ID: 1107610372

View in Genome Browser
Species Human (GRCh38)
Location 13:42107083-42107105
Sequence AAATTGCAATAGATTCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107610372_1107610374 -3 Left 1107610372 13:42107083-42107105 CCTGTGTGAATCTATTGCAATTT 0: 1
1: 0
2: 1
3: 10
4: 195
Right 1107610374 13:42107103-42107125 TTTACAAATATGGCTCTGTGAGG 0: 1
1: 0
2: 2
3: 29
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107610372 Original CRISPR AAATTGCAATAGATTCACAC AGG (reversed) Intronic
904861749 1:33543067-33543089 AAATTTCAAAAGATTCATAGGGG - Intronic
906222566 1:44093229-44093251 AAATGGCAATAGAGTAACAGGGG + Intergenic
907479557 1:54735866-54735888 AAATTTGAAGAGATTCCCACTGG - Intronic
908484958 1:64582382-64582404 AATTTGCAATAAATAAACACAGG - Intronic
910231257 1:84989740-84989762 AATGTGCAATATATTTACACAGG + Intronic
911879223 1:103213124-103213146 AACTTGCAATGGACACACACTGG - Intergenic
914880768 1:151544948-151544970 AAATTGTAATACAATTACACTGG - Intronic
916701758 1:167303033-167303055 AGATAGCAATAGATCCATACAGG - Intronic
916777816 1:167986666-167986688 CAATGGCATTAGATTCTCACAGG - Intronic
918409759 1:184246160-184246182 AAGTTGCATTAGATTCTCATGGG - Intergenic
919369616 1:196707029-196707051 AAATTGCACTATGGTCACACTGG - Intronic
919382185 1:196873068-196873090 AAGTTGCACTATAGTCACACTGG - Intronic
921367541 1:214387879-214387901 ATATTTAAATAGATTCACCCTGG - Intronic
923213460 1:231827820-231827842 AAATTGCAGTGCATTCACTCAGG - Intronic
1062951948 10:1510674-1510696 TAATTACAATAGAATCACAAAGG - Intronic
1063928785 10:11008231-11008253 GAATAGCAAAAGATTCAAACTGG + Intronic
1065368739 10:24960326-24960348 GAGCTGCAATAGATTCCCACTGG - Intergenic
1065740563 10:28793502-28793524 AAATAGTAATACATTCACATTGG - Intergenic
1069433138 10:68355269-68355291 ATAATACATTAGATTCACACAGG + Intronic
1071400426 10:85263488-85263510 ATATTGAAATAGAATCACAATGG + Intergenic
1071733120 10:88268786-88268808 ACATTGCAAGAGTTTCCCACTGG - Intergenic
1072577170 10:96710802-96710824 AATTTGCACAAGATTCACAGTGG + Intronic
1077223640 11:1428245-1428267 AAATAGCAACAGAGTCACAGAGG - Intronic
1078279488 11:9885849-9885871 GAATTGAAACAGACTCACACAGG + Intronic
1078847378 11:15131350-15131372 AAATTTCAGAAGATTGACACTGG - Intronic
1079218911 11:18541506-18541528 AAAATGTAGTACATTCACACTGG - Intronic
1079581502 11:22070047-22070069 AAATTGGAAAAGATTCAAATTGG + Intergenic
1081341346 11:41931810-41931832 AAATTGCAAAAGATTCACTCAGG + Intergenic
1081491201 11:43570398-43570420 ACATTGCAATGGCTTCATACTGG + Intronic
1085234073 11:74998393-74998415 AAAGTGCAATAAAATCACATAGG + Intronic
1086670970 11:89547213-89547235 ATATTGCCATAGAATCACATGGG + Intergenic
1086752386 11:90513428-90513450 AAATTGGAGAAGCTTCACACTGG - Intergenic
1090471246 11:126983226-126983248 TAATCCCAATAGATACACACGGG + Intronic
1093079999 12:14799241-14799263 AAATTGCCTTATATTCACAGGGG + Intronic
1093215056 12:16352150-16352172 CAATTGTAATAGATTAACAAAGG + Intronic
1095258878 12:40075268-40075290 AAATTGCTAGAGATTCACTGTGG - Intronic
1095530097 12:43176846-43176868 AAATTCAAATTGTTTCACACTGG - Intergenic
1097080603 12:56428071-56428093 AAACTGTAGTAGACTCACACTGG + Intronic
1097907533 12:64935832-64935854 AAGTTGCCATAGATTCAGAGTGG - Intergenic
1099548761 12:84016792-84016814 AAATAGTCATAGATTCACAAAGG - Intergenic
1099567226 12:84267738-84267760 AAATTGCAATAAATTTGCAAGGG + Intergenic
1100006356 12:89900082-89900104 AAATTGGAAAATATTCACATGGG - Intergenic
1100155318 12:91792428-91792450 AGACTGCAATAGAATCACAATGG - Intergenic
1100472768 12:94908475-94908497 GAATTGCCATAGATTGACCCAGG - Intronic
1103100941 12:118175163-118175185 AAATTGTATTTGATTTACACTGG - Intronic
1103155345 12:118680040-118680062 AAATTAAAATAGATTCAGCCGGG - Intergenic
1103183729 12:118937724-118937746 AGAGTGCAATAGATTCATGCAGG - Intergenic
1104201833 12:126597111-126597133 AAATTGTATTAGGTTCACCCAGG - Intergenic
1104246831 12:127051131-127051153 CAGTGGCAATAGATTCTCACAGG + Intergenic
1105205961 13:18224576-18224598 AGATTGCCAAAGATTCACTCAGG - Intergenic
1107610372 13:42107083-42107105 AAATTGCAATAGATTCACACAGG - Intronic
1108878642 13:55081171-55081193 AAATTACAATAGAATCTCATAGG + Intergenic
1110456443 13:75695037-75695059 AAACTGAGAAAGATTCACACAGG - Intronic
1112943278 13:104893063-104893085 AAATTCCAATAAATGCAAACAGG - Intergenic
1113154064 13:107297887-107297909 ATATTTTCATAGATTCACACAGG + Intronic
1116538169 14:46062532-46062554 AGATTGCAATATATTCAACCAGG - Intergenic
1116798110 14:49413384-49413406 AAATTGCTACAGAATCCCACTGG - Intergenic
1117224907 14:53646546-53646568 AAATAGAAATAGATGCACAAGGG - Intergenic
1118606753 14:67509704-67509726 AAAACACAATAGATTCAGACTGG + Intronic
1122361127 14:101165264-101165286 AAACTGCTATAGATGTACACTGG - Intergenic
1124100048 15:26684438-26684460 AAATTGCAAATGCTACACACTGG - Intronic
1124798071 15:32801971-32801993 AAATTGCAAAAGATTTTCAGTGG - Intronic
1125416981 15:39464098-39464120 AATGTGCAATAGATACACACTGG + Intergenic
1128235824 15:66066408-66066430 AAATTCCTATAGATTCCCCCTGG - Intronic
1128342377 15:66831391-66831413 AAATGGCAGCAGATTCATACTGG - Intergenic
1137851694 16:51752150-51752172 AAATAGAAGTAGATTCACATAGG + Intergenic
1138064960 16:53931156-53931178 ACATTTTAATAGATTCACAGGGG + Intronic
1139559126 16:67730463-67730485 GAATGGCAATGGAATCACACTGG + Intronic
1145358321 17:22184195-22184217 AAATTGAAATAAATCCACAATGG - Intergenic
1145894457 17:28445831-28445853 AGATAGGAATAGATTCCCACAGG - Intergenic
1146289493 17:31597578-31597600 AGATGGCAACAGATTCACAATGG - Intergenic
1148511310 17:48172274-48172296 TAATTGCCGTAGATTCACAATGG + Intronic
1148716562 17:49720027-49720049 AGATTGCAATAGGTCCACTCAGG + Intronic
1153383206 18:4461424-4461446 AAATTTCCATAGCTTCACTCTGG + Intergenic
1153681919 18:7509028-7509050 AAATGGAAATAGACTCCCACAGG - Intergenic
1153772590 18:8427571-8427593 AAAATGTAATATATACACACAGG - Intergenic
1154134707 18:11765889-11765911 AACTTCCAATACATTCAAACTGG - Intronic
1155225290 18:23724667-23724689 AAATTGCAAAAGTTCCACAAGGG - Intronic
1156000038 18:32374542-32374564 AATTTGCATTAGTTTTACACAGG + Intronic
1159251725 18:65887460-65887482 AAATTGCTATATAGTTACACAGG - Exonic
1160536530 18:79597516-79597538 ACATTGCACAAGATTCAGACTGG + Intergenic
1161737337 19:5999507-5999529 AAATTACAATAAAGCCACACTGG - Intronic
1162471251 19:10872899-10872921 AAGTGGCAAAAAATTCACACAGG - Intronic
1166252134 19:41578463-41578485 AAATTGCATCAGCATCACACAGG + Intronic
1166883260 19:45941754-45941776 AAATTGAAATATATCCACAATGG + Intronic
1166892468 19:46001833-46001855 AAATTTCATTAGATTCTCAAAGG + Intronic
1167055295 19:47107023-47107045 TAATTGCAAAAGATGAACACAGG + Intronic
1168375541 19:55876097-55876119 AAAAAGCATGAGATTCACACAGG + Intronic
925932457 2:8720239-8720261 AATTTGAAATAGATTTAAACTGG - Intergenic
927443841 2:23140485-23140507 AATTTTCTATGGATTCACACAGG + Intergenic
928876401 2:36045077-36045099 AAATTTCAATATTTTCAGACAGG + Intergenic
938317187 2:130337993-130338015 AAATTACATTAGGTTTACACTGG + Intergenic
938616699 2:133006724-133006746 AATTAGCAACAGATTAACACCGG - Intronic
940782500 2:157947612-157947634 AAATGGCAAGAGACACACACTGG + Intronic
941334192 2:164220815-164220837 AAAATTCAATGGAATCACACTGG + Intergenic
943987002 2:194635725-194635747 AAATTGCTAAAGATTCAAAAGGG + Intergenic
945167449 2:206961180-206961202 GATTTGAAATATATTCACACTGG - Intronic
947584571 2:231345866-231345888 AAATTGCAATAGAGTAAGACTGG - Intronic
1169575078 20:6950718-6950740 AAATGGCAATAGATACAAACAGG + Intergenic
1170006185 20:11671887-11671909 AAATTGGAATAGAGACATACGGG + Intergenic
1170229911 20:14034619-14034641 AAATAGCAAAACATTCATACTGG - Intronic
1173775812 20:45705270-45705292 AAATTTCAAAAGACTCACAGTGG + Intronic
1174030798 20:47624452-47624474 AAGTAGCATTAGATTCTCACAGG - Intronic
1174922614 20:54720921-54720943 AAAATACAACATATTCACACTGG - Intergenic
1175566965 20:59987909-59987931 AAAATGTAATAGATTTACATAGG + Intronic
1177356638 21:20017256-20017278 AAATTCCAAGAGATTAACATTGG + Intergenic
1177575778 21:22953569-22953591 AATTTGCAATAGATGCACTAAGG - Intergenic
1177948617 21:27505213-27505235 AACTTGAAATAGATTCCCATAGG - Intergenic
1178496699 21:33092308-33092330 CAATTGTAATAAATTCACACAGG + Intergenic
1180760000 22:18194140-18194162 AGATTGCCAAAGATTCACTCAGG + Intergenic
1180770312 22:18378439-18378461 AGATTGCCAAAGATTCACTCAGG + Intergenic
1180775668 22:18430560-18430582 AGATTGCCAAAGATTCACTCAGG - Intergenic
1180776018 22:18484227-18484249 AGATTGCCAAAGATTCACTCAGG - Intergenic
1180808741 22:18741597-18741619 AGATTGCCAAAGATTCACTCAGG - Intergenic
1180828253 22:18881395-18881417 AGATTGCCAAAGATTCACTCAGG + Intergenic
1181071669 22:20346571-20346593 AGATTGCCAAAGATTCACTCAGG - Intergenic
1181194739 22:21175513-21175535 AGATTGCCAAAGATTCACTCAGG - Intergenic
1181214705 22:21317257-21317279 AGATTGCCAAAGATTCACTCAGG + Intergenic
1182084864 22:27554636-27554658 AGATTTTAATATATTCACACTGG - Intergenic
1182403440 22:30102447-30102469 AAATTACAAGAGAGTGACACAGG - Intronic
1203232144 22_KI270731v1_random:119623-119645 AGATTGCCAAAGATTCACTCAGG + Intergenic
1203278349 22_KI270734v1_random:107397-107419 AGATTGCCAAAGATTCACTCAGG + Intergenic
949757188 3:7425699-7425721 AAAATGCAATGGTTACACACAGG + Intronic
951372956 3:21874721-21874743 AAATTTCAAAAGAATCACAAAGG - Intronic
957231725 3:77526608-77526630 AAATTGTAAGAGATACACATGGG - Intronic
958797989 3:98726892-98726914 AAATTGCCACACATGCACACTGG - Intergenic
963246342 3:143067192-143067214 CAGTTACAATAGATTCATACTGG - Intergenic
964673106 3:159248626-159248648 AAATTGAATTAGATTCTCAGGGG + Intronic
964986303 3:162744354-162744376 AAATAGCAATAGAATCAAACAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
969283998 4:6191097-6191119 ATATTGCAAAAGACTTACACAGG + Intronic
969302931 4:6307903-6307925 GAAATGCAATGGATTCAAACAGG - Intergenic
970894473 4:21086306-21086328 TAATTGCAATAGAGTCTGACAGG - Intronic
972248836 4:37277252-37277274 AAATACAAAGAGATTCACACCGG - Intronic
973010689 4:45069346-45069368 AAATTGCAATATATTTAAAAGGG + Intergenic
974292097 4:59946322-59946344 AAATTGCAGTAAGTGCACACAGG - Intergenic
974962128 4:68715995-68716017 AAATTGAAATAAATTCACCAGGG - Intergenic
975477085 4:74835665-74835687 CAATTGAAACAGATTCACAGAGG + Intergenic
976634196 4:87271227-87271249 AAATTGAAATAGAATTATACTGG - Intergenic
976800338 4:88983382-88983404 AAATGGCAAAAGATACAAACAGG + Intronic
977440702 4:97063535-97063557 ATATTGAAATAGATACACAGTGG + Intergenic
978053363 4:104231866-104231888 AATTGGCAATAAATTGACACAGG + Intergenic
978558017 4:110001876-110001898 AAATAACCATAGATTCACTCAGG - Intronic
978631296 4:110748729-110748751 AAATGTCAACAGTTTCACACTGG - Intergenic
978841393 4:113217641-113217663 AGATGGCATTAGATTCTCACAGG - Intronic
981207282 4:142057923-142057945 AAAGTGCAATACATGCTCACAGG - Intronic
982035265 4:151339742-151339764 ACATTGCAATAGGTTTGCACTGG - Intergenic
982481214 4:155913135-155913157 AAATTGGAATAGAGGCATACTGG - Intronic
984657647 4:182336452-182336474 AAACTGCAAAATATTCACAGAGG + Intronic
984682449 4:182625356-182625378 AGATAGCATTAGATTCTCACAGG + Intronic
986423469 5:7607475-7607497 CACTTGCAAAAGATGCACACGGG - Intronic
987987832 5:25172136-25172158 AAATAGAAATAGATTCACAGAGG - Intergenic
993450198 5:88063521-88063543 AAACCGCATTAGATTCACAGTGG + Intergenic
994658174 5:102620275-102620297 AAATTGAATAAGATTCATACTGG + Intergenic
995588432 5:113673309-113673331 AAATTTCAATACATTGACCCTGG - Intergenic
1001636670 5:173214944-173214966 AAATGGAAATGTATTCACACAGG + Intergenic
1008247612 6:49197452-49197474 AATTTCCAATAGATTCTCAAAGG - Intergenic
1008872995 6:56294222-56294244 ACAATGCAATAAATTCACAAAGG - Intronic
1010309631 6:74369689-74369711 AAATTGTAAGAGATTAAAACTGG - Intergenic
1010984440 6:82406768-82406790 AAATTGCAATATATAAACAGTGG + Intergenic
1013867429 6:114715510-114715532 TAATTGAAATAGATTCTCTCAGG + Intergenic
1015152486 6:130055295-130055317 AAATTGGAAATGGTTCACACAGG + Intronic
1017422900 6:154291191-154291213 AATTTGAAATATATTCCCACTGG - Intronic
1018377656 6:163228731-163228753 AAATTGGAATAAATGCAGACTGG + Intronic
1018780242 6:167057255-167057277 TAAATGGAATAGATTCTCACTGG + Intergenic
1020926904 7:14339800-14339822 AAATTGAAATATATTTACAGTGG + Intronic
1022364042 7:29692898-29692920 TATTTGCAATAGCTTCAAACTGG + Intergenic
1022697324 7:32720842-32720864 TATTTGCAATAGCTTCAAACTGG - Intergenic
1022934586 7:35159330-35159352 TATTTGCAATAGCTTCAAACTGG - Intergenic
1023759227 7:43448160-43448182 AAACTGCATTAGATTAACCCAGG + Intronic
1025971623 7:66331846-66331868 AAATGGCATTAGATTCTCATAGG + Intronic
1027198778 7:76049262-76049284 AACTTGCAATGGGTTCCCACAGG + Intronic
1029830526 7:103252109-103252131 TATTTGCAATAGCTTCAAACTGG - Intergenic
1031825038 7:126553927-126553949 AAATTGCAAAAGATACAAAATGG + Intronic
1033764208 7:144470228-144470250 TAATTGCAAAAGATACACTCTGG + Intronic
1036026538 8:4915306-4915328 CCATTGCAATAAATCCACACGGG - Intronic
1037407460 8:18558238-18558260 ATATTGCAATAAATACACAAAGG - Intronic
1039071565 8:33653499-33653521 AGAGAGCAAGAGATTCACACAGG + Intergenic
1039230666 8:35443643-35443665 CAATGGTAATAGCTTCACACTGG + Intronic
1040066989 8:43153906-43153928 AATGTGCAATATATTCACAGAGG - Intronic
1040494281 8:47952246-47952268 AAAATGCAGTAAATACACACAGG + Intronic
1041559443 8:59198379-59198401 AAATTGCAATATATGTGCACTGG + Intergenic
1043584617 8:81753946-81753968 AATTTGCTTTACATTCACACTGG + Intronic
1044737611 8:95295196-95295218 AAATAGCCATAGATTCACAGCGG + Intergenic
1044799887 8:95943264-95943286 AAATTGCAAGAGAGTCAAAAGGG - Intergenic
1046240434 8:111483680-111483702 ATATTTTAATAGATTCAGACAGG - Intergenic
1047284608 8:123476697-123476719 AAATTGCATTAGCTTTACAAGGG + Intergenic
1047953203 8:129952759-129952781 TAATGGAAATAGAATCACACAGG + Intronic
1048896704 8:138998753-138998775 AAATTGCAAAAGATTTGCAATGG - Intergenic
1050699372 9:8320619-8320641 AACTTTCAACAGATTCTCACAGG + Intronic
1050947617 9:11546118-11546140 ATATTTCAAAAGATTCACCCTGG - Intergenic
1050993962 9:12190133-12190155 AAATAGCAAGAGATTCACTAGGG - Intergenic
1051180688 9:14408719-14408741 AAATTACAATAGAATCAGAGGGG + Intergenic
1051682038 9:19617232-19617254 CATTTGCATTAGATTCTCACAGG - Intronic
1059262930 9:112996228-112996250 AAATTGCAATAAATTCTCAGAGG - Intergenic
1060607956 9:124934546-124934568 AAAGTGCAATAAATTCAGTCTGG + Intronic
1061347555 9:130039238-130039260 AACTTACAACAGATTCAGACTGG + Intronic
1189801590 X:44696559-44696581 AAATAGAAAAAGACTCACACTGG - Intergenic
1193506890 X:82355858-82355880 AAATTACAATAAATAAACACTGG + Intergenic
1193894723 X:87098980-87099002 AAATGGCAAAAGACTCAAACAGG - Intergenic
1194719732 X:97326253-97326275 ACATTTCAAAAGATTCACAGTGG + Intronic
1195120762 X:101749558-101749580 AATTTGCAATAGATAGACACAGG - Intergenic
1196122526 X:112066249-112066271 TAATTGCAATAGTTTGAGACAGG - Intronic
1197615499 X:128686053-128686075 AAAGTGCACTAGAGTCTCACAGG + Intergenic
1200937082 Y:8747775-8747797 AAATTGCAATAGATTGATGCTGG - Intergenic
1202360030 Y:24097937-24097959 AAATTCCAACAGATACACCCAGG - Intergenic
1202510747 Y:25572177-25572199 AAATTCCAACAGATACACCCAGG + Intergenic