ID: 1107616745

View in Genome Browser
Species Human (GRCh38)
Location 13:42176696-42176718
Sequence CTGAATAAACTGAGGCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 371}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107616745 Original CRISPR CTGAATAAACTGAGGCTGAT TGG Intronic
900865388 1:5265389-5265411 CTTAACAAACTGCGGCTGATGGG - Intergenic
902542437 1:17164627-17164649 TTGAGGAAACTGAGGCTGAGAGG - Intergenic
902672772 1:17986392-17986414 CTGATGAAACGGAGGCAGATGGG + Intergenic
902681703 1:18048307-18048329 ATGACAAAACTGAGGCTGAGAGG - Intergenic
902931517 1:19734824-19734846 ATGAGAAAACTGAGGCTGAGAGG - Intronic
903003691 1:20284341-20284363 CTGGATACACTGAGGTTGTTAGG + Intergenic
903593324 1:24474115-24474137 ATGAAGAAACTGAGACTGACTGG + Intergenic
903724029 1:25427790-25427812 ATGAGAAAACTGAGGCTGAGAGG - Intronic
903761430 1:25701421-25701443 ATGAGGAAACTGAGGCTGAAAGG + Intronic
905453898 1:38074479-38074501 ATGAGGAAACTGAGGCTCATTGG + Intergenic
906696881 1:47829064-47829086 CTGAGGAAACTGAGGATGACTGG + Intronic
907072002 1:51544163-51544185 ATGAAGAAACTGAGGCTCAAAGG + Intergenic
908650406 1:66326839-66326861 TTGAGAAAACTGAGGCTGAGAGG - Intronic
908969687 1:69812350-69812372 ATGAAGAAACTGAGGCTCAGAGG - Intronic
908971196 1:69833729-69833751 CGAAATAAAATGAGGCTAATGGG + Intronic
909838763 1:80290929-80290951 ATGAGAAAACTGAGGCTGTTTGG - Intergenic
910026348 1:82659344-82659366 ATGAGTAAGCTGAGGCTTATTGG - Intergenic
910727288 1:90352345-90352367 CTGAAGAAACTGAGGCTTAAGGG + Intergenic
912760375 1:112360834-112360856 ATGAAAAAACTGAGGCAGAGTGG + Intergenic
913074610 1:115331236-115331258 ATGAAGAAACTGAGGCTTACAGG + Intronic
913187250 1:116380175-116380197 ATGAAGAAACTAAGGCTGACAGG + Intronic
913361523 1:117985989-117986011 ATCAATAAACTGAGGCTAATTGG - Intronic
914448251 1:147768784-147768806 ATGAAAAAACTGAGGCTCAGAGG + Intronic
915277886 1:154802168-154802190 ATGAAGAAACTGAGGCAGAGAGG + Intronic
915901706 1:159851442-159851464 ATGAATAAACTGAGGCTCAGAGG - Intronic
918447426 1:184629277-184629299 GTGAATTTGCTGAGGCTGATAGG - Intergenic
919219969 1:194615944-194615966 CAAAATAAACTGAGGTTAATGGG + Intergenic
919426545 1:197439452-197439474 ATGTGTAAACTGAGGCTGAGAGG + Intronic
919641889 1:200053430-200053452 ATGAAGAAACTGAGGCAGAAGGG + Intronic
919786834 1:201263458-201263480 CTGAGGAAACTGGGGCTGAGAGG + Intergenic
921518150 1:216123430-216123452 CTTAGGAAACTGAGGCTTATAGG - Intronic
921670767 1:217921515-217921537 ATGAATAAACTGAGGATGGAAGG + Intergenic
921956527 1:220990597-220990619 CTGAGGAAACTCAGGCTGAGAGG + Intergenic
922500502 1:226093928-226093950 CTGAATGAACTGTGGCTCTTGGG - Intergenic
922639283 1:227210972-227210994 TGGAATCAACTGAGGCTGATGGG + Intronic
923331689 1:232931211-232931233 CTGAATTCACTGAGGATGATGGG + Intergenic
923394750 1:233550762-233550784 ATGAAAAAACTGAGGCTCACAGG + Intergenic
924155580 1:241173117-241173139 GTGCATAAACTGAGGCCCATAGG + Intronic
924223233 1:241899493-241899515 CTGAAGAAGCTGATGTTGATGGG + Intergenic
924415857 1:243855937-243855959 CTGAAGAAACTAAAGCTGAGGGG - Intergenic
1063466404 10:6247915-6247937 ATGAAAAAACTCAGGCTGAGAGG + Intergenic
1065413534 10:25458672-25458694 ATGAAGAAACTGAGGCTCAAAGG + Intronic
1066629406 10:37444332-37444354 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1068098776 10:52525593-52525615 CTGAGGAAACTGAGGCTCAGAGG - Intergenic
1068778148 10:60890044-60890066 CTGAGGAAACTGAGGCAGAAAGG + Intronic
1069707513 10:70468043-70468065 ATGAAGAGACTGAGGCTGAGAGG + Intergenic
1071576526 10:86730652-86730674 CTGAAAAAACTGGGGCTCAGAGG - Intronic
1072016198 10:91349260-91349282 CTGAGGAAACTGAGGCTTACAGG + Intergenic
1073646842 10:105313770-105313792 CTGGGGAAACTGAGGCTGACAGG + Intergenic
1073964541 10:108973658-108973680 GTGAATCAACTGAGGCTGAGAGG + Intergenic
1074719018 10:116248698-116248720 TTGAGAAAACTGAGGCTGGTGGG + Intronic
1076092036 10:127694706-127694728 TGGAACAAACTGATGCTGATAGG + Intergenic
1078151616 11:8764475-8764497 ATGAAGAAGCTGAGGCTGAAAGG + Intronic
1078902536 11:15654752-15654774 AAGAGGAAACTGAGGCTGATGGG - Intergenic
1079153235 11:17920523-17920545 ATGAGAAAACTGAGGCTGAGAGG + Intronic
1079395883 11:20062987-20063009 ATAAAGAAACTGAGGCTGTTCGG - Intronic
1080052903 11:27874865-27874887 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1080746715 11:35114970-35114992 ATGAGTAAACTGAGGCTCAGGGG + Intergenic
1082246669 11:49931513-49931535 CAGAACAAACTGAGGTTGAAGGG + Intergenic
1082935797 11:58655379-58655401 TTGATGAAACTGAGGCTGAGAGG + Intronic
1085737412 11:79050863-79050885 CTGAAGAAAATCAGGCTGACTGG + Intronic
1086617188 11:88835640-88835662 CTGAGGAAACTGGGGATGATGGG + Intronic
1087199460 11:95330978-95331000 CTAAATATACTGATCCTGATGGG - Intergenic
1087264492 11:96045397-96045419 ATGAGGAAACTGAGGCTGAGAGG - Intronic
1088910596 11:114188280-114188302 ATGAGGAAACTGAGGCTGAAAGG + Intronic
1089325857 11:117656350-117656372 CTGATGAAACTGAGGCTCAGAGG - Intronic
1090087650 11:123664892-123664914 CTGAAGAAACTGAGGCTCAGAGG - Intergenic
1090826903 11:130393914-130393936 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1090924386 11:131236663-131236685 ATGAGAAAACTGAGGCTCATGGG + Intergenic
1090948574 11:131452648-131452670 ATGAAGACACTGAGGCTGAAGGG + Intronic
1091198020 11:133748275-133748297 CTGAAGAAACTGAGTCTGAAAGG + Intergenic
1091386041 12:95219-95241 ATGAGAAAACTGAGGCTGAGTGG - Intronic
1092015900 12:5157720-5157742 CTGAGAAAACTGAGGCTCAGTGG - Intergenic
1094371944 12:29748576-29748598 ATGAAGAAACTGAGGCTTAGAGG - Intronic
1094405874 12:30115652-30115674 TTGAGGAAACTGAGGCTGATAGG - Intergenic
1094425803 12:30315993-30316015 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1094491125 12:30961376-30961398 ATGAAGAAACTGAGGCTTAGAGG + Intronic
1096235233 12:49921926-49921948 ATGAGGAAACTGAGGCTGAGAGG + Intergenic
1096339802 12:50788121-50788143 CTGTGTAAAATGTGGCTGATAGG + Intronic
1096470367 12:51871794-51871816 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1099220387 12:79907212-79907234 CTTAATAATCTTAGGGTGATTGG - Intronic
1101090013 12:101275640-101275662 ATGAGGAAACTGAGGCTGAAAGG + Intergenic
1101337347 12:103808196-103808218 CTGAATAAAATGGGGATGGTAGG - Intronic
1101535330 12:105611351-105611373 ATGGAGAAACTGAGGCTGAGAGG - Intergenic
1101875198 12:108592829-108592851 ATGAAAAAACAGAGGCTGAGAGG + Intronic
1101965170 12:109277446-109277468 ATGAAGAAACTGAGGCTCAGGGG - Intergenic
1101966865 12:109287755-109287777 GTGAGTAAACTGAGGCTCAGAGG + Intronic
1102009120 12:109607196-109607218 ATAAAGAAACTGAGGCTGAGAGG - Intergenic
1102741515 12:115211511-115211533 GTGAAAAAACTGAGGCTTACGGG - Intergenic
1103001801 12:117390479-117390501 ATGAGAAAACTGAGGCTGAAAGG + Intronic
1103054149 12:117805427-117805449 ATGAAGAAACTGAGGCTCAGAGG - Intronic
1104516329 12:129430641-129430663 ATGAGAAAACTGAGGCTGAGTGG - Intronic
1105910325 13:24858460-24858482 AAGGATAAACTGAGGCTTATTGG + Intronic
1106794947 13:33195826-33195848 ATGAAAAAACTGAGGCTCAGAGG - Intronic
1107616745 13:42176696-42176718 CTGAATAAACTGAGGCTGATTGG + Intronic
1107956918 13:45523508-45523530 CTTAAAAAAATGAGGCTGATTGG + Intronic
1109325249 13:60859495-60859517 CTGAATAAACTTAGCCTCCTTGG - Intergenic
1109558542 13:64015200-64015222 CTGATTTAACTGAGGCTGTTGGG + Intergenic
1109737689 13:66508062-66508084 ATGAACAAACTGAGGCAGAGAGG - Intronic
1110533242 13:76621277-76621299 ATGAATAAACTGCAGCTGAGTGG + Intergenic
1110733008 13:78902667-78902689 CTGTGAGAACTGAGGCTGATGGG - Intergenic
1110846254 13:80193536-80193558 ATGAGCAAACTGAGGCTTATAGG - Intergenic
1111734965 13:92126518-92126540 CTCAACAAACTGCTGCTGATGGG + Intronic
1111880603 13:93951644-93951666 ATGAAGAAACTGAGGCTGAGAGG - Intronic
1112440276 13:99420045-99420067 ATGAATAAAATGAGGCTTAGAGG + Intergenic
1112796226 13:103059495-103059517 CTGAATACACTCAGGCACATAGG - Intronic
1113186722 13:107695157-107695179 CTGAGAAAACTGAGGCTTAGAGG - Intronic
1113249933 13:108441119-108441141 CTGAAGAAACTGAAGCGTATGGG - Intergenic
1114351975 14:21862676-21862698 ATGAATAAACTGAGGATTATAGG + Intergenic
1114624061 14:24117157-24117179 CTGAATATACTGGGGCTGTAAGG - Intronic
1115148205 14:30251724-30251746 ATGAAGAAACTGAGGCTTAGAGG - Intergenic
1116466306 14:45236805-45236827 ATGAAGAAACTGAGACTGACAGG + Intronic
1119465979 14:74858966-74858988 CTGAGGAAACTGAGGCAGAGAGG - Intronic
1119743959 14:77031227-77031249 CCAAATCAACTGGGGCTGATGGG - Intergenic
1120458417 14:84761622-84761644 ATGAGGAAACTGAGGCTGAGAGG - Intergenic
1121333976 14:93065528-93065550 AAGAATAAACTGAGGCTTAGAGG + Intronic
1121434046 14:93907096-93907118 GTGAGGAAACTGAGGCTGAGAGG - Intergenic
1122004466 14:98690648-98690670 ATGAGTAAACTGAGGCTCAAAGG + Intergenic
1122129711 14:99597957-99597979 ATGAAGAAACTGAGGCTTAGAGG + Intronic
1122878322 14:104678887-104678909 CTGCAGAAACTGAGGCTCAAAGG + Intergenic
1123098201 14:105776347-105776369 ATGAACACACTGAGGCTGAGTGG + Intergenic
1124054599 15:26230677-26230699 ATGAAGAAACTGAGGCTATTGGG + Intergenic
1124257288 15:28154665-28154687 ATGAGGAAACTGAGGCTGAGAGG - Intronic
1124987007 15:34629645-34629667 ATGAATATATTGAGGATGATAGG + Intergenic
1125963769 15:43855313-43855335 GTGAAAAAACTGAGGCAGAGAGG + Intronic
1127315100 15:57787720-57787742 ATGAAGAAACTGAGGCTAAGGGG + Intergenic
1127487466 15:59432641-59432663 ATGAATAAACTTAGGCTTAGAGG - Intronic
1128327075 15:66730788-66730810 ATGAAAAAACTGAGGCTCAGAGG + Intronic
1128666197 15:69539958-69539980 CTGAAGGAAGTGAGGCTGAGCGG - Intergenic
1129859654 15:78850690-78850712 ATGAAGAAACTGAGGCAGAGTGG - Intronic
1129872235 15:78947871-78947893 ATGAGGAAACTGAGGCTGGTGGG - Intronic
1129939453 15:79481077-79481099 CTGAAGAAACTGATGCTCGTGGG + Intergenic
1130145205 15:81268859-81268881 CTGAGGAAACTGAGGCAGAGAGG + Intronic
1130742137 15:86612351-86612373 CTGAATAAACTTAGGCTGAATGG + Intronic
1131124975 15:89852153-89852175 ATGAAGAAACTGAGGTTTATTGG - Intronic
1133757831 16:8776004-8776026 CTGTATAAAATGAGGGTTATAGG + Intronic
1135044009 16:19139907-19139929 GTGAATAAACTGAGGTTCAGAGG - Intronic
1135382419 16:22006083-22006105 CTGAATAGAATGATGATGATTGG - Intergenic
1135640376 16:24114712-24114734 CTCAATACACTGAGTCTGGTGGG + Intronic
1136099161 16:27980584-27980606 ATGAAGAAACTGAGGCTGGCTGG + Intronic
1136230213 16:28881236-28881258 ATGAAGAAACTGAGGCTCAGAGG - Intronic
1136348700 16:29693558-29693580 ATAAATAAAATGAGGATGATGGG - Intronic
1137376942 16:47959981-47960003 CTGAAGAAACTTAGGCTCAAAGG - Intergenic
1137705081 16:50529595-50529617 CTGACTAAACTGAGACTTTTGGG + Intergenic
1138618280 16:58189841-58189863 AGGAATAAACTGAGGCTGAAGGG - Intronic
1140861562 16:79022898-79022920 CTGAGTAAACTGATGCTCAGGGG - Intronic
1140894011 16:79309173-79309195 CAGGAAAAACTGAGGCTGAAGGG + Intergenic
1141375982 16:83531267-83531289 CAGGAGAAACTGAGGCTGAAAGG - Intronic
1203139742 16_KI270728v1_random:1754095-1754117 TTGAATAAACTGTGGATGAAAGG - Intergenic
1142688992 17:1593450-1593472 CTTCATGGACTGAGGCTGATGGG + Intronic
1142702070 17:1668859-1668881 CTGAAGAAACTGAGAGGGATTGG - Intronic
1143248380 17:5504275-5504297 ATGAGGAAACTGAGGCTGAGAGG + Intronic
1143256285 17:5560386-5560408 ATGAGAAAACTGAGGCTCATAGG - Intronic
1144699267 17:17326235-17326257 ATGAAGAAACTGAGGCTCAGAGG + Intronic
1145977381 17:28992208-28992230 ATGAAGAAACTAAGGCTGAGAGG + Intronic
1146675006 17:34767384-34767406 CTGAGCAAACTGAGGCTCAGAGG - Intergenic
1147588185 17:41665145-41665167 CTGAGTTAACTGAGGCTCAGAGG + Intergenic
1148635642 17:49147216-49147238 CTGACTCAGTTGAGGCTGATTGG + Intronic
1148799003 17:50211263-50211285 TTGAGGAAACTGAGGCTCATTGG - Intergenic
1152482713 17:80565808-80565830 TTGAGTAAACTGAGGCTATTTGG + Intronic
1153666833 18:7374092-7374114 CTGATTACAATGGGGCTGATGGG - Intergenic
1153868585 18:9296227-9296249 CTGAAGAAACTGAGGCACAGAGG + Intergenic
1156622523 18:38869670-38869692 CTGAGGAAACTGAGGCTTAGGGG - Intergenic
1157291914 18:46415713-46415735 ATGAAGAAACTGAGGCTCAAGGG - Intronic
1157898087 18:51487337-51487359 CTGGAGAAGCTGAGGCTGAGTGG - Intergenic
1160060329 18:75524049-75524071 CTGAATAAAATGGGCCTCATGGG - Intergenic
1161398285 19:4056270-4056292 CTAGGGAAACTGAGGCTGATGGG - Intronic
1163480323 19:17551786-17551808 ATGAGGAAACTGAGGCTGAGCGG + Intronic
1165641019 19:37386744-37386766 CTGAATAAAAGAAGCCTGATGGG - Intronic
1166428258 19:42698861-42698883 CTGAATCAATTGAGGTTTATTGG - Intronic
1167906959 19:52669060-52669082 ATGAATAAAGAGTGGCTGATTGG - Intronic
926850172 2:17187942-17187964 ATGAATAAACTGAGGATGGAAGG + Intergenic
927481973 2:23461206-23461228 CTGAAGAGACTGAGGCAGAGGGG + Intronic
927677299 2:25115424-25115446 ATGAAAAAACTGAGGCTTAAAGG - Intronic
928314422 2:30234637-30234659 ATGAAGAAACTGAGGCTTACTGG - Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930474102 2:51857336-51857358 CTGAAGAAACTGAGTCTCAGGGG + Intergenic
930866766 2:56129600-56129622 CTGCAAAAACTGAGGCTCATGGG + Intergenic
931444928 2:62318820-62318842 CTGAGGAAACTGAGGCTCAGAGG + Intergenic
932004624 2:67915955-67915977 CAGAATAGACTTTGGCTGATCGG - Intergenic
932268686 2:70389955-70389977 CTGAATAATCCAAGTCTGATAGG + Intergenic
932688032 2:73890332-73890354 CTGAATAAACTGAAGCTCTGAGG - Intergenic
935469390 2:103438707-103438729 CTGAAGAAACTGAAGCTTAGTGG + Intergenic
935904055 2:107824347-107824369 CTGAACAAAATGAGGCTGGAAGG - Intergenic
936269451 2:111037678-111037700 CTGAGGAAACTGAGGCTCAGAGG + Intronic
937224161 2:120358640-120358662 CTGGAGCAACTGAGGCTGAGGGG + Intergenic
937261284 2:120588019-120588041 CTGAAGAAACCGAGGCAGAGAGG + Intergenic
937457793 2:122057989-122058011 CTAGATAAAATGAGGCTGTTAGG - Intergenic
940457336 2:153917032-153917054 CTGAATAAACTGAGGCCCAGAGG - Intronic
940591205 2:155730147-155730169 CTGTAGAAACAGATGCTGATAGG + Intergenic
940810660 2:158239002-158239024 ATGAAGAAACTGAGGCACATAGG - Intronic
941373386 2:164696076-164696098 CTGAGCAAACTGAGGCTCAAAGG - Intronic
941854447 2:170216424-170216446 ATGAAAAAACTGAGGCTCAAAGG + Intronic
942081561 2:172403892-172403914 CTGGACAAACTGAGGAAGATCGG + Intergenic
942521599 2:176809659-176809681 GTGAATCAACTGAGGCTGTCAGG - Intergenic
944691340 2:202161103-202161125 TTGAAGAAACTGAGGCTCAGGGG + Intronic
945390309 2:209257757-209257779 TAGAATAAACCCAGGCTGATTGG - Intergenic
946047759 2:216835320-216835342 ATGAAGAAACTGAGGTTCATGGG - Intergenic
946702784 2:222429280-222429302 CTGAATATACTAAGGGTGGTGGG - Intronic
946771388 2:223092472-223092494 CTGAAGAAACTGGAGCTGAAGGG - Intronic
948676707 2:239601192-239601214 GTGAGGAAACTGAGGCTGGTAGG - Intergenic
948723936 2:239920313-239920335 CTGTACAAACTGCTGCTGATGGG - Intronic
1168835646 20:875565-875587 ATGAAGAAACTGAGGCTCAGTGG - Intronic
1168902466 20:1376650-1376672 ATGAAGAAACTGAGGCAGACAGG + Intronic
1170309572 20:14977569-14977591 CTGAGGAAACTGAGGCAGAGAGG - Intronic
1172008938 20:31835310-31835332 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1172261293 20:33568127-33568149 CTGAGAAAACTGAGGCTTAGAGG - Intronic
1172838387 20:37887408-37887430 CTGGGGAAACTGAGGCTGAGAGG + Intergenic
1172870361 20:38131917-38131939 ATGAATAAACTGAGGCACAGAGG + Intronic
1173400216 20:42719553-42719575 CTGAAAAAAATGAGGCTCAGAGG - Intronic
1173907659 20:46640630-46640652 ATGAATAAATTGAGGCTCAGGGG + Intronic
1174171718 20:48621746-48621768 ATGAAAAAACTGAGGCTCAGAGG + Intergenic
1174746482 20:53068238-53068260 CTGAATAAACCCAGGGTTATGGG - Intronic
1178163450 21:29945423-29945445 CTAAAGAAACTGAGGCAGAGAGG + Intergenic
1179875268 21:44263663-44263685 CTGAATAAAATGTGGCTCCTTGG + Intergenic
1180859094 22:19066909-19066931 GTGAAGACACTGAGGCTGAGAGG - Intronic
1181294732 22:21827742-21827764 ATGAAGAAACTGAGGCAGAGTGG + Intronic
1181860536 22:25814530-25814552 ATGAAGAAACTGAGGCTCAGAGG + Intronic
1182463988 22:30503161-30503183 ATGAAGAAACTGAGGCTCAGTGG + Intronic
1182676948 22:32046670-32046692 CTTAAGAAACTGAGGATGTTGGG - Intronic
1183303440 22:37069744-37069766 CTGAATTCCCTGAGGCTGGTGGG + Intronic
950236119 3:11321698-11321720 CTGAGGAAACTGAGGCTCAGAGG - Intronic
950527025 3:13530226-13530248 CTGAGAAAACTGAGGCAGAAAGG - Intergenic
950715849 3:14847317-14847339 CTGAGGAAACTGAGGCACATAGG + Intronic
951087762 3:18534771-18534793 ATGAAGAAACTGAAGATGATTGG + Intergenic
951094063 3:18608087-18608109 CTGCATAAAATGCAGCTGATGGG - Intergenic
952246164 3:31594949-31594971 CTGAATACAAGGAGGCTGACAGG - Intronic
952656618 3:35793839-35793861 CAGAACAACCTTAGGCTGATTGG + Exonic
953328617 3:42033634-42033656 ATGAAAAAACTGTGGCTCATAGG - Intronic
954549213 3:51466354-51466376 CTCAACAAATTGTGGCTGATAGG - Intronic
954751464 3:52816578-52816600 GTGAAGAAACTGAGGCTCAGAGG + Intronic
955043984 3:55342661-55342683 ATGAGGAAACTGAGGCTGATGGG - Intergenic
955123427 3:56085032-56085054 ATGGAGAAACTGAGGCTGAAAGG - Intronic
955250946 3:57281590-57281612 CTCAATAAGCAGAGGCTTATTGG - Intronic
955386238 3:58483300-58483322 TTGAGGAAACTGAGGCTGAGAGG + Intergenic
955405555 3:58623558-58623580 CTGAGGAAACTGAGGCTCAGAGG + Intronic
955457069 3:59134779-59134801 ATGAAGAAACTGAGGCTCAAGGG + Intergenic
955559343 3:60172033-60172055 CTGTAAAAACTGGGGCTGTTTGG - Intronic
956615997 3:71173311-71173333 GTGAATAGAGTCAGGCTGATTGG - Intronic
957912250 3:86635066-86635088 CTGAATTATCTGAGGTTGTTAGG + Intergenic
958928925 3:100188619-100188641 CTGCATGAAATGATGCTGATGGG + Intronic
959595366 3:108123332-108123354 TTGAAGAAACTGAGGCACATAGG - Intergenic
959628305 3:108479233-108479255 CTGAAGGAACTGATGCTTATGGG - Intronic
959973661 3:112434459-112434481 TTGAGTAAACTGAGGCTCAGAGG - Intergenic
960299941 3:115990557-115990579 CTGAGAAAACAGAAGCTGATTGG - Intronic
962829309 3:139126114-139126136 CTGAGGAGACTGAGGCTGAAAGG + Intronic
962970467 3:140396288-140396310 TGTAATAAACTGTGGCTGATAGG + Intronic
964490682 3:157232744-157232766 ATGAACAAACTGAGACTGATAGG + Intergenic
964990240 3:162801872-162801894 CTGAAAAAACTAAGACAGATTGG + Intergenic
965002539 3:162973578-162973600 CTGAATTATTTGAGGCAGATTGG + Intergenic
967107530 3:186266358-186266380 ATGAATAAATTGAGGCATATCGG - Intronic
967413203 3:189187666-189187688 TTGAGAAAACTGAGGCTGAGGGG + Intronic
969848798 4:9940633-9940655 ATGAAGAAACTGAGGCTTACAGG - Intronic
970138971 4:12959268-12959290 CTGATTGAACTGAGGCTTAATGG - Intergenic
970280907 4:14453786-14453808 GTGAAGAAACTGAGGCTTACAGG + Intergenic
970899369 4:21140848-21140870 ATGAAGAAACTGAGACTGAGAGG - Intronic
971077013 4:23161582-23161604 ATGAATGAATTGAAGCTGATGGG - Intergenic
971127716 4:23772549-23772571 ATGAAGAAACTGAGGCTTAGAGG + Intronic
971255542 4:25010385-25010407 CTGAATAAACAGTGGGTGACTGG + Intronic
971300084 4:25434692-25434714 CTGAGTAAACTGAGGCTGAGTGG + Intergenic
972636757 4:40891125-40891147 CTGGGGAAACTGAGGCTGAAAGG + Intronic
973816886 4:54627281-54627303 CTGAATACATGGAGGCTGACAGG - Intergenic
973952832 4:56035023-56035045 CTAAAGAAAGTGAGGGTGATGGG - Intergenic
974472549 4:62337464-62337486 CTGGAGAAAATGAGTCTGATGGG - Intergenic
974845761 4:67349723-67349745 ATGAAGAAACTGAGGCAGAGAGG - Intergenic
974916833 4:68188423-68188445 CTGAATTCTCTGAGGCTTATGGG - Intergenic
975155390 4:71066749-71066771 CTGAAGAAACTATTGCTGATGGG + Intergenic
976103219 4:81588115-81588137 CAGAAAAAACTGAGCCTGATTGG - Intronic
976278514 4:83303162-83303184 CTGAATAAACTCAAGCTTCTAGG + Intronic
976610079 4:87021374-87021396 CTGGATAAACTGAGGCAAACAGG - Intronic
977213744 4:94253213-94253235 CTGAAAAAACCCAAGCTGATTGG + Intronic
977314851 4:95432936-95432958 CTGAATACACTGAGACTCTTGGG + Intronic
977869764 4:102077603-102077625 CAGAATAAAATTAAGCTGATAGG + Intergenic
978499052 4:109388871-109388893 GTCAATAAACCGTGGCTGATGGG + Intergenic
979819541 4:125153487-125153509 TTGAAAAAACTGAGGCTTACAGG - Intergenic
980981633 4:139659166-139659188 ATGGAGAAACTGAGGCTGAGAGG - Intergenic
985389323 4:189478648-189478670 CTGAAGAAACTCAGGCTGCCTGG + Intergenic
988869678 5:35374891-35374913 CTGAATTAGCTCAGTCTGATTGG + Intergenic
988910558 5:35836951-35836973 ATGAGAAAACTGAGGCTGAGTGG + Intergenic
990373741 5:55148873-55148895 GTGAAGAAACTGAGGCTTAGAGG + Intronic
992207996 5:74449582-74449604 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
992356156 5:75985927-75985949 CTGAATAATCTCAGGATAATGGG + Intergenic
992803618 5:80315542-80315564 CCAAATAAACTGAGGCAGAAAGG - Intergenic
992835863 5:80640806-80640828 ATGAGGAAACTGAGGCTGAATGG + Intronic
994347870 5:98708987-98709009 CAAAATAAACTGAGTCTGTTTGG + Intergenic
995251668 5:110000319-110000341 CTGAATAAACACTGGCTGACTGG + Intergenic
995402861 5:111761083-111761105 ATGAATAAACTGAGACTAAAAGG - Intronic
995575359 5:113525508-113525530 GTGAAGAAACTGAGGCTTAGAGG + Intronic
995872835 5:116760588-116760610 CTGAATAAACACAGGCCGTTTGG + Intergenic
996814642 5:127561440-127561462 ATGAAGAATCTGAGGCTGAAAGG - Intergenic
997721755 5:136083486-136083508 ATGAGTAAACTGAGGCTCAAAGG + Intergenic
997804713 5:136905720-136905742 CTGAATACACAGAGGCAGACAGG - Intergenic
998134523 5:139667743-139667765 ATGAAGAAACTGAAGCTCATAGG - Intronic
998460256 5:142304708-142304730 ATGAAGAAACTGAGGCTAAGAGG + Intergenic
998609085 5:143668358-143668380 CTGAATAAACGGGGGCAGAAAGG - Intergenic
998817113 5:146025862-146025884 ATGAGTACACTGAGGCTTATTGG - Intronic
998942541 5:147300231-147300253 CTGAAGAAACTGAGGCTCAAAGG + Intronic
1000382521 5:160641968-160641990 CTGAATGGAGTGAGGCTGAGAGG - Intronic
1001775836 5:174328526-174328548 ATGAGGAAACTGAGGCTGAAGGG + Intergenic
1001878356 5:175220387-175220409 GTGAAGAAACTGAGGCTGGGTGG - Intergenic
1002200913 5:177527649-177527671 ATGAAGAAACTGAGGCTTAGAGG + Intronic
1003378684 6:5602983-5603005 ATGAAGAAACTGAGGCATATTGG + Intronic
1005430010 6:25746466-25746488 CTTAATAAACTGGGGGTAATGGG + Intergenic
1005971940 6:30768626-30768648 TTGAAGAAACTGAGGCTTAGAGG + Intergenic
1006501220 6:34460187-34460209 CTGAGGAAACTGAGGCTCATTGG - Intergenic
1006901636 6:37506360-37506382 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1007274616 6:40664096-40664118 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1008086365 6:47248976-47248998 ATGAAGAAACTGAGGCAGAGAGG + Intronic
1008103996 6:47423519-47423541 TTGGATCAACTGAGGCTGTTTGG + Intergenic
1008547614 6:52597295-52597317 CTGAAGAAACTGAGGCTCACAGG + Intergenic
1009331144 6:62422211-62422233 CAGTATAAACTGACTCTGATTGG - Intergenic
1009700864 6:67178241-67178263 GTGAATAAATTGATACTGATTGG - Intergenic
1010064081 6:71660237-71660259 TTGAATAATATGTGGCTGATTGG + Intergenic
1011445342 6:87433146-87433168 CTGAATAAAATGAGGCAGCAAGG - Intronic
1012248001 6:96947792-96947814 ATGAAGAAACTGAGGCAGAGAGG + Intronic
1012759474 6:103280064-103280086 ATGGATAAACTGAGGCTCAGAGG + Intergenic
1012888333 6:104870995-104871017 CTGATTTAGCTGAGGCTCATGGG + Intergenic
1013600426 6:111699117-111699139 ATGAAAAAACTGAGGCTTAAAGG + Intronic
1013974691 6:116063856-116063878 GAGAAGAAACTGAGGCTGAAAGG + Intergenic
1016933792 6:149433818-149433840 ATGGATAAACTGAGGCTCACAGG - Intergenic
1017168442 6:151432536-151432558 CTGAGGAAACTGAGGGTCATAGG - Intronic
1018399522 6:163408774-163408796 CTGAAGAAGCAGAGGCTGAGAGG - Intergenic
1018739939 6:166720768-166720790 CTGAGTAAAATAAGGGTGATTGG - Intronic
1019501862 7:1368775-1368797 ATGAGGAAACTGAGGCTGAGAGG + Intergenic
1022578504 7:31523428-31523450 CCAACTAAACTGAGGGTGATTGG + Intronic
1023280013 7:38559699-38559721 ATGAGAAAACTGAGGCTTATAGG + Intronic
1023975938 7:45030089-45030111 CTGAAGAAACTGAGGCTGTGAGG - Intronic
1024685083 7:51735899-51735921 ATGCAGAAACTGAGGCTTATTGG + Intergenic
1025027937 7:55533607-55533629 CTGAAGAAGCTGAGGCTCAGGGG - Intronic
1026129795 7:67610757-67610779 CTGAAGAAACTGAGGCACAGAGG - Intergenic
1026352796 7:69532334-69532356 ATGAGAAAACTGAGGCTGAAAGG + Intergenic
1028136146 7:87225064-87225086 AAGTAAAAACTGAGGCTGATAGG - Intergenic
1029118529 7:98251272-98251294 GTGAATAAACTGAGACAGAAAGG - Intronic
1029579576 7:101426631-101426653 CTGGAGAAACTGAGGCTCAGAGG - Intronic
1029612714 7:101635863-101635885 CTGTAGAAACTGAGGCTCACAGG + Intergenic
1029685842 7:102147335-102147357 CTGAAGACACGGAGGCTGATGGG - Intronic
1029882451 7:103829727-103829749 CTGAATAAACTGTGTTTTATTGG - Intronic
1030303108 7:107993715-107993737 GTGATTAAACTGATGCTCATCGG - Intronic
1031896112 7:127349734-127349756 CTGAATAAAATGAAGGTTATAGG + Intronic
1032331321 7:130983201-130983223 CTGAATAAAGGGATGCTGAGGGG + Intergenic
1033573601 7:142658152-142658174 CTGAAATAATTGAGGCTTATGGG - Intergenic
1033606412 7:142931306-142931328 CTAAATAACCTGAGGATGCTGGG - Intronic
1034625643 7:152490262-152490284 CTGAAGAAACTGAGGTTCACAGG + Intergenic
1035328926 7:158084029-158084051 CTGAGTAAACTGAGGCCCAGCGG - Intronic
1035677976 8:1468360-1468382 CAGAATGGACTGAGGCTGCTGGG - Intergenic
1036828157 8:11995919-11995941 ATGAAGAAACTAAGGCTCATTGG + Intronic
1037565097 8:20111315-20111337 CTGAAGAAACAGACTCTGATGGG + Intergenic
1037577230 8:20218861-20218883 CTGAGTACACTGAGCCTGAGGGG - Intronic
1039891960 8:41691765-41691787 ATTAAGAAACTGAGGCTGAGAGG - Intronic
1039913431 8:41842573-41842595 ATGAAGAAACTGAGGCTTACAGG - Intronic
1040091758 8:43406149-43406171 CTGAATCAAGTGAACCTGATAGG - Intergenic
1040825241 8:51612852-51612874 CTGAATAAACTAAGACACATGGG + Intronic
1041789942 8:61683898-61683920 CTCAATAGAGTGAGGCTGAAAGG - Intronic
1043000850 8:74757905-74757927 CTGATTAAACTCAGGCGGTTGGG - Exonic
1044513923 8:93116654-93116676 ATGAGAAAACTGAGGCTGAGAGG - Intergenic
1044751432 8:95420041-95420063 AGGAATAAACTGAGGCACATAGG + Intergenic
1045418830 8:101993847-101993869 ATGAAGAAACTGAGGCTCAGAGG - Intronic
1046137956 8:110055043-110055065 CTAAGGAAACTGAGGCTGATAGG + Intergenic
1047059188 8:121204244-121204266 ATGAAGAAACCGAGGCTGAGAGG - Intergenic
1047063608 8:121255270-121255292 CTGATTACACTGGGGCTGACTGG - Intergenic
1047758793 8:127938941-127938963 ATGAGGAAACTGAGGCTGAGAGG + Intergenic
1047816707 8:128472432-128472454 CTGAATTATTTGAGGGTGATAGG - Intergenic
1048293811 8:133199917-133199939 CTCTTTAAAATGAGGCTGATAGG - Intronic
1048606990 8:135979276-135979298 ATGAAGAAACTGAGGCTAAGAGG - Intergenic
1048947875 8:139467048-139467070 ATGAGCAAACTGAGGCTGAGAGG - Intergenic
1049204090 8:141355327-141355349 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1049266778 8:141671803-141671825 CAGGGTAAACTGAGGCTTATGGG + Intergenic
1050162149 9:2730201-2730223 TTGAAGAAACTGAGGCTTAAAGG - Intronic
1050433554 9:5586118-5586140 CTCAGGAAACTGAGGCTCATAGG - Intergenic
1051136642 9:13930219-13930241 CTGAATAATCTGATGTTGCTTGG - Intergenic
1052459993 9:28750685-28750707 ATGAAGAAACTGAGGCTCAAAGG - Intergenic
1053297290 9:36923982-36924004 ATGAATAAACTGAGGCTCAAGGG + Intronic
1056062665 9:82900155-82900177 CTGAATAAACTGAGCCAGCAAGG - Intergenic
1056431468 9:86532533-86532555 ATGAATTAACTGAGGCTGAAAGG - Intergenic
1059260569 9:112972164-112972186 CTGAAAAATCTGAGGCCTATAGG + Intergenic
1059487498 9:114637950-114637972 ATGAATAAACTGAGACTCAAAGG - Intronic
1060012018 9:120052010-120052032 CTGAATAAACTGAGACCCAAAGG - Intergenic
1060201122 9:121652177-121652199 CTGAGTAAACTGAGGCACAGTGG - Intronic
1060423754 9:123487871-123487893 ATGAAGAAACTGAGGCTCAGAGG + Intronic
1060670712 9:125466900-125466922 CTGACTAAACAGGGGCTGACGGG - Intronic
1061008838 9:127943529-127943551 GTGAAGAAACTGAGGCTCAGAGG + Intronic
1061060370 9:128247214-128247236 GTGAGGAAACTGAGGCTGAGAGG + Intronic
1061421578 9:130475622-130475644 ATGAAGAAATTGAGGCTGAGCGG - Intronic
1188393205 X:29646612-29646634 CTGATTAGACTGAATCTGATTGG - Intronic
1190258572 X:48783450-48783472 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1190398656 X:50010029-50010051 CTGCATATACTGAGGGTGAGTGG + Intronic
1190502867 X:51096759-51096781 CATAATAAACTCAGGCAGATAGG + Intergenic
1190784399 X:53630416-53630438 ACGAATAAGCTGAGGCTGAGAGG + Intronic
1190946860 X:55103376-55103398 ATGAAGAAACTGAGGCTTAATGG + Intronic
1191884246 X:65873288-65873310 ATGAATAAACTGTGGCTTAGTGG + Intergenic
1192215712 X:69156770-69156792 CTGAAAAACATGAAGCTGATAGG - Intergenic
1193212835 X:78827861-78827883 GTGAAGAAACTGAGGCTCAATGG - Intergenic
1194766664 X:97849532-97849554 ATGAGTAAACTGAGGCTCAACGG - Intergenic
1195765653 X:108294152-108294174 CTGAGGAAACTGAGGCTTACAGG + Intronic
1196387178 X:115170196-115170218 CCGAATATATTTAGGCTGATTGG - Intronic
1197250570 X:124211830-124211852 ATAAAGAAACTGAGGCTCATGGG - Intronic
1197428317 X:126325574-126325596 CTGGATAAAGTGAACCTGATAGG + Intergenic
1197715366 X:129702427-129702449 AGGAAGAAACTGAGGCTGATGGG - Intergenic
1198401124 X:136269304-136269326 CTGGAGAAACTGAAGCTGTTGGG + Intergenic
1198509243 X:137332711-137332733 CTGAAGAAACTGAGGCTCAGAGG - Intergenic
1198959502 X:142169377-142169399 ATGAAAAACCTGAGGCTCATAGG - Intergenic
1199437558 X:147829442-147829464 CTGAATCAAATGGAGCTGATAGG + Intergenic
1200374006 X:155760257-155760279 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1202101282 Y:21310306-21310328 CTGAATGAACTGAGGTGGAACGG - Intergenic