ID: 1107612076

View in Genome Browser
Species Human (GRCh38)
Location 13:42125206-42125228
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107612076 Original CRISPR GGACAAATAACAGCTGGAGT AGG (reversed) Intronic