ID: 1107625437

View in Genome Browser
Species Human (GRCh38)
Location 13:42277327-42277349
Sequence TAGAATAATCAGATGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107625437_1107625439 -5 Left 1107625437 13:42277327-42277349 CCTGCCTTCATCTGATTATTCTA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1107625439 13:42277345-42277367 TTCTAATTAACTTCTAACAATGG 0: 1
1: 0
2: 3
3: 19
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107625437 Original CRISPR TAGAATAATCAGATGAAGGC AGG (reversed) Intronic
900040175 1:454714-454736 TAGAAAAATGAGTTGAATGCTGG - Intergenic
900061604 1:689688-689710 TAGAAAAATGAGTTGAATGCTGG - Intergenic
902996528 1:20229757-20229779 TAGAAAACTCAGGTGCAGGCCGG + Intergenic
904749790 1:32734475-32734497 TAGAATATACATATGTAGGCCGG + Intergenic
905618608 1:39420369-39420391 AAGAAAAATCAGATAGAGGCAGG - Intronic
908452639 1:64271155-64271177 TTGAACAAACAGATGAAGTCTGG - Intergenic
908919453 1:69171536-69171558 TAGAACAAGAAGATGAAGGAAGG + Intergenic
909196607 1:72634522-72634544 TAGAAGAATCACATAAAAGCAGG - Intergenic
910742451 1:90534836-90534858 TGGGATGATCACATGAAGGCGGG + Intergenic
911772443 1:101763738-101763760 TGGCATTCTCAGATGAAGGCTGG + Intergenic
913461045 1:119086154-119086176 TAGAATTTTCTTATGAAGGCTGG - Intronic
914333120 1:146690740-146690762 TAGATTAATCATGTGGAGGCCGG - Intergenic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
917045425 1:170854467-170854489 TAGAATCCTCAGAAGAGGGCTGG - Intergenic
918355323 1:183702467-183702489 TAGATCCATCAGATGAACGCTGG + Intronic
918554914 1:185787264-185787286 GAGAAGAATTAGATTAAGGCTGG + Intronic
920360712 1:205414284-205414306 TAAAATAATAATATGGAGGCCGG + Intronic
922210892 1:223485983-223486005 TAGAATAATCAGTCCAATGCTGG + Intergenic
922276912 1:224087779-224087801 TAGAATAGACAAGTGAAGGCCGG + Intergenic
922297120 1:224260550-224260572 AATAATTATCAGATGAAGGCTGG - Intronic
922308249 1:224363338-224363360 TAGAAAATTCAAAAGAAGGCTGG - Intronic
923432944 1:233941166-233941188 TACAAAAATGAGAGGAAGGCAGG - Intronic
924220789 1:241873319-241873341 GACAGTAATCAGATTAAGGCAGG - Intronic
1063416802 10:5879860-5879882 TAGAAGAATAACATTAAGGCTGG + Intronic
1063847582 10:10148200-10148222 TATAAAAATCACATGGAGGCTGG + Intergenic
1066507418 10:36059891-36059913 TAGACTAATCACATTAAGGAGGG + Intergenic
1068004886 10:51381162-51381184 CAGAATAATCAGTTGAACCCAGG + Intronic
1069036182 10:63648369-63648391 TAAAATGTTCTGATGAAGGCTGG + Intergenic
1069131735 10:64712810-64712832 TATAAAAATCAGATGGAGCCAGG + Intergenic
1070362831 10:75707507-75707529 TAGAAAATGCAGATGAAAGCCGG + Intronic
1070364914 10:75727175-75727197 AAGAAAAATCAGGTGAAGGATGG - Intronic
1070945976 10:80392027-80392049 TAAAATAAACACATGATGGCTGG + Intergenic
1071040647 10:81305590-81305612 GAGATGAATCAGAAGAAGGCAGG + Intergenic
1071396239 10:85226849-85226871 TACTATAATCAAATGAAAGCTGG + Intergenic
1071536196 10:86433212-86433234 TTGATTAATCAAAGGAAGGCAGG - Intergenic
1073985749 10:109206929-109206951 TAGAATAATCAAATGAGTACTGG - Intergenic
1074197912 10:111205612-111205634 TGGAAAAATCAGAAGAAGGAAGG - Intergenic
1075165620 10:120065584-120065606 TATAAAAATGAGATGATGGCTGG - Intergenic
1076140599 10:128075864-128075886 TAGAAAAATCAGTGAAAGGCAGG - Intronic
1076966396 11:90619-90641 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080085032 11:28269708-28269730 TAGTATAATCAGTTAAAGACAGG + Intronic
1083672434 11:64306757-64306779 CAGAATACCCAGATGAGGGCAGG + Intronic
1083981122 11:66171271-66171293 TATAATAATCAAAAGAAAGCTGG - Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1086121297 11:83306883-83306905 TAGAATTATCAGAGGAAGAGAGG + Intergenic
1087260639 11:96007405-96007427 TAGAAAATTCAGAATAAGGCAGG + Intronic
1087292588 11:96336330-96336352 TAGAAAAATCAGAGGAAGAGAGG - Intronic
1087928592 11:103949419-103949441 GTGTATAATCAAATGAAGGCTGG + Intronic
1088251481 11:107864935-107864957 TAAAAGAATAATATGAAGGCTGG + Intronic
1088374925 11:109130433-109130455 TAGAAGAATTAGCAGAAGGCAGG + Intergenic
1090103520 11:123827413-123827435 GTGAATAATGAAATGAAGGCAGG - Intergenic
1092902164 12:13070112-13070134 CACAATAATCCTATGAAGGCAGG - Intronic
1093137641 12:15471348-15471370 TTAAATGATCAGATGCAGGCTGG - Intronic
1094171490 12:27497442-27497464 TGGTAAAATCAGATGGAGGCTGG + Intronic
1094332484 12:29310111-29310133 TAGAAGAAAGAGTTGAAGGCAGG - Intronic
1095228754 12:39708215-39708237 TATAATAATCACATGAAAACTGG - Intronic
1095552168 12:43455799-43455821 TAGGATAATCACATGAATGTGGG - Intronic
1096973925 12:55687784-55687806 AAGATAAATCAGATGCAGGCTGG - Intronic
1097558255 12:61167157-61167179 TAGAAGACTCAGAAGAAGACAGG - Intergenic
1099545429 12:83973740-83973762 TAGGCTGATCAGATGAATGCTGG - Intergenic
1099656932 12:85505259-85505281 TAGAAGAATCACTTGAAGCCAGG + Intergenic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1104542887 12:129683838-129683860 TAGAATACTAATATGATGGCTGG - Intronic
1104756114 12:131270331-131270353 CAGCATCATCAGATGAAGGCAGG + Intergenic
1104777662 12:131400694-131400716 CAGCATCATCAGATGAAGGCAGG - Intergenic
1105389684 13:19963132-19963154 TAAAAAAATCACATGCAGGCCGG - Intronic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1108645783 13:52426228-52426250 GAGAATAATTAGATGTATGCAGG - Intronic
1109137000 13:58664843-58664865 TAAAATAATAAGAGGAAAGCTGG - Intergenic
1109170065 13:59083940-59083962 TAGAATAACTAGTTCAAGGCCGG - Intergenic
1111098115 13:83540970-83540992 TAGAATATTCATATTAAGGATGG - Intergenic
1111162617 13:84415119-84415141 TACAATAATCAGAATAAGGGAGG - Intergenic
1111409632 13:87857621-87857643 GAGACTAATCAGATTAAGGGTGG + Intergenic
1112546640 13:100377473-100377495 TAAAATAAAAAGATGGAGGCTGG - Intronic
1112803754 13:103139558-103139580 TGCAATAAACAGATGAATGCAGG - Intergenic
1113038397 13:106076733-106076755 TAGAAGAATCACTTGAACGCGGG + Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115569831 14:34655967-34655989 TATAATAAACAAATTAAGGCTGG - Intergenic
1116567185 14:46463263-46463285 AACAATAATCACATGAAAGCTGG - Intergenic
1116925333 14:50629007-50629029 TAGAATAATAAAAAGTAGGCTGG - Intronic
1116925848 14:50636001-50636023 TAGAAGAATTATATGTAGGCCGG - Intronic
1117146478 14:52841148-52841170 TAGAATAAACAAAAGAGGGCCGG - Intergenic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1119039476 14:71259927-71259949 TAGAATAATAAAATGAAGGATGG + Intergenic
1120351255 14:83361784-83361806 TGGAATATTTAAATGAAGGCAGG - Intergenic
1121901145 14:97694487-97694509 TCAAATAATGTGATGAAGGCTGG + Intergenic
1122260497 14:100517371-100517393 TAAAATAATCCAAAGAAGGCAGG - Intronic
1124455994 15:29843483-29843505 TAGAAAAATCAAAGGTAGGCTGG - Intronic
1124573622 15:30888140-30888162 TAGAAAAATAATTTGAAGGCTGG + Intergenic
1125299086 15:38235114-38235136 TATAAAAATCAAATTAAGGCCGG - Intergenic
1125366152 15:38918954-38918976 TGGAGAAATCAAATGAAGGCTGG - Intergenic
1125850796 15:42901062-42901084 TAAAATTATTAGAGGAAGGCCGG + Intronic
1125917679 15:43503749-43503771 AAGAAGAATCAGGAGAAGGCAGG - Intronic
1127119999 15:55763256-55763278 CAGAAGAATCAGATGAACCCGGG + Intergenic
1127342728 15:58065180-58065202 TAGTATCCTCAGATGGAGGCCGG - Intronic
1127470918 15:59289278-59289300 TAAAATAATCAGCTGAATCCAGG + Intronic
1127918437 15:63474321-63474343 TTGACTAAGCAGATGAAAGCAGG - Intergenic
1129083597 15:73064957-73064979 TAAAATAATCCAAGGAAGGCAGG - Intronic
1129571647 15:76692390-76692412 TAGAAAAATAACATGAAGGCTGG + Intronic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1130544893 15:84848785-84848807 AACACTAATCAGATGAAAGCTGG + Intronic
1131693130 15:94847405-94847427 CAGGATAATCAGATGTAGGAGGG - Intergenic
1132441732 15:101872906-101872928 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1134759900 16:16705086-16705108 TAGAAAAATGAAATGCAGGCTGG + Intergenic
1134986172 16:18654119-18654141 TAGAAAAATGAAATGCAGGCTGG - Intergenic
1135133813 16:19873166-19873188 TTGAAAAATAAGAGGAAGGCTGG + Intronic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135510061 16:23074923-23074945 TAGAATATTTAGCTGAATGCTGG + Intronic
1135558630 16:23457723-23457745 TAAAAGAATCAGCTGCAGGCCGG + Intergenic
1136055482 16:27685443-27685465 TAGAAAAATAAGATGAAACCAGG + Intronic
1138845749 16:60563815-60563837 TTGAAAAATAAGATGATGGCAGG + Intergenic
1138910254 16:61388052-61388074 CAGAAGAATCATTTGAAGGCAGG - Intergenic
1139095315 16:63698200-63698222 GTGAAAAATCAGGTGAAGGCCGG + Intergenic
1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG + Intronic
1140000500 16:71020510-71020532 TAGATTAATCATGTGGAGGCCGG + Intronic
1141359314 16:83380681-83380703 TAGAATATGGAGGTGAAGGCTGG - Intronic
1141365320 16:83437373-83437395 TCGATTAATAAGATAAAGGCTGG + Intronic
1144048947 17:11480884-11480906 TTAAAAAATCAGTTGAAGGCAGG + Intronic
1144132084 17:12255760-12255782 AAGAACAATCAGCTGAAAGCAGG - Intergenic
1144615355 17:16766443-16766465 TATAAAAAGCAGATGTAGGCCGG + Intronic
1144897346 17:18549219-18549241 TATAAAAAGCAGATGTAGGCCGG - Intergenic
1145135026 17:20396502-20396524 TATAAAAAGCAGATGTAGGCCGG + Intergenic
1146152569 17:30488068-30488090 TAGAATAATTGGATCAGGGCTGG - Intronic
1147682829 17:42263821-42263843 TATAATAAACAGATTATGGCTGG - Intronic
1149684657 17:58528426-58528448 TAGAACCAGCAGATGGAGGCTGG + Intronic
1149771190 17:59322514-59322536 TAGAAGAATCACTTGAACGCGGG - Intergenic
1150883236 17:69055323-69055345 AACAATAATCAGAAGAAAGCTGG + Intronic
1151264734 17:72945946-72945968 TAGAAAAATCAGATAAAGTCTGG + Intronic
1153771092 18:8416938-8416960 TAGAATAAGTGGACGAAGGCAGG + Intergenic
1155185189 18:23381499-23381521 TAGAAAATACAGATGGAGGCCGG - Intronic
1155348809 18:24885803-24885825 TAGAGTGATGAGATGAAGGCAGG + Intergenic
1155356639 18:24960062-24960084 TGTAATAATCAGAAGAAGACAGG - Intergenic
1160643199 19:160241-160263 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1163286260 19:16350123-16350145 TTTAAAAATCAGATGGAGGCTGG + Intergenic
1163436139 19:17296348-17296370 TTGAAGAATCTGATGAGGGCCGG - Intronic
1163997481 19:21064605-21064627 TAGAATCAACAGTTCAAGGCCGG - Intergenic
1164924444 19:32117777-32117799 TAGAATAATTATATGCTGGCTGG - Intergenic
1165078530 19:33294299-33294321 TAAACTAATCACATGAAGGCAGG + Intergenic
1166018373 19:40001280-40001302 TAAAATAATCTAATTAAGGCAGG - Intronic
1166372280 19:42308842-42308864 TAGAATGACCAGATGAGGCCAGG - Exonic
1167059773 19:47136784-47136806 TATAAGACTCAGGTGAAGGCCGG - Intronic
925273475 2:2631919-2631941 TAGAAGCATCATCTGAAGGCTGG - Intergenic
925476365 2:4221112-4221134 TAGAATATATAGAGGAAGGCAGG - Intergenic
926272567 2:11377726-11377748 TAGAATTATTAGAGAAAGGCCGG + Intergenic
926347915 2:11966236-11966258 TAGTCAAATCAGATGAAGGCAGG - Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927656092 2:24947999-24948021 AATAATAATCAGATGAAAACAGG + Intronic
927821412 2:26268848-26268870 TAGAAAAAGCAGGGGAAGGCTGG + Intronic
928879123 2:36077261-36077283 AAGAAAAATCAGAGAAAGGCAGG + Intergenic
929968396 2:46552526-46552548 GAGAATATTCAGATGAAGGAGGG - Intronic
931049863 2:58399957-58399979 TATAAATATCAGATGAAGGAAGG + Intergenic
931569713 2:63655998-63656020 TAAATTAATCTGATGAAGGACGG + Intronic
931876833 2:66522679-66522701 TGGAGTAATTAGATGAAGCCAGG + Intronic
932129286 2:69173287-69173309 TAGAAATATCAGATGGAGTCAGG - Intronic
932245976 2:70196761-70196783 TAAAATAATCATTTGAAGCCAGG - Intronic
936063834 2:109315759-109315781 TAGAGTATTCAGGTGAATGCCGG + Intronic
936929267 2:117770297-117770319 TATAATACACAGATGCAGGCAGG + Intergenic
937013348 2:118581474-118581496 TATAATAATCAGATGAGGCAGGG - Intergenic
937371308 2:121299434-121299456 TACAAAAATCAGCTGAATGCGGG - Intergenic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
942330510 2:174818693-174818715 TAGAATAAACATATGAAAGGAGG + Intronic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
944674515 2:202023913-202023935 TAGAATAATAAGGGGGAGGCAGG + Intergenic
944706383 2:202293170-202293192 TAGAACAATCGGATGAATGCAGG + Intronic
946069732 2:217023678-217023700 TAGAACAAAAAGATGAAGGAAGG - Intergenic
1173212954 20:41051385-41051407 TAGGGTAATCAGATCAGGGCAGG - Intronic
1173562162 20:44013723-44013745 TAGAATAAGCAGCTGCAGGCAGG - Intronic
1183486686 22:38091148-38091170 CAGAATAATCACTTGAAGCCGGG - Intronic
1183850030 22:40577900-40577922 TAAAAAGATCAGATGTAGGCCGG - Intronic
1184579768 22:45408116-45408138 AATAATAATAAGATGAAGGAAGG - Intronic
1184632849 22:45798686-45798708 AAGAAAAATCAGATGCATGCAGG + Intronic
949677036 3:6467365-6467387 TAGAAGAATAAAATGAAGGAGGG + Intergenic
950244050 3:11399049-11399071 TTTAAAAATCAGATGCAGGCTGG + Intronic
951222728 3:20085805-20085827 TAGAAAAATTACATGTAGGCAGG - Intronic
952812541 3:37417395-37417417 AATAATAAACAGAGGAAGGCGGG + Exonic
954470001 3:50685657-50685679 TGGAATAATTATATGAAAGCTGG + Intronic
957738917 3:84237524-84237546 AAGAATAGACAGATTAAGGCGGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
963427049 3:145143737-145143759 TATAATAATCAGATTATGGTAGG + Intergenic
964598046 3:158459300-158459322 TAGATAAATCAGATTTAGGCAGG + Intronic
965570276 3:170165454-170165476 CAGAATTATATGATGAAGGCTGG + Intronic
966649798 3:182287024-182287046 TAATATAATCAGATGAATTCAGG + Intergenic
966869173 3:184278743-184278765 TAGAAGAATAAGAGGAAGGAAGG - Intronic
967223829 3:187272674-187272696 TAGAATAGGCAGTTGTAGGCGGG - Intronic
967765819 3:193278288-193278310 CAGACTAATTAGATGACGGCAGG - Intronic
970266607 4:14295211-14295233 TAGGAAAATCAGATGAATGATGG - Intergenic
970376780 4:15466658-15466680 TACAATAATCAGATGGAGAGTGG - Intergenic
970415843 4:15856159-15856181 TAGAATAATCAGATACAAGTTGG + Intergenic
970765312 4:19541319-19541341 TAAAGTAATCAGATGAAGCCTGG - Intergenic
971891775 4:32533252-32533274 TAGACCAATCAGATGAAAGAAGG + Intergenic
972419780 4:38876465-38876487 GAGAATAAGCATAGGAAGGCAGG - Intronic
972475315 4:39444436-39444458 GAGAAGAATGAGATGAAGGTGGG - Intronic
973212093 4:47627276-47627298 AATAATAATCAGATGAGGCCAGG - Intronic
974000938 4:56510061-56510083 TAGAATTATAAGAGGGAGGCTGG + Intronic
974476907 4:62393920-62393942 TAAAATAATCACATGATGGTTGG - Intergenic
974583431 4:63836948-63836970 AAGAATCATCAGGTGGAGGCAGG + Intergenic
976211120 4:82671062-82671084 TATAATAATCAAAAGAAGGTAGG + Intronic
976247689 4:83020056-83020078 TAAAATAATCTGTTGATGGCAGG + Intergenic
976436294 4:85022374-85022396 TAAAAAAATCAGATCTAGGCTGG + Intergenic
976958349 4:90933723-90933745 TAAAATAATCATATAAATGCTGG + Intronic
977308022 4:95349786-95349808 GAGAAAAATGAGATAAAGGCAGG - Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
979228208 4:118315938-118315960 TTGAATAATTAGTTGAAGCCAGG - Intronic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
981925150 4:150131181-150131203 TAAAATGATCAAATGAAGCCAGG - Intronic
982425278 4:155251317-155251339 TACAATTATCAGCTCAAGGCTGG - Intergenic
983474978 4:168202825-168202847 TAGAGCACTCAGATGAAGACAGG + Intergenic
983572857 4:169228833-169228855 TAGAATTATCAAATTAGGGCAGG - Intronic
984886997 4:184457966-184457988 TGGAACAAACAGATGAAGGAGGG - Intronic
985260297 4:188108602-188108624 TAGAGAGATCAGAAGAAGGCAGG - Intronic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
986634675 5:9809641-9809663 CAGAATGAACAGATGAAGACAGG + Intergenic
987784054 5:22476052-22476074 TAGAATAGTTACATGAAGGGAGG - Intronic
988318165 5:29658842-29658864 AAAAATAATCTGAGGAAGGCTGG + Intergenic
988428199 5:31088638-31088660 TATTATAATCACATGAAGGAGGG - Intergenic
988957680 5:36335221-36335243 TAAAAAACTAAGATGAAGGCTGG - Intergenic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991460954 5:66858047-66858069 TAGAAGAATCAGTTGAACCCAGG - Intronic
991943369 5:71876437-71876459 TATAAAAATCACATGCAGGCCGG - Intergenic
992742660 5:79789830-79789852 AAGAATAAACAGAACAAGGCTGG - Intronic
993127357 5:83851583-83851605 AAGAAAAACCAGATGCAGGCCGG - Intergenic
994824072 5:104690690-104690712 CAAAATAATCAGGTGAAAGCTGG - Intergenic
994926749 5:106126098-106126120 TAAAATAACCAGGTGAGGGCCGG + Intergenic
996110796 5:119564156-119564178 TTGAATAATCAGTTGAAGTTGGG + Intronic
996149607 5:120019452-120019474 TAGAATAATCACAGGCAGGGAGG - Intergenic
996944153 5:129046548-129046570 TAGAAAAAAAAGATGAAGGAAGG - Intergenic
999274873 5:150323527-150323549 AAGAAGAATGAGCTGAAGGCAGG - Intronic
1000420459 5:161032797-161032819 AAGAATATTCTCATGAAGGCTGG - Intergenic
1001205372 5:169757212-169757234 TAGCAAAATCAGATGACTGCAGG - Intronic
1002465670 5:179407242-179407264 TTGAAGCATCAGATGATGGCGGG + Intergenic
1002733672 5:181364229-181364251 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1002750869 6:109889-109911 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1003228560 6:4228731-4228753 TAGAAAAATGAGTAGAAGGCTGG + Intergenic
1003962215 6:11219393-11219415 AAAAATAATCAGAGGAAGCCGGG - Intronic
1004308531 6:14523067-14523089 TAGAACAAGAAGATGAAGGAAGG - Intergenic
1004652365 6:17622832-17622854 TATATTAAGCAGATAAAGGCTGG + Intronic
1004909928 6:20273127-20273149 CAGAAGAATCACATGAAGTCAGG - Intergenic
1005106569 6:22230166-22230188 GAAAATACTCAAATGAAGGCAGG - Intergenic
1005307211 6:24525400-24525422 TAGAAAATTCAGCTGAGGGCCGG + Intronic
1006901481 6:37505118-37505140 TAGAAAAATCAAATAAAGCCAGG - Intergenic
1007917658 6:45576111-45576133 TAGAATCCTAAAATGAAGGCAGG - Intronic
1008136241 6:47780444-47780466 CAGAATCATAAGATGAAGGTTGG - Intergenic
1008853722 6:56055755-56055777 TAGATGAAGCAGATGAAGGGAGG + Intergenic
1010086751 6:71928467-71928489 TAGGATAATCAGATAAAAGATGG - Intronic
1010964935 6:82193976-82193998 TAGAAAAGTCAAATGAAGGCTGG - Intronic
1011772177 6:90685967-90685989 TAGATTATTAAAATGAAGGCAGG + Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1015492007 6:133837274-133837296 TAGAATAATAAAATGCAGCCGGG + Intergenic
1017381928 6:153841386-153841408 TAGAAGAAACAGAAGACGGCCGG + Intergenic
1017755903 6:157528935-157528957 AAGCATAATTAGATGAAGACTGG + Intronic
1019237922 6:170636551-170636573 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1020183179 7:5938269-5938291 TTAAAAAATCAGCTGAAGGCTGG + Intronic
1020299734 7:6786488-6786510 TTAAAAAATCAGCTGAAGGCTGG - Intronic
1020802464 7:12748544-12748566 TAGAAATATCCGATGGAGGCCGG + Intergenic
1021095505 7:16530898-16530920 TAAAATACCCAGATGAGGGCTGG + Intronic
1022731282 7:33028703-33028725 TAGAAAAATCAGAAAAAGGATGG + Intronic
1023363922 7:39444285-39444307 GAAAAAAACCAGATGAAGGCCGG + Intronic
1023593050 7:41799146-41799168 TAGACTAATCATCTGAAGGAAGG + Intergenic
1024076778 7:45825033-45825055 TAGAAAAATCTGATTAAGGCTGG - Intergenic
1024375719 7:48636125-48636147 TACAATAATGAGAAGAAAGCAGG - Intronic
1025127636 7:56356387-56356409 TAGAAAAATCTGATTAAGGCTGG + Intergenic
1025602866 7:63015967-63015989 TAGAAAAATGTGATTAAGGCCGG + Intergenic
1029289944 7:99494825-99494847 TAGGATAATCAGTTGAACTCGGG - Intronic
1029992468 7:104974751-104974773 TAGAAAAATCAAATGTAGGCCGG + Intergenic
1031190964 7:118550343-118550365 TACAAAAATGAGATGAAGGAAGG + Intergenic
1032826231 7:135571218-135571240 TTGAACAATGAGATGAAGTCAGG - Exonic
1033461991 7:141555099-141555121 TAGAAAAACCAGAGGAAGCCTGG + Intronic
1033874938 7:145804426-145804448 AATAAAAATCAAATGAAGGCAGG - Intergenic
1033874981 7:145804734-145804756 AATAAAAATCAAATGAAGGCAGG - Intergenic
1033913338 7:146291574-146291596 TTCAATAAACAGCTGAAGGCAGG + Intronic
1034118376 7:148604735-148604757 TAAAATAAACAGAAGAAGGCAGG + Intronic
1035509848 8:170059-170081 TAGAAAAATGAGTTGAATGCTGG - Intergenic
1036393053 8:8341834-8341856 TAGAATTATAAAATGACGGCCGG + Intronic
1036477532 8:9106668-9106690 AAAAATATTCAGATTAAGGCCGG - Intronic
1036498547 8:9292992-9293014 TTGAATATTCAGATGATGGTGGG - Intergenic
1038294191 8:26275776-26275798 TAAAAAAATCTGATGAAGCCAGG + Intergenic
1038390570 8:27196231-27196253 GAGAATAATGACATGAAGCCTGG - Intergenic
1039111862 8:34049698-34049720 TAAAATTATCTGATGATGGCTGG - Intergenic
1039600257 8:38830561-38830583 TAAAATAACCAGAAGATGGCTGG - Intronic
1042243536 8:66688494-66688516 TAGAATAATTAGAGGAAAGGAGG - Intronic
1043201680 8:77377505-77377527 TAGAGTAATCAGATTCAGACAGG - Intergenic
1044318833 8:90779600-90779622 TAGAAAAATCAACTCAAGGCTGG - Intronic
1044768588 8:95604831-95604853 GAGAACATTCAGAGGAAGGCAGG - Intergenic
1045755701 8:105538713-105538735 TAAAACAATGAGATGGAGGCTGG + Intronic
1046689803 8:117269616-117269638 TAGAATTATAATATGTAGGCTGG - Intergenic
1047730135 8:127721035-127721057 TAGAATTACTATATGAAGGCTGG + Intergenic
1049829636 8:144692223-144692245 CAGAATAGCCAGATGAGGGCAGG - Intergenic
1050493566 9:6215616-6215638 TAAAATATTCAGATGGAGGGAGG + Intergenic
1055128196 9:72743701-72743723 TAGAATATTCATAGGAAGGAAGG + Intronic
1056461880 9:86816645-86816667 TAAAATGATCTGAAGAAGGCAGG + Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056948085 9:91017846-91017868 TAGAACTATCAGGTGGAGGCAGG - Intergenic
1056983741 9:91341820-91341842 TAGAAAAATGTGATGGAGGCTGG + Intronic
1057001603 9:91514771-91514793 TAAAAGAATAAGATGTAGGCTGG - Intergenic
1058122791 9:101157169-101157191 TAGAAAAATCAGGTGAAGTGGGG - Intronic
1058810432 9:108633777-108633799 TAGAATAATCCTATGTGGGCTGG - Intergenic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1060317366 9:122525044-122525066 TAGACTAAGGAGATGAGGGCAGG + Intergenic
1060489426 9:124071631-124071653 TAGAGGAATCATATGAGGGCAGG - Intergenic
1060720863 9:125976387-125976409 TTGAATAAATAGATGAAGGGAGG + Intergenic
1061613087 9:131761541-131761563 TAGGAGAATCAGTTGAAGCCAGG - Intergenic
1062605564 9:137347102-137347124 TAGAAAAATGACATGGAGGCTGG - Intronic
1062758128 9:138316847-138316869 TAGAAAAATGAGTTGAATGCTGG + Intergenic
1203788027 EBV:138704-138726 TAGAATATTTGCATGAAGGCAGG - Intergenic
1186453303 X:9691137-9691159 TAGAATCATCAGAGGTAGGCCGG + Intronic
1187532504 X:20109747-20109769 AAAAATATTCAGATTAAGGCTGG + Intronic
1188018552 X:25131514-25131536 ACAAATAATCAGAAGAAGGCTGG + Intergenic
1189595687 X:42563228-42563250 TAGAATGAGGACATGAAGGCTGG - Intergenic
1189705688 X:43756553-43756575 TAGAATAAAGATATGAAAGCGGG - Intergenic
1189993045 X:46612629-46612651 TAGAAAACTGAGATGCAGGCCGG + Intronic
1190647865 X:52539547-52539569 AAGCATCATCAGATGAATGCAGG + Intergenic
1193071616 X:77312124-77312146 TAGAAAAATAAGAGGGAGGCTGG + Intergenic
1195056540 X:101151532-101151554 TAGAATAGTATGATGAAGCCAGG + Intronic
1195307611 X:103600710-103600732 GAAAATAAAAAGATGAAGGCAGG - Intergenic
1196420034 X:115511871-115511893 TAGAATACTCAGCTGAACGTAGG + Intergenic
1196799382 X:119528987-119529009 AAAAAAAATCAGATTAAGGCCGG + Intergenic
1197289083 X:124632744-124632766 TAAAACAATCAGATAAATGCAGG + Intronic
1198021613 X:132664303-132664325 TAGAAAAATAAAGTGAAGGCTGG - Intronic
1198519691 X:137440329-137440351 TAGAAGAGTCACATGCAGGCAGG + Intergenic
1201322416 Y:12714748-12714770 TAGATTTAACAGATGGAGGCCGG - Intronic
1201366628 Y:13213507-13213529 CACAATAAACAGATGTAGGCCGG - Intergenic
1201611996 Y:15852993-15853015 TAGATTAATCAGTTGAAAGAAGG + Intergenic