ID: 1107612076

View in Genome Browser
Species Human (GRCh38)
Location 13:42125206-42125228
Sequence GGACAAATAACAGCTGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107612076 Original CRISPR GGACAAATAACAGCTGGAGT AGG (reversed) Intronic
901089555 1:6632319-6632341 GGACAAGTAGCAGCTGCAGGAGG + Intronic
901875689 1:12165881-12165903 GGACAGATTGCAGCTGGAATGGG + Intergenic
904466807 1:30713007-30713029 GGACAAACACCAGCTGGTTTTGG + Exonic
906506418 1:46383166-46383188 GGACAAATAATGGGTGGATTGGG + Intergenic
906657181 1:47556698-47556720 GGCCAAACAACAGCTGAAATGGG + Intergenic
910000477 1:82335558-82335580 GAACAAATAAAAGCTGGCATAGG + Intergenic
910434390 1:87190572-87190594 GGACAATAAACAGCTAGAGGAGG - Intergenic
912754467 1:112312958-112312980 AGAAAAATAACTGCTGGAGCTGG - Intergenic
913364632 1:118023408-118023430 GGACAAATAAGACCTGAATTGGG + Exonic
914387258 1:147181867-147181889 AGTCAAAGAACTGCTGGAGTTGG + Intronic
914978437 1:152389472-152389494 AAACAAAAAACAGCAGGAGTGGG - Intergenic
921363677 1:214353843-214353865 GGAGAAATGACATCTGGTGTTGG + Exonic
922347568 1:224709014-224709036 GGACAACAATCAGCTGGAGTGGG + Intronic
924136959 1:240977790-240977812 GTACCAAAAACAGCTGCAGTGGG + Intronic
924500902 1:244637139-244637161 GGATAAATAATATCTGGAATTGG - Intronic
924802293 1:247336270-247336292 GAACAAATAGCATGTGGAGTGGG - Intergenic
1063481823 10:6383178-6383200 GGAAAAGTACCAGCTGGTGTGGG + Intergenic
1066112100 10:32206724-32206746 GGACAAGAAACATCTGGGGTAGG - Intergenic
1069483099 10:68801866-68801888 GGATAAGTAACAGATGGATTTGG - Intergenic
1072685989 10:97537292-97537314 GGTCAAATGACAGCTGGAGGTGG - Intronic
1075541042 10:123314500-123314522 GGACCTATAACAGTTGGAATTGG - Intergenic
1075692735 10:124410425-124410447 GAACAAATGACATCTGGATTAGG + Intronic
1077831599 11:5878026-5878048 GGACAACTATCACCTGCAGTTGG - Intronic
1079380523 11:19933711-19933733 GGAGAAACAACAGCGGGAGAAGG + Exonic
1079582595 11:22084717-22084739 TGACAAATACCAGTTTGAGTGGG - Intergenic
1080039779 11:27747400-27747422 ATACAAATAACAGCATGAGTAGG - Intergenic
1080224169 11:29941546-29941568 AGACAAATATCAGGTGCAGTAGG + Intergenic
1081206160 11:40277991-40278013 GAACAAATAACTGTTGGAGTAGG - Intronic
1082994736 11:59244236-59244258 CTACTAATAACAGCAGGAGTAGG + Intergenic
1083243308 11:61405860-61405882 GGACAAATACCAGCCTGCGTAGG - Intronic
1083803993 11:65063047-65063069 GGACAGAAGACAGCTGGAGCAGG - Intergenic
1085156274 11:74297654-74297676 GGAAAAATAACACCTGGAGGAGG + Intronic
1085862315 11:80248706-80248728 GTATAATTAACAGCTGAAGTAGG - Intergenic
1085961405 11:81466932-81466954 GGAGGAATAACACATGGAGTGGG - Intergenic
1087094957 11:94309135-94309157 AGACAGATGACAGCTGCAGTGGG + Intergenic
1091061429 11:132466656-132466678 GCACATATAAAAGCTGGTGTAGG + Intronic
1095179449 12:39130503-39130525 GGACAGAAAGCAACTGGAGTTGG + Intergenic
1099023440 12:77435567-77435589 GGCCAGTCAACAGCTGGAGTTGG + Intergenic
1104952150 12:132445975-132445997 CGACAAATAACAGCAGGATTAGG + Intergenic
1106165581 13:27242903-27242925 GGACAAATGCCAGCTGACGTAGG + Intergenic
1106476259 13:30100793-30100815 TGGCAAATAATAGCTGGAATGGG - Intergenic
1107406762 13:40121930-40121952 GGACACATAGCAGCTGGGTTGGG - Intergenic
1107612076 13:42125206-42125228 GGACAAATAACAGCTGGAGTAGG - Intronic
1107659754 13:42626612-42626634 GCACAAATAACTGCAGGAATTGG + Intergenic
1107886532 13:44878381-44878403 GCACAGAGAACAGCTGCAGTGGG + Intergenic
1110442742 13:75543339-75543361 AGAAAAAAAACAGCTGGAATAGG + Intronic
1115460981 14:33660312-33660334 TGAGAAATAAAAGCTGGAGAAGG - Intronic
1118640281 14:67785815-67785837 GAACAAATAAAAGCTGAACTGGG - Intronic
1118810712 14:69271172-69271194 ATACAAAAAACAACTGGAGTTGG - Intronic
1119185114 14:72635147-72635169 GGAGATCTAACTGCTGGAGTGGG + Intronic
1119564896 14:75620109-75620131 GGCCATATATGAGCTGGAGTGGG + Intronic
1120690734 14:87589798-87589820 GAACAAATCACAGCTGGAGCTGG + Intergenic
1121618229 14:95328113-95328135 GTACAAATATCAGCTGGACGTGG + Intergenic
1126471222 15:49013160-49013182 GGACAAATAGCAGATTCAGTAGG - Intronic
1128175383 15:65550752-65550774 GGTCAGATGACAGCTGTAGTTGG + Intronic
1132860526 16:2069234-2069256 GGACAAAAAAGAGGTGGAGGTGG - Intronic
1134059322 16:11189401-11189423 GGACAGGTCACAGCTGAAGTGGG + Intergenic
1135551357 16:23400598-23400620 AGGGAAAGAACAGCTGGAGTGGG + Intronic
1138299672 16:55915535-55915557 GGAGAAATAGCAGGTGGGGTTGG + Intronic
1138456219 16:57122244-57122266 GGGCAAATAACTGCTGGATCTGG + Intronic
1139104318 16:63808296-63808318 AGAAAAATAACAGCAGGAATTGG + Intergenic
1145956060 17:28855457-28855479 AGAGAAATAACAGTTTGAGTGGG + Intronic
1146783949 17:35702220-35702242 GGAAAAATATAAACTGGAGTTGG + Intronic
1148751314 17:49947314-49947336 GGACAAACACCAGCTGGGGGTGG + Intergenic
1149219157 17:54395356-54395378 GGGCAAATAACATCTTTAGTGGG + Intergenic
1150711408 17:67533590-67533612 GGACAAGTAAGTGCTGGAGGTGG + Intronic
1151779016 17:76229887-76229909 GGACAAAGAAAGGCTGGGGTTGG + Intronic
1154998439 18:21663569-21663591 CTTAAAATAACAGCTGGAGTAGG + Intronic
1156566270 18:38194863-38194885 GGACAAAAAATAGCAGGAGGTGG + Intergenic
1157082471 18:44540779-44540801 GGAACAATAAGAGATGGAGTTGG - Intergenic
1160231435 18:77052439-77052461 GCACAAATAGCAGCTGGGATGGG - Intronic
1161065019 19:2233248-2233270 GGAGAATTCACAGCTGGTGTGGG + Exonic
1161104853 19:2438246-2438268 GGCCAAAAAGCAGCTGGAGAAGG - Exonic
1161650137 19:5479296-5479318 AGACATATAAAAGCTGCAGTGGG + Intergenic
1162365250 19:10244697-10244719 TAAAAAATAAAAGCTGGAGTAGG + Intergenic
1164140525 19:22457655-22457677 GTACAAAAATCAGCTGGACTTGG - Intronic
1164141003 19:22462891-22462913 GGACAAATTACACCTGGATCTGG - Intronic
925647997 2:6056615-6056637 TGAAAAATAAAAGCAGGAGTCGG - Intergenic
927450548 2:23205933-23205955 GGAGAGGTAAGAGCTGGAGTTGG - Intergenic
928313470 2:30229564-30229586 GGCCAGATAACAGCTGGTGGAGG + Intergenic
928439274 2:31278245-31278267 GGCCAAAAAAAAGCTGGATTAGG - Intergenic
931840873 2:66146740-66146762 GGACAAGTAGCAGATGGAGGGGG - Intergenic
936662410 2:114556927-114556949 GGACCAAAACCAACTGGAGTGGG + Intronic
941791032 2:169552336-169552358 AGAAAAATAAGAGCAGGAGTGGG - Intronic
942003903 2:171678578-171678600 GGATAAATAATAGTTGGAGATGG - Intergenic
948466355 2:238153546-238153568 GGACACAGAACAGGTGGAGAAGG + Intergenic
1170119871 20:12900279-12900301 GGACAAATGTCAGCTGCAGCAGG + Intergenic
1172320128 20:33989989-33990011 GGAGAAATGACAACTGGAGAGGG - Intergenic
1182621236 22:31619912-31619934 GGACAAGCAACAGAGGGAGTGGG - Intronic
1183492960 22:38126565-38126587 GGACAGATGACAGGGGGAGTGGG - Intronic
1184651244 22:45920370-45920392 GGCCCAATAAAAGCTGGAATCGG - Exonic
1184969344 22:48004087-48004109 GGATAAAAAATAGCTGGTGTGGG - Intergenic
951414225 3:22403368-22403390 TGATACATATCAGCTGGAGTAGG + Intergenic
951499817 3:23372728-23372750 GGAAAAATAACAGCATGAGTAGG - Intronic
953411472 3:42692750-42692772 GGACAAAGAGAAGCCGGAGTAGG - Exonic
954263375 3:49455860-49455882 GTACAAATAACGACTGAAGTGGG + Intergenic
956149037 3:66222029-66222051 GGATAAATAACAGGTGGGCTAGG + Intronic
960573724 3:119209324-119209346 AGAAAAATTACAGATGGAGTTGG + Intergenic
962812406 3:138971038-138971060 TTCCAAATAACAGCTGGTGTGGG + Intergenic
963768834 3:149367810-149367832 GGATAAATAACTGGGGGAGTGGG + Intergenic
968728351 4:2258563-2258585 GGACAAACAGCAGGTGGAGATGG + Intronic
972787372 4:42339577-42339599 GGAGAAATTCCAGCTGGAGCAGG + Intergenic
979604008 4:122617801-122617823 GGATAAATAACTGCGGGAATTGG + Intronic
983677157 4:170309121-170309143 GGACAAATATCTGCTGAAGCTGG + Intergenic
985312512 4:188617464-188617486 GGACAAAGAGAAGCTGGAGAAGG + Intergenic
988965946 5:36418020-36418042 GGATGAATACCAGCAGGAGTGGG + Intergenic
991350714 5:65718031-65718053 GGTCAAAGAATAGCTGGAGTAGG + Intronic
992564827 5:77986647-77986669 GGCCAAATAACAGAGGGAGAGGG - Intergenic
995524959 5:113043493-113043515 GGATAAACACCAGCTGGGGTGGG + Intronic
996647376 5:125832734-125832756 GAAAAAATAACATCTGGATTTGG + Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
1003202382 6:3973815-3973837 GGACAACTCAAAGCTGGAGTGGG - Intergenic
1003460257 6:6322051-6322073 GGAGGAGTAACAGCAGGAGTGGG - Intergenic
1004783858 6:18943783-18943805 GGAAAGATAACAGCTGGTGTAGG + Intergenic
1005403180 6:25456454-25456476 TTACAAATAACAACTGGAGTGGG - Intronic
1006843761 6:37048840-37048862 GGAAAACTCACAGCTGCAGTGGG - Intergenic
1011121301 6:83956352-83956374 GGACAACTCAAAGCTGGATTGGG + Intronic
1011749882 6:90444548-90444570 GGAAATATAACAGCTGGTGCTGG + Intergenic
1012400211 6:98836037-98836059 GGACAGCTTACAGCTGGAGAAGG + Exonic
1014506145 6:122259810-122259832 GGAAAAATACCAGATGCAGTGGG - Intergenic
1019263188 7:93858-93880 GGAGAAATAGCCGCTGGACTAGG - Intergenic
1019385439 7:753161-753183 GGACAAATACCAGCTGTGGAAGG - Intronic
1024653364 7:51427910-51427932 GGACAATTACCACCTGGAATGGG + Intergenic
1024852809 7:53741156-53741178 GCACATATGTCAGCTGGAGTGGG - Intergenic
1025032105 7:55566158-55566180 GGACAAAGAGAAGCTGGAGGTGG + Intronic
1026672788 7:72404203-72404225 GGACAAATGACAGTAGAAGTAGG - Intronic
1027053841 7:75036742-75036764 AGACAAAAATTAGCTGGAGTTGG + Intronic
1028210984 7:88073930-88073952 GGACAGATAACAAATGGAGCAGG + Intronic
1029019939 7:97354059-97354081 GCACAGATAATAGCTGGATTTGG + Intergenic
1034356497 7:150454342-150454364 GGACAATAGACAGCTGGAGAAGG + Intronic
1035853614 8:2947716-2947738 GGACAAATAACTCCAGGATTCGG + Intronic
1038110205 8:24488057-24488079 AGACAAAAAACAAATGGAGTGGG - Intronic
1043360533 8:79466655-79466677 GGACAAATCAAAGCAGGAGGAGG - Intergenic
1045211321 8:100103232-100103254 AGACAAAGAAAAACTGGAGTTGG + Intronic
1045232764 8:100320544-100320566 GGAAAAATAACAGGTGCATTTGG + Intronic
1045989286 8:108286750-108286772 GGAAAAGTCACAGCTTGAGTGGG - Intronic
1046702462 8:117417064-117417086 GGACAAAGATCAGCAGAAGTGGG - Intergenic
1047879714 8:129179935-129179957 GGGCACCTCACAGCTGGAGTGGG + Intergenic
1051920419 9:22257829-22257851 GGAGAAATTACAGCTGTAGCAGG + Intergenic
1052199626 9:25762802-25762824 AGACAAATAAAAGCTGAAGGAGG + Intergenic
1054898603 9:70342492-70342514 GCACAAAAAACAGCTGGGGGTGG - Intronic
1055152616 9:73020838-73020860 GGACACAGAAGAGCTGGAGGAGG + Intronic
1059280599 9:113130183-113130205 GAACAAATGGCAGTTGGAGTTGG - Intergenic
1186148709 X:6651444-6651466 GGGCAAAAATCCGCTGGAGTAGG - Intergenic
1187143094 X:16613383-16613405 GGACAAGTGTGAGCTGGAGTTGG + Intronic
1187335111 X:18375009-18375031 CTAGAAATAACAGCGGGAGTAGG + Intergenic
1190408771 X:50114051-50114073 GGACAACTCAAAGCTGGGGTGGG + Intergenic
1190438749 X:50454879-50454901 GGACAAATAAAGGATGGAGGAGG - Intronic
1193776671 X:85650747-85650769 GGACAAAGAACAGCTTCAGTAGG - Intergenic
1196931877 X:120689836-120689858 GGACAAATAGCACCTGGGTTTGG + Intergenic
1197208233 X:123808440-123808462 GGACAAATAGAAGGTGCAGTAGG - Intergenic
1198587018 X:138133284-138133306 GGACAAATACCATGTGGAATTGG + Intergenic
1199881563 X:151977470-151977492 GTACAACTGACAGATGGAGTTGG + Intergenic