-224404115 ACCTACCTTTGAAATGTTAAAGG - Intronic
922318084 1:224459919-224459941 ACATACCTCTGCACTCTGGCTGG - Intronic
922455483 1:225770633-225770655 ACCTACCTCTCAGCTGTTCCAGG + Intergenic
1070345128 10:75534247-75534269 AAATACCTTTGAACAGCTACTGG + Intronic
1074412438 10:113239908-113239930 ACACACCTCCGCACTTTTACTGG + Intergenic
1076282287 10:129258485-129258507 ACCTTCCTCTGGACTCTTACAGG - Intergenic
1078638165 11:13071644-13071666 ACATACCTCAGAGCCGTTGCAGG - Intergenic
1084508692 11:69587840-69587862 ACATTCCTCTGACCTGTGTCAGG - Intergenic
1089503324 11:118946003-118946025 AGTTACCTCTGCACTCTTACAGG + Intronic
1090729549 11:129558003-129558025 CCAGATCACTGAACTGTTACAGG - Intergenic
1091358030 11:134953392-134953414 TCAAACCTCTGAACTGTAGCAGG - Intergenic
1091701904 12:2668949-2668971 ACATGCCTCTGAACAGCGACGGG + Exonic
1092624174 12:10307831-10307853 ACAAGCCTCTGAAGTGTTCCAGG - Intergenic
1094067158 12:26373423-26373445 AATTACCTCTGAAAAGTTACAGG + Intronic
1099084373 12:78226890-78226912 ATATACTTCTGAGCAGTTACAGG + Intergenic
1106186276 13:27412613-27412635 ACATACCTCTGAGATGTAAGAGG + Intergenic
1106202196 13:27548564-27548586 ACTTACCACTGAACTGTCAATGG + Intronic
1107610049 13:42104037-42104059 ACATACCTCTGAACTGTTACTGG - Intronic
1112386450 13:98944666-98944688 GCATCCCCATGAACTGTTACAGG - Intronic
1126541182 15:49825784-49825806 ACATACCTCAGAAATATTGCAGG + Intergenic
1131884759 15:96899875-96899897 ACATACCACTGCAGAGTTACGGG + Intergenic
1136250753 16:29003188-29003210 AGAGACCTCTGAGCTCTTACCGG + Intergenic
1138572111 16:57882167-57882189 AAATAACTCTGAAATGATACAGG + Intergenic
1142797031 17:2316427-2316449 ACAGACACCTGAACTGTTGCAGG + Intronic
1144237945 17:13280439-13280461 ACATGTTTCTGAACTATTACTGG + Intergenic
1153577254 18:6534930-6534952 ACAGGCCACTGAACTGTTAAAGG + Intronic
1154496882 18:14967748-14967770 TCAAACCTCTGAACTGTAGCAGG + Intergenic
1157113146 18:44839855-44839877 ACATCCCTCTGTACTATTACTGG - Intronic
1158067896 18:53435420-53435442 ACATACCTGTCAACTCTTATTGG - Intronic
926732808 2:16049915-16049937 ACATATCTCTGAACAGGGACTGG + Intergenic
930712590 2:54563014-54563036 ACATACCTGTGAAGTTTTAGAGG + Intronic
931591793 2:63892197-63892219 ACATACCTCTGTAATGATAAAGG + Intronic
933211912 2:79580020-79580042 ACAGACCTCTTCACTGTTTCAGG + Intronic
935045419 2:99477461-99477483 ATCTACCTCTGGACTATTACAGG + Intronic
939072711 2:137562567-137562589 AAATACTGCTAAACTGTTACTGG - Intronic
941418837 2:165257329-165257351 ACATACCTCAGAGATATTACGGG + Intronic
943980371 2:194541948-194541970 ACATACCCCTGAATGGCTACTGG - Intergenic
945563930 2:211372314-211372336 ACCTAACTCTGAAATATTACTGG - Intergenic
948308104 2:236964910-236964932 ACATAGTTCTGAAATTTTACTGG - Intergenic
1169654837 20:7911646-7911668 CCAAACCTCTGAACTCTTGCTGG + Intronic
1176096038 20:63345024-63345046 ACCTGCCTCTGAACTGCTGCTGG - Exonic
1176992235 21:15511130-15511152 ACCTGCTTCTGAACTGATACTGG - Intergenic
1180571452 22:16725184-16725206 ATACACCTCAGAAGTGTTACAGG + Intergenic
1182819498 22:33203013-33203035 ACATATCTCTGAAGTTTGACAGG + Intronic
1183960430 22:41408458-41408480 ACATAGCTAAGAAATGTTACAGG + Intergenic
951517762 3:23580603-23580625 GCATACCTTGGAAATGTTACAGG - Intronic
952337108 3:32413624-32413646 AAATAACTCTCAAATGTTACTGG + Intronic
954872727 3:53780042-53780064 ACATGCCTCTCAACAGTGACGGG + Exonic
955745728 3:62138811-62138833 ACACACCTCTTAACTGACACAGG - Intronic
956606819 3:71081459-71081481 TCATACCTCTAAATAGTTACAGG + Intronic
957106742 3:75899288-75899310 ATACACCTCAGAAGTGTTACAGG - Intergenic
959030351 3:101292293-101292315 GCATACCTCTGATATATTACAGG + Intronic
959630248 3:108499620-108499642 ACATACCCCTCAAATGGTACAGG + Intronic
960175746 3:114515708-114515730 AAAGATCTCTGAAATGTTACAGG - Intronic
961915630 3:130371045-130371067 ACACAGCTCTGAACATTTACTGG + Intronic
963950759 3:151197681-151197703 AACTCCCTCTGAAATGTTACAGG + Intronic
967324232 3:188223295-188223317 AGATACTTCTGAACTATAACCGG + Intronic
971538018 4:27779206-27779228 ACATACCTCAGAAGTATTGCGGG - Intergenic
972938218 4:44166468-44166490 AAATACCTCTGAAGTATTAATGG - Intergenic
973843294 4:54885057-54885079 AGATACCTCTCAAATGCTACTGG + Intergenic
978223865 4:106310332-106310354 ACAAACCTCTTGACTATTACAGG - Intronic
979931325 4:126634917-126634939 AAATACCTCTGTATTGTAACTGG - Intergenic
981366371 4:143908477-143908499 ACTTACCTCTCAACTATTTCAGG + Intergenic
981376481 4:144022252-144022274 ACTTACCTCTCAACTATTTCAGG + Intergenic
981386991 4:144143598-144143620 ACTTACCTCTCAACTATTTCAGG + Intergenic
983689079 4:170446228-170446250 AGATACTTCTGAACTTTTACAGG - Intergenic
985425508 4:189826450-189826472 ACATACATGTGATTTGTTACTGG - Intergenic
991133645 5:63155812-63155834 AAATATGTATGAACTGTTACAGG - Intergenic
991627018 5:68613421-68613443 ACATACCTCTGAACAACCACTGG + Intergenic
994349472 5:98727820-98727842 TCATACCTTTGAACTATTCCTGG - Intergenic
994901913 5:105783994-105784016 ACATACATCTGGACTTTTCCAGG + Intergenic
995694863 5:114867238-114867260 ACAGAGCTCTGAACTATTCCTGG + Intergenic
1003776867 6:9376867-9376889 TCATACCTCTCAACTGATAGCGG - Intergenic
1009354530 6:62725860-62725882 ACATGCCTCTGAATGATTACTGG - Intergenic
1009453243 6:63825587-63825609 ACCTAACTCTGGACTGATACTGG - Intronic
1009476498 6:64098120-64098142 ACATACTTCTTAATTATTACTGG - Intronic
1011760647 6:90561858-90561880 ACATACATCTTCACTGTTAGTGG - Intronic
1013764926 6:113563614-113563636 ACAGACCTTTTAACTGCTACTGG + Intergenic
1023373590 7:39534947-39534969 AAGTACCTCAGAACTCTTACAGG - Intergenic
1024097513 7:45995015-45995037 ACATGCCTCTGAACTTTCTCAGG + Intergenic
1033026906 7:137782834-137782856 ACAGAGCTCTGAGCTGGTACTGG - Intronic
1034506280 7:151494282-151494304 ACAGTCCTCTGAACTGGCACTGG + Intronic
1035367014 7:158355616-158355638 ACATCCCTCTGCACTGCTGCGGG - Intronic
1037614484 8:20506308-20506330 ACATCCCTCTTAACTGTGAATGG + Intergenic
1039449878 8:37664020-37664042 AAATAGCTCTGAAATGTTAATGG + Intergenic
1046279549 8:112007883-112007905 ACATGGTTCTGAACTGATACAGG - Intergenic
1051565170 9:18489192-18489214 AAAAACCTCTTAACTGTTAGTGG + Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1056959223 9:91106948-91106970 ACATACCTCAGAAATATTTCAGG + Intergenic
1058940708 9:109810300-109810322 ATAGAGCTCTGGACTGTTACAGG + Intronic
1186827349 X:13353665-13353687 ACAGACCCATGAACTGTTTCAGG + Intergenic
1188020013 X:25146673-25146695 ATACACCTTTGAACTGTTACTGG + Intergenic
1189229447 X:39440801-39440823 ACACTCCTCAGAACTGTTCCTGG - Intergenic
1189478857 X:41377663-41377685 ATATTACTCTGCACTGTTACAGG - Intergenic
1193969326 X:88032334-88032356 AAAAAACTCTGAACTGATACAGG + Intergenic
1200845519 Y:7828624-7828646 AAATTCCTCTGAAGTGTTGCAGG - Intergenic
1200897628 Y:8392527-8392549 ACTTCCCTCTGAATTCTTACAGG + Intergenic