ID: 1107626008

View in Genome Browser
Species Human (GRCh38)
Location 13:42284867-42284889
Sequence TTGAAGCAGCAGCATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 562}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107626008_1107626009 20 Left 1107626008 13:42284867-42284889 CCTTTCTCATGCTGCTGCTTCAA 0: 1
1: 0
2: 2
3: 35
4: 562
Right 1107626009 13:42284910-42284932 TTATTGTTATAGAGACCACTAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1107626008_1107626010 21 Left 1107626008 13:42284867-42284889 CCTTTCTCATGCTGCTGCTTCAA 0: 1
1: 0
2: 2
3: 35
4: 562
Right 1107626010 13:42284911-42284933 TATTGTTATAGAGACCACTAGGG 0: 1
1: 0
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107626008 Original CRISPR TTGAAGCAGCAGCATGAGAA AGG (reversed) Intronic
901354643 1:8634155-8634177 TAGTAGCAGCAGCGTGAGGATGG - Intronic
901388539 1:8927257-8927279 TTGAAGTAGCCAGATGAGAATGG + Intergenic
901795394 1:11676709-11676731 AAGAAGCACCAGCATGACAAGGG - Intronic
901862319 1:12082187-12082209 GTGAAGCACCATCATAAGAAAGG - Intronic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
902385852 1:16075371-16075393 TTGAGGCAGCAGCGTGGGATAGG + Intergenic
902546025 1:17190824-17190846 GTGTAGCAGCAGCGTGAGGAAGG - Intergenic
903083232 1:20830300-20830322 TTGAAGTGGCAGCTTCAGAATGG - Intronic
903575795 1:24339019-24339041 ATGAAGCAGCAGCAGCAGTATGG - Intronic
903737349 1:25538517-25538539 AAGAAGCAGCTGCATGGGAAGGG + Intergenic
903857556 1:26345816-26345838 TTGAGGCAGCTGCCTGAGACCGG - Exonic
904867605 1:33593349-33593371 TTTTATCAGCAGCATGAAAATGG - Intronic
904933213 1:34107056-34107078 CTGGATCAGCAGCAAGAGAAAGG + Intronic
905066130 1:35184800-35184822 TTGAAACAGGTGTATGAGAATGG - Intronic
905961911 1:42050119-42050141 AGGAGGCACCAGCATGAGAATGG + Intergenic
906645958 1:47475275-47475297 ATGAAGCTGGAGCATGAGCAGGG - Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907875382 1:58481953-58481975 TTTCATTAGCAGCATGAGAATGG + Intronic
908885346 1:68781923-68781945 TTTATTAAGCAGCATGAGAACGG + Intergenic
909073389 1:71023950-71023972 TTTAAGCAGCAGCATGGGCCAGG - Intronic
909342241 1:74545162-74545184 TTGAACCAGTAGACTGAGAAAGG + Intergenic
909751520 1:79166670-79166692 CTTTAGTAGCAGCATGAGAATGG + Intergenic
910643659 1:89490455-89490477 CTTAATCAGCAGCATGAGAATGG - Intergenic
911710537 1:101066643-101066665 TGGTAGGAGCAGGATGAGAAGGG + Intergenic
911853185 1:102844001-102844023 TCCAAGAAGCAGCAAGAGAATGG + Intergenic
913234854 1:116770972-116770994 TAGAGGCAACAGCATGAGCAAGG + Intergenic
913315459 1:117547337-117547359 TTAAAGCAGAATGATGAGAATGG + Intergenic
913315814 1:117550323-117550345 ATCCAGCAGCAGCCTGAGAAGGG - Intergenic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
913384196 1:118241800-118241822 GGGAAGCAGCAGCATGAGTTAGG - Intergenic
913402949 1:118456061-118456083 TTTTATCAGCAGCATGAAAACGG - Intergenic
914750668 1:150532876-150532898 TCCAAGAAGCAGCATTAGAAAGG - Intergenic
915193829 1:154174228-154174250 GGGAAGCTGAAGCATGAGAATGG + Intronic
915268005 1:154732455-154732477 TGGAAGCAGAAGCCTGGGAAAGG + Intronic
915702562 1:157810095-157810117 TTGATGCAGCAACATGAAGATGG + Intronic
916733966 1:167590606-167590628 TTTTATCAGCAGCATGAAAACGG + Intergenic
916880593 1:169016499-169016521 TTGCAGCAGGAGTAGGAGAAAGG - Intergenic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
917730538 1:177870605-177870627 CGGAAGCAGAAGGATGAGAAAGG + Intergenic
917895164 1:179480180-179480202 CTTTATCAGCAGCATGAGAATGG - Intronic
919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG + Intronic
920036830 1:203071528-203071550 TTGAAGGAGCAGCTTCAAAAAGG + Intronic
920795820 1:209135027-209135049 TTGAAATAGCTGCATGAGATAGG - Intergenic
921023344 1:211256779-211256801 CTGATGCAGAATCATGAGAAGGG - Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921601199 1:217108658-217108680 GTGAAGCAGAAGCAAGAGAGAGG - Intronic
922511906 1:226175660-226175682 TTAAAGCAGCAGTAGGAAAATGG + Intronic
922874997 1:228933634-228933656 TTGAATCAGCAGCAACAGACTGG - Intergenic
923685239 1:236148922-236148944 GTGAAGCAGCAGCCTTAGAGAGG - Intronic
923762318 1:236858122-236858144 CTTTATCAGCAGCATGAGAATGG - Intronic
923876691 1:238057696-238057718 CTTTATCAGCAGCATGAGAATGG - Intergenic
924297948 1:242607802-242607824 TTTTCACAGCAGCATGAGAATGG - Intergenic
924313973 1:242776570-242776592 CAGAAGCAGGAGCAAGAGAAAGG + Intergenic
924625456 1:245693578-245693600 TTGACTCAGCACCAAGAGAAAGG - Intronic
1063218499 10:3944841-3944863 TCCAAGCAGCAGGATAAGAAGGG + Intergenic
1063841526 10:10077065-10077087 CTTTATCAGCAGCATGAGAACGG + Intergenic
1064783352 10:18866936-18866958 TTTTATTAGCAGCATGAGAATGG + Intergenic
1064941607 10:20741585-20741607 TTTCATTAGCAGCATGAGAATGG + Intergenic
1065205084 10:23349416-23349438 TTGAAGCTGCAGGATGATAAAGG - Intergenic
1066332811 10:34443391-34443413 ATTTATCAGCAGCATGAGAACGG - Intronic
1068747640 10:60553068-60553090 CTTTATCAGCAGCATGAGAATGG + Intronic
1069127989 10:64661865-64661887 CTTTAGCAGCAGCATGAAAATGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070377975 10:75852844-75852866 TAGCATGAGCAGCATGAGAACGG - Intronic
1070905978 10:80073502-80073524 TTGAAACAGTATAATGAGAATGG - Intergenic
1071737402 10:88317427-88317449 TTGAAAGAGCAGCTTTAGAAAGG + Intronic
1073308182 10:102519641-102519663 CAGAAGCAGCAGCATGACCATGG - Intronic
1073734315 10:106327977-106327999 TTTTATCAGCAGCATGAAAACGG - Intergenic
1074500661 10:114020978-114021000 CTTTATCAGCAGCATGAGAACGG + Intergenic
1075536758 10:123278027-123278049 CTTTATCAGCAGCATGAGAATGG - Intergenic
1075604947 10:123798000-123798022 TGGGAGCATCTGCATGAGAATGG - Exonic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1078006353 11:7535320-7535342 TTGAGGAAACAGCATGACAAAGG + Intronic
1078517798 11:12039612-12039634 CTTTATCAGCAGCATGAGAATGG - Intergenic
1078851138 11:15165017-15165039 CTGTATCAGCAGCATGAAAATGG + Intronic
1079301046 11:19279087-19279109 TTTTATCAGCAGCATGAAAATGG + Intergenic
1079340094 11:19604628-19604650 TTGTAGCAGCCTCATGAGATGGG + Intronic
1080404516 11:31967020-31967042 TTGAAGCCACAGCATGGGAGTGG - Intronic
1080796606 11:35569643-35569665 TTTTATCAGCAGCATGAAAACGG - Intergenic
1080929931 11:36799395-36799417 ATGAAGCATCAGGATCAGAATGG - Intergenic
1080958681 11:37131430-37131452 TTTTATCAGCAGCATGAAAATGG + Intergenic
1081414994 11:42803783-42803805 TGAAAGCAGCAGCATCAGATGGG - Intergenic
1081444736 11:43119623-43119645 CTGAAGCAGCAGCATCAAGAAGG + Intergenic
1083749414 11:64753182-64753204 TTGAAGCTGCAGGATGAGGTTGG + Exonic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085866660 11:80302915-80302937 CTTTATCAGCAGCATGAGAATGG + Intergenic
1085941669 11:81213068-81213090 TTTATCCAGCAGCATGAAAATGG - Intergenic
1086202216 11:84217543-84217565 TTGTATCAGCATCATGAAAATGG + Intronic
1086555430 11:88104913-88104935 TCCCAGAAGCAGCATGAGAAGGG - Intergenic
1086750613 11:90489405-90489427 CTTTAGCAGCAGCATGAAAATGG + Intergenic
1086759950 11:90616208-90616230 ATGAAGAAGCAGCATGAACATGG - Intergenic
1087571212 11:99929439-99929461 TTGTCACAGCAGCATGAGAATGG - Intronic
1088778893 11:113114440-113114462 TTTAAGCAGCAGGAAAAGAAAGG + Intronic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1090332338 11:125941853-125941875 TTGGAGCAGCAGCATGTGAAAGG - Intergenic
1090341986 11:126032130-126032152 TTAAAGCAGTTACATGAGAAAGG + Intronic
1090537203 11:127656270-127656292 TTGAAGCAACTGTATCAGAAAGG - Intergenic
1091104984 11:132910165-132910187 TTAAAGCAGCCGCAGGACAAAGG + Intronic
1093757366 12:22867451-22867473 ATGAGGCAGGAGCATGGGAATGG - Intergenic
1093928239 12:24929975-24929997 TGGAAACAGCAGCTGGAGAATGG - Intronic
1095424369 12:42059788-42059810 TTGAATCAGTAGAATGAGTAAGG + Intergenic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1098498544 12:71165065-71165087 TGGCTGCAGCAGCATGAGTAAGG - Intronic
1098986725 12:77020279-77020301 ATTTATCAGCAGCATGAGAATGG - Intergenic
1099846003 12:88030113-88030135 TTTTATCAGCAGCATGAAAACGG - Intronic
1099944077 12:89224341-89224363 TTGAATCAGTAGGCTGAGAAAGG + Intergenic
1101411607 12:104473389-104473411 TGGAAGCAGTGGCAGGAGAAAGG + Intronic
1102188794 12:110970306-110970328 AAGAAGCAGCAGCTTCAGAAGGG + Intergenic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1102737023 12:115171180-115171202 TTTAAGCAGCAGCAGAAGACAGG + Intergenic
1104528832 12:129549648-129549670 CTTTATCAGCAGCATGAGAATGG + Intronic
1104542064 12:129675130-129675152 TAGAAGCAGCAGCAAGAAAAGGG + Intronic
1106147410 13:27062229-27062251 TTGAAATAGCAACATGATAAAGG + Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1107667960 13:42712434-42712456 TTTTATCAGCAGCATGAAAATGG - Intergenic
1108110585 13:47067462-47067484 AGGCAACAGCAGCATGAGAATGG + Intergenic
1108440856 13:50451450-50451472 GTGAAGCAGCAGCAAGCCAAGGG + Intronic
1108745514 13:53389417-53389439 CTTTATCAGCAGCATGAGAATGG - Intergenic
1109448131 13:62471953-62471975 CTTTATCAGCAGCATGAGAATGG - Intergenic
1109697232 13:65977014-65977036 TTTTATCAGCAGCATGAAAATGG + Intergenic
1109727860 13:66368683-66368705 TTTTATCAGCAGCATGAAAATGG - Intronic
1110065270 13:71096693-71096715 TTGAAGCAGGAACAAGAAAAGGG - Intergenic
1110184617 13:72658074-72658096 TTTTATCAGCAGCATGAAAATGG - Intergenic
1110741651 13:79004657-79004679 TTGATGCAGCTGGATGAGAGTGG + Intergenic
1111074398 13:83214690-83214712 CTTTATCAGCAGCATGAGAATGG - Intergenic
1111477489 13:88771515-88771537 TTGAAGTAGAAGGAAGAGAAGGG - Intergenic
1112232018 13:97598152-97598174 TTAAAGCATCTGCATCAGAAAGG + Intergenic
1112359764 13:98706780-98706802 CTTTATCAGCAGCATGAGAATGG + Intronic
1112391279 13:98986636-98986658 TCTAGGCAGCAGGATGAGAAAGG - Intronic
1112694771 13:101935712-101935734 TTTTCACAGCAGCATGAGAACGG + Intronic
1113068459 13:106394736-106394758 TTTTATCAGCAGCATGAAAAGGG - Intergenic
1113395717 13:109945649-109945671 TTTTATTAGCAGCATGAGAATGG + Intergenic
1114390401 14:22302110-22302132 TTTTATCAGCAGCATGAAAAGGG - Intergenic
1114713446 14:24801657-24801679 TGGAAGCAGCAGGAGGAGAAGGG + Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1115514812 14:34174723-34174745 TTGATGCAGGGGCTTGAGAAAGG + Intronic
1115753259 14:36510729-36510751 TTAGAGCAGCAGCATTAGGAGGG + Intronic
1116120416 14:40716576-40716598 TTTATGAAGCAGCATGAAAATGG + Intergenic
1116813462 14:49561852-49561874 TTTTATCAGCAGCATGAAAATGG + Intergenic
1116897950 14:50335449-50335471 TTTAAACAGCAGGCTGAGAAGGG - Intronic
1117639134 14:57778287-57778309 CTTTATCAGCAGCATGAGAATGG + Intronic
1117682182 14:58215392-58215414 TTGAAGCAGTACCATCAGAGTGG - Intronic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118019678 14:61697172-61697194 TTGAAGAAGGACCAGGAGAAGGG - Intronic
1118186561 14:63543191-63543213 CTGCAGCGGCAGCAAGAGAAGGG + Exonic
1118228743 14:63928008-63928030 CTTTATCAGCAGCATGAGAATGG + Intronic
1118249657 14:64147263-64147285 TGGAAGCAGCTGCATGAGACAGG - Intronic
1119102814 14:71895944-71895966 TAGAAGCACCAGCAGGAGACTGG - Intergenic
1119142856 14:72283682-72283704 CTTTATCAGCAGCATGAGAATGG + Intronic
1119220162 14:72900144-72900166 TTCCAGCAGCAGCATGACCATGG + Intergenic
1120104777 14:80481133-80481155 CTTTAGCAGCAGCATGAAAATGG - Intronic
1121510893 14:94512582-94512604 TTGATGCTGGAGGATGAGAATGG - Intronic
1121513029 14:94527138-94527160 TTTTATCAGCAGCATGAAAATGG + Intergenic
1121885544 14:97539458-97539480 TTTATACAGCAGCATGAGAATGG + Intergenic
1124357445 15:29006488-29006510 CTGTATTAGCAGCATGAGAATGG - Intronic
1125085829 15:35728172-35728194 GTGAAGCTGCAGCATGATCAGGG - Intergenic
1126356680 15:47803397-47803419 TTGAATCAGCAACATGACACAGG - Intergenic
1126625293 15:50680462-50680484 GGGAAGCTGCAGCAGGAGAATGG + Intronic
1126628555 15:50710135-50710157 TTGAAGCAGCCTCAGCAGAATGG + Intronic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127188715 15:56507093-56507115 AGGAAGCTGCAGTATGAGAAGGG - Intergenic
1127282445 15:57503614-57503636 CTTAATCAGCAGCATGAAAATGG - Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128535688 15:68488554-68488576 CTTTATCAGCAGCATGAGAACGG - Intergenic
1128884709 15:71275967-71275989 TTCTATCAGCAGCATGAGAACGG + Intronic
1130266141 15:82405474-82405496 GTGAAGCGGCAGGATGGGAAAGG + Intergenic
1130505868 15:84541400-84541422 GTGAAGCGGCAGGATGGGAAAGG - Intergenic
1130635520 15:85616050-85616072 ATAAAGTAGCAGCATGTGAATGG - Intronic
1130782605 15:87059030-87059052 CTTAATCAGCAGCATGAAAAGGG - Intergenic
1130995455 15:88901365-88901387 TGGAAGCAGGATCAAGAGAAGGG + Intronic
1131305976 15:91243530-91243552 TGGAAGCAGCTGCAATAGAAAGG - Intronic
1131401544 15:92129271-92129293 TTGACAGAGTAGCATGAGAAAGG - Intronic
1131984053 15:98023499-98023521 CTTAATTAGCAGCATGAGAATGG + Intergenic
1132032520 15:98450322-98450344 TAGAAGGAGCAGCATGAGCCAGG + Intronic
1134870804 16:17650772-17650794 ATGGAACACCAGCATGAGAAAGG + Intergenic
1135037714 16:19091901-19091923 ATGTATTAGCAGCATGAGAACGG + Intergenic
1135326248 16:21527514-21527536 TGGAAGCAGCAGCCAGAGGAAGG - Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136679390 16:31947390-31947412 TTTAAAAAGCAGCAAGAGAAAGG + Intergenic
1136854072 16:33639220-33639242 TTTGAGCAGCAGGGTGAGAAAGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137373052 16:47926624-47926646 TAGTAGCAGAAACATGAGAAGGG + Intergenic
1138136646 16:54529187-54529209 TTGAGTCATCAGCATCAGAAAGG - Intergenic
1138220677 16:55247799-55247821 CTTTATCAGCAGCATGAGAATGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138504598 16:57471762-57471784 TGGAAGCAGCCGCAGGAGCAAGG + Exonic
1138962558 16:62044977-62044999 TTTTATTAGCAGCATGAGAATGG + Intergenic
1141214388 16:82010156-82010178 TTTTATTAGCAGCATGAGAATGG + Intronic
1141442065 16:84035563-84035585 TTGCAACACCAGCCTGAGAATGG - Intronic
1141743592 16:85910941-85910963 CTGAGGAAGCGGCATGAGAAGGG + Intronic
1142039295 16:87882241-87882263 TGGAAGCAGCAGCCAGAGGAAGG - Exonic
1142103412 16:88288077-88288099 TTGGAGCAGCAGGAGGAAAAAGG - Intergenic
1203115649 16_KI270728v1_random:1487659-1487681 TTTGAGCAGCAGGGTGAGAAAGG + Intergenic
1144065761 17:11622764-11622786 AAGCAGCAGCAGCCTGAGAAAGG - Intronic
1146720688 17:35121438-35121460 GTGAAGCAGCATCATGAGAGGGG - Exonic
1147116474 17:38304033-38304055 TTCTAGCAGCTGCCTGAGAAAGG + Intronic
1148413208 17:47485582-47485604 TTCTAGCAGCTGCCTGAGAAAGG - Intergenic
1148623097 17:49049388-49049410 GTTAAGCAGCAGCATCAGAAGGG + Exonic
1149455154 17:56781855-56781877 TGACAGCAACAGCATGAGAAGGG - Intergenic
1149530584 17:57391768-57391790 CTAAAGCCCCAGCATGAGAAAGG - Intronic
1149653292 17:58292491-58292513 TAGTGGCAGCAGCAGGAGAAGGG + Intergenic
1150162095 17:62907137-62907159 TAGAAGGAACAGCAGGAGAAAGG + Intergenic
1150971365 17:70031940-70031962 CTGTATCAGCAGCATGAAAACGG - Intergenic
1151195071 17:72425509-72425531 CTGTATCAGCAGCATGAAAATGG + Intergenic
1152509038 17:80772608-80772630 GTGAAGCTGCCGCAGGAGAATGG - Intronic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1155317677 18:24588861-24588883 TAGAAGCAAGAGCAAGAGAAGGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155521766 18:26675357-26675379 TTTTATTAGCAGCATGAGAACGG + Intergenic
1155681632 18:28493707-28493729 TTGAAGCAGCATCATGTAGAAGG - Intergenic
1155998275 18:32356103-32356125 TTTAAGGAGCAAAATGAGAAAGG + Intronic
1156181183 18:34606753-34606775 TTGAAGGACTAGCATGAGCAAGG + Intronic
1156265736 18:35487311-35487333 CTGTATCAGCAGCATGAAAATGG - Intronic
1156277494 18:35597548-35597570 TTAAAGGAGCAGCATGTAAAGGG - Intronic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1156749677 18:40436361-40436383 TTTAATCAGCAGTATGAAAACGG + Intergenic
1156825412 18:41424940-41424962 CTTTACCAGCAGCATGAGAACGG + Intergenic
1157220272 18:45824609-45824631 TTGAAGGAGTCCCATGAGAAGGG + Intergenic
1158038080 18:53058925-53058947 ATTTATCAGCAGCATGAGAATGG - Intronic
1158300257 18:56044039-56044061 TTGTAGCAGGAGGATGGGAATGG - Intergenic
1158396144 18:57079602-57079624 ATGTACCAGGAGCATGAGAATGG - Intergenic
1158414481 18:57237497-57237519 TTCTTACAGCAGCATGAGAATGG - Intergenic
1159368443 18:67500764-67500786 TTGAACCAGCAGCATGTCAGGGG + Intergenic
1159702490 18:71646423-71646445 TGGAAGCAGCATGAGGAGAAAGG - Intergenic
1160454331 18:78988367-78988389 TTTAATCATCATCATGAGAAGGG + Intronic
1160462033 18:79046667-79046689 CTGGAGCGACAGCATGAGAAGGG + Intergenic
1161010175 19:1956069-1956091 TGGAGGCAGGAGGATGAGAAAGG - Intronic
1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG + Intronic
1164838967 19:31378103-31378125 TTTTATCAGCAGCATGAAAATGG + Intergenic
1164900781 19:31920260-31920282 GTTTAGTAGCAGCATGAGAATGG + Intergenic
1165975660 19:39674222-39674244 TTTAAATAGCAGCATGAGCATGG - Intergenic
1166410208 19:42551638-42551660 CTTTAGCAGCAGCATGAAAATGG + Intronic
1168579425 19:57541638-57541660 TTAAAGATGAAGCATGAGAACGG - Intronic
925434786 2:3827344-3827366 TGGAAGCAGCAGCCTGGGACCGG + Intronic
925746367 2:7047324-7047346 CTTAATCAGCAGCATGAAAATGG - Intronic
925787581 2:7448069-7448091 TGGAGGCAGAAGCAGGAGAATGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926434708 2:12826092-12826114 TTGGAGTAGCAGCATGAACAAGG - Intergenic
927669272 2:25055137-25055159 TTGAACCAGCTGCATGACATTGG - Intronic
927912870 2:26914088-26914110 TTTCAGCAGCAGCATCAGACCGG + Intronic
927936912 2:27081262-27081284 TTCAAACAGCTGCAGGAGAAAGG + Intronic
928327547 2:30331842-30331864 CTTTATCAGCAGCATGAGAATGG + Intergenic
928582663 2:32724819-32724841 CTGTATCAGCAGCATGAAAATGG - Intronic
929739314 2:44586920-44586942 TGCCAGCAGCAGCATGGGAAAGG + Intronic
930189796 2:48445709-48445731 TGGGAGCAGGAGCAGGAGAAAGG + Intronic
930507627 2:52304473-52304495 TTTTATTAGCAGCATGAGAATGG + Intergenic
930525156 2:52519536-52519558 CTGTATTAGCAGCATGAGAATGG + Intergenic
930801835 2:55450819-55450841 TTAAAGCAGCAGCAGAAGAAGGG - Intergenic
930802331 2:55455921-55455943 TTAAAGCAGCAGCAGAAGAAGGG - Intergenic
930906503 2:56574737-56574759 TGAAAGCAGAAGCATGAGAAAGG - Intergenic
931590532 2:63878245-63878267 TTGAAGCAGAATTATGAGAGTGG + Intronic
932287486 2:70549074-70549096 TTGAAACGGCAGCAAGACAACGG + Intronic
932688175 2:73891295-73891317 GTGCAGCAGCAGCATGATATGGG - Intergenic
932825626 2:74936495-74936517 TAAAAACAGGAGCATGAGAATGG - Intergenic
932904236 2:75732834-75732856 TTTTATCAGCAGCATGAAAACGG - Intergenic
932984584 2:76709781-76709803 TTTTATCAGCAGCATGAAAAGGG - Intergenic
933267230 2:80194264-80194286 CTGAAGCATCAGCATGTGCAGGG - Intronic
934053275 2:88228091-88228113 GTGAAGCCTCAGCATCAGAAAGG + Intergenic
935536864 2:104304959-104304981 TTGAAGAAAAGGCATGAGAAGGG - Intergenic
935711858 2:105906091-105906113 GAGAAGGAGCAGCATGAGAAAGG - Intergenic
935860008 2:107319400-107319422 TAGCAGCAGCAGGAAGAGAAAGG - Intergenic
936997019 2:118426256-118426278 GTGAAGCAGCAAGATGAGATTGG - Intergenic
937176927 2:119947281-119947303 ATGAACCAGCAGCCTGAGAGAGG + Intronic
937530262 2:122819459-122819481 TTGGAGCAGAAGCATGACATGGG + Intergenic
937878931 2:126850633-126850655 GTGATGCAGAATCATGAGAACGG - Intergenic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938084947 2:128393426-128393448 CTTTAGCAGCAGCATGAAAATGG + Intergenic
938594745 2:132776590-132776612 ATGAAGAAGCAGCAAGAAAATGG + Intronic
939232134 2:139442130-139442152 TTTAAGTAACAGGATGAGAAAGG - Intergenic
939423268 2:142001203-142001225 CTTTATCAGCAGCATGAGAATGG + Intronic
940440290 2:153707204-153707226 TTTTATCAGCAGCATGAAAACGG + Intergenic
940561769 2:155305786-155305808 CTGTATTAGCAGCATGAGAATGG + Intergenic
940662950 2:156570208-156570230 TTGAAGCAGAGGTATGTGAATGG + Exonic
941057485 2:160805816-160805838 TCGTATCAGCAGCATGAAAATGG - Intergenic
941733818 2:168949807-168949829 TTGAATCAGCAGTATGGGGAAGG + Intronic
942724870 2:178995160-178995182 CTTAATCAGCAGCATGAAAATGG - Intronic
942799907 2:179862519-179862541 TTGAGGTACCAGCGTGAGAAAGG + Intergenic
942998166 2:182290697-182290719 TCTAAGCAGAAGAATGAGAAAGG - Intronic
943123992 2:183773335-183773357 CTTTATCAGCAGCATGAGAACGG + Intergenic
943458252 2:188135559-188135581 TTAATGCAGCAGCAAGAGGAGGG - Intergenic
943869250 2:192972969-192972991 TAGAAGAAACACCATGAGAAAGG - Intergenic
944286245 2:197952958-197952980 TTTTATCAGCAGCATGAAAACGG + Intronic
944781787 2:203026022-203026044 TAGAAGCAGAAGAATTAGAAGGG - Intronic
946134669 2:217636024-217636046 TAGATGCAGCAGCATAATAATGG - Intronic
946437467 2:219667098-219667120 GTTAAGCAACATCATGAGAAAGG + Intergenic
946543518 2:220711672-220711694 CTTCAGCAGCAGCATGAAAATGG + Intergenic
946632237 2:221682943-221682965 TTTCATCAGCAGCATGAAAATGG - Intergenic
946884235 2:224206996-224207018 TCTTTGCAGCAGCATGAGAACGG + Intergenic
946974540 2:225133807-225133829 CTTTATCAGCAGCATGAGAATGG - Intergenic
947081376 2:226400822-226400844 TTTTCCCAGCAGCATGAGAATGG - Intergenic
947248723 2:228078156-228078178 CTGTATCAGCAGCATGAAAATGG + Intronic
947876174 2:233469582-233469604 AGGAAGTAGCACCATGAGAAGGG - Exonic
948358129 2:237396974-237396996 TTGAACCAGCAGCAAAAGGATGG + Intronic
948365195 2:237450221-237450243 TTGAGGCACCAGCAAGGGAAAGG + Intergenic
1169777761 20:9275087-9275109 TTTTATCAGCAGCATGAAAACGG - Intronic
1170077287 20:12433530-12433552 TTTAAGCAGCAACATTTGAAGGG + Intergenic
1170395202 20:15918706-15918728 TTACAGCAACAGCTTGAGAAAGG - Intronic
1170711018 20:18791097-18791119 TTGCAGCAGAGGCAGGAGAAGGG + Intergenic
1170875394 20:20245250-20245272 GTTTATCAGCAGCATGAGAATGG - Intronic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1173073055 20:39788078-39788100 TAGAAGCTGTAGCATGAAAATGG - Intergenic
1173529461 20:43757805-43757827 TTTTATCAGCAGCATGAAAATGG - Intergenic
1173818990 20:46008752-46008774 TGGCAGCACCAGCATGAGAAAGG - Intergenic
1173876743 20:46377356-46377378 TTTTAGTAGCAGCATGAAAAAGG - Intronic
1174543278 20:51306451-51306473 TTGAAGCAGGAGCATGGGGCTGG + Intergenic
1175501060 20:59451160-59451182 TAGAAGCAGCAGCAGCAGCAAGG - Intergenic
1176976708 21:15329097-15329119 TTGAAGCAGCACACTGACAAAGG + Intergenic
1178161147 21:29916401-29916423 AAGAAGCAGCAGCATTAGTAAGG + Intronic
1178341049 21:31785499-31785521 CTTAATTAGCAGCATGAGAATGG - Intergenic
1178745956 21:35250562-35250584 CTTTATCAGCAGCATGAGAATGG + Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179310342 21:40189871-40189893 CTGTATCAGCAGCATGAAAACGG + Intronic
1179382715 21:40914397-40914419 CTTTAGTAGCAGCATGAGAATGG - Intergenic
1182985470 22:34712262-34712284 TTGGGGGAGCATCATGAGAAAGG - Intergenic
1184441817 22:44521577-44521599 TTGAAGCTGCCGGCTGAGAAAGG - Intergenic
1184953910 22:47867810-47867832 TTAGAGCAGCAGCAAGAAAATGG - Intergenic
949607036 3:5664547-5664569 TGGGAGCAGGAGCAAGAGAAGGG + Intergenic
951446663 3:22789377-22789399 CTTAACTAGCAGCATGAGAATGG + Intergenic
951710505 3:25581508-25581530 TAGAAGCAGTAGCGTGAGCAGGG + Intronic
951952203 3:28212349-28212371 TTTTATCAGCAGCATGAAAATGG + Intergenic
952541175 3:34369844-34369866 TTTTATCAGCAGCATGAAAATGG + Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
953170142 3:40499802-40499824 GAGAAGCAGCAGCAAGAGCATGG - Intergenic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
953632693 3:44632254-44632276 TTGAAGCACAAGGATGAGAGAGG - Intronic
954304058 3:49716342-49716364 TTGAAGCAGGAGCATGTGGGTGG + Intronic
954644899 3:52125265-52125287 TGAAAGCAGCAGCAGGATAAAGG + Intronic
956123585 3:65990494-65990516 TTGAAGCATGTGCTTGAGAATGG - Intronic
958076836 3:88691130-88691152 CTTTATCAGCAGCATGAGAACGG - Intergenic
958163347 3:89847398-89847420 TGGAGGCTGAAGCATGAGAATGG - Intergenic
958174509 3:89979061-89979083 ATGAAGCAGCAGCATGACTTGGG + Intergenic
958602258 3:96311616-96311638 TTATAACAGCAGCATCAGAAGGG - Intergenic
959171874 3:102854096-102854118 CTTAATCAGCAGCATGAAAATGG - Intergenic
959906317 3:111714595-111714617 TTGAAGCTACAGCATGGGCATGG - Intronic
960666403 3:120113082-120113104 TTGAAACAGCCTTATGAGAAAGG + Intergenic
961013999 3:123453607-123453629 TTCCACCAGCAGCATGAAAAGGG - Intergenic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961479741 3:127172070-127172092 ATGAAGCAGGACCATGAGAAAGG + Intergenic
962173974 3:133133152-133133174 TTGATGCAGCAGCAGCAGCAGGG + Intronic
962689628 3:137881034-137881056 TTCAAGCACAAGCATAAGAAAGG + Intergenic
964395572 3:156242250-156242272 CAGAAGCACCAGCAAGAGAATGG - Intronic
964836039 3:160939762-160939784 TTTTATCAGCAGCATGAAAATGG + Intronic
964951226 3:162296036-162296058 CTGAAAGAGCAGCATGAGAAAGG + Intergenic
965454399 3:168879912-168879934 TGGAAGCTGAAGCAGGAGAATGG - Intergenic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966252277 3:177879425-177879447 TTGAAGCTGTAACAAGAGAAAGG - Intergenic
967563596 3:190946944-190946966 TTGAAGCAGAAGCCTGAGCTCGG - Intergenic
968292052 3:197546639-197546661 GTGAAGCTGCAGCTTGAGAGAGG - Intronic
969255536 4:5999262-5999284 TGGAAGCAGCAGTATCTGAAAGG - Intergenic
969867786 4:10086733-10086755 TTAAAGCAGGAGCCCGAGAAGGG + Intronic
969964843 4:10983505-10983527 CTGACGCTGCAGGATGAGAAAGG + Intergenic
970457687 4:16241153-16241175 TTTTATCAGCAGCATGAAAACGG + Intergenic
970560708 4:17279571-17279593 CTTTATCAGCAGCATGAGAATGG - Intergenic
971017279 4:22501330-22501352 TTGAAGGAGAACAATGAGAAAGG + Intronic
971053018 4:22882338-22882360 TTTTATCAGCAGCATGAAAATGG + Intergenic
971484690 4:27147293-27147315 CTTTATCAGCAGCATGAGAATGG - Intergenic
971945189 4:33266146-33266168 TGGAAGCAGGAGCAAGAGAGAGG - Intergenic
972084144 4:35192574-35192596 TTTTATCAGCAGCATGAGAATGG - Intergenic
972109068 4:35532237-35532259 TTTTATCAGCAGCATGAAAATGG + Intergenic
972749544 4:41974302-41974324 TTTTATCAGCAGCATGAAAATGG + Intergenic
972783921 4:42309982-42310004 TAGAAGCAGCTGCAAGATAATGG + Intergenic
974413189 4:61568481-61568503 TTGAAGCAGTAGAAGAAGAAAGG + Intronic
974445593 4:61976838-61976860 CTTTATCAGCAGCATGAGAATGG + Intronic
974671755 4:65039172-65039194 TTGCACCAGCTGCATGAGGATGG + Intergenic
975082404 4:70296897-70296919 GTGAGGCAGAGGCATGAGAATGG - Intergenic
975619004 4:76276777-76276799 CTGAGGCAGAAGCATGACAAGGG + Intronic
975937595 4:79600476-79600498 GTGAAGCAGCAGGATCAGAATGG - Intergenic
976339919 4:83935437-83935459 TTGAATCAGCAGAAGGACAAAGG - Intergenic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976932763 4:90588925-90588947 CTTTATCAGCAGCATGAGAATGG + Intronic
977023363 4:91785653-91785675 TTGAAGCAGAAGGGTGGGAAAGG - Intergenic
977028314 4:91849183-91849205 AAGAAGCACCAGCATGGGAATGG - Intergenic
977650972 4:99469154-99469176 ATTTATCAGCAGCATGAGAATGG - Intergenic
978828465 4:113053221-113053243 TTCAAGCTGGAGAATGAGAAAGG - Intronic
979149373 4:117290066-117290088 TTGAAGCTGCAGAAAGTGAAAGG - Intergenic
979350034 4:119632745-119632767 GTGAAGAGGCAGCAAGAGAATGG + Intergenic
979383880 4:120041213-120041235 TTGAACCTGTAGCAGGAGAAAGG + Intergenic
979511362 4:121557414-121557436 TTTTATTAGCAGCATGAGAATGG + Intergenic
979629312 4:122881831-122881853 TTTTATCAGCAGCATGAAAATGG - Intronic
979895986 4:126157519-126157541 TTTTATTAGCAGCATGAGAATGG - Intergenic
980071354 4:128245623-128245645 CTTAATCAGCAGCATGAAAATGG + Intergenic
980386230 4:132090266-132090288 TTGTATTGGCAGCATGAGAAGGG + Intergenic
980509991 4:133772663-133772685 CTTTAGCAGCAGCATGAAAATGG - Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
981330256 4:143500002-143500024 TTCAAGCACCAGAATGAGAAGGG - Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982329321 4:154163877-154163899 GTGTAGCAGCAGCGTGGGAAAGG - Intergenic
982793202 4:159616183-159616205 TAGTAGCAACAGAATGAGAAGGG - Intergenic
984415881 4:179458264-179458286 TTTTATCAGCAGCATGAAAACGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984765983 4:183400822-183400844 TGGAGGCAGCAGCCAGAGAAGGG - Intergenic
984841409 4:184071358-184071380 CTTTATCAGCAGCATGAGAATGG - Intergenic
985110139 4:186539924-186539946 CTTTATCAGCAGCATGAGAATGG - Intronic
985145056 4:186887920-186887942 CTTAGGAAGCAGCATGAGAAGGG + Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986652536 5:9978940-9978962 TGGTAGCAGAAGGATGAGAATGG - Intergenic
986948667 5:13055515-13055537 TTTAAGCAGCAGCAAGTGAATGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987680665 5:21132652-21132674 CTTTATCAGCAGCATGAGAATGG + Intergenic
987759828 5:22147539-22147561 CTTAATCAGCAGCATGAAAATGG - Intronic
988061348 5:26174768-26174790 TTTTATCAGCAGCATGAAAATGG + Intergenic
988815865 5:34834558-34834580 TTTTATCAGCAGCATGAAAACGG - Intergenic
988834975 5:35023242-35023264 CTTTATCAGCAGCATGAGAAAGG + Intronic
989681055 5:44030779-44030801 TTTTATCAGCAGCATGAAAAAGG - Intergenic
989807978 5:45635475-45635497 TTGAAGCAGCTGCAAAATAAAGG - Intronic
990035540 5:51313598-51313620 TTCAAGCAGCACCATGAACATGG - Intergenic
990122357 5:52470895-52470917 TTTTATCAGCAGCATGAAAATGG - Intergenic
990146265 5:52763732-52763754 CTTAATCAGCAGCATGAAAATGG + Intergenic
990480362 5:56204698-56204720 TTTTTGTAGCAGCATGAGAATGG + Intronic
991104762 5:62831886-62831908 TTTTATCAGCAGCATGAAAATGG - Intergenic
991894560 5:71380967-71380989 CTTAATCAGCAGCATGAAAATGG - Intergenic
992122692 5:73610928-73610950 CTGTATCAGCAGCATGAAAACGG - Intergenic
993873726 5:93281616-93281638 TAGAAGCAGGAGCATGGGCAGGG + Intergenic
994764829 5:103902902-103902924 CTTTAGCAGCAGCATGAAAATGG - Intergenic
995017481 5:107327376-107327398 TTGGAGCTGCAGGCTGAGAAGGG + Intergenic
996214170 5:120847748-120847770 CTTAATCAGCAGCATGAAAATGG - Intergenic
996417125 5:123222573-123222595 TCTCAGCAGCAGCCTGAGAAGGG - Intergenic
996546082 5:124680068-124680090 TTAAAACAGCAGCATATGAATGG - Intronic
996903899 5:128575893-128575915 TTGTAGCAGGAGCAAGAGCAGGG - Intronic
998053196 5:139053490-139053512 TTGAAGCAGGAGAATGACATAGG - Intronic
1000016478 5:157282274-157282296 TGGAAGCAGGAGCAAGAGAGTGG + Intronic
1000431945 5:161162855-161162877 TTGATGATGCAGCATGAGATAGG - Intergenic
1001694827 5:173662137-173662159 CTTTATCAGCAGCATGAGAATGG - Intergenic
1002452830 5:179329220-179329242 TTGAGGCTGAAGCAGGAGAATGG + Intronic
1002961893 6:1923174-1923196 CTTTATCAGCAGCATGAGAACGG + Intronic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003204426 6:3994007-3994029 TTGAATCAAAAGGATGAGAAAGG + Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1004894262 6:20131592-20131614 TTTATTTAGCAGCATGAGAACGG + Intronic
1005384956 6:25277191-25277213 TTGCAGCAGTAGCAGTAGAAGGG + Intergenic
1006289056 6:33120394-33120416 TTTAAATAGCAGCATGAGCATGG + Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006638400 6:35475953-35475975 TTGAAGGAGCTCTATGAGAAGGG - Exonic
1008060964 6:46996564-46996586 GTTTATCAGCAGCATGAGAATGG + Intergenic
1008264423 6:49406865-49406887 TTAACACAGAAGCATGAGAACGG + Intergenic
1009344477 6:62596293-62596315 TTTTATCAGCAGCATGAAAATGG + Intergenic
1010003688 6:70972904-70972926 CTTTATCAGCAGCATGAGAATGG + Intergenic
1010301587 6:74266636-74266658 ATGAAACAAGAGCATGAGAAAGG + Intergenic
1010474374 6:76267935-76267957 CTGTATCAGCAGCATGAAAATGG + Intergenic
1011042948 6:83051272-83051294 TGGAGGCAGGAGCAGGAGAATGG - Intronic
1011744730 6:90398503-90398525 TAGAAGCAAGAGCATGAGAGAGG - Intergenic
1011919149 6:92548705-92548727 TTTTATCAGCAGCATGAAAATGG + Intergenic
1012070081 6:94603653-94603675 TTGTATCAGTAGCATGAAAATGG - Intergenic
1012121254 6:95369983-95370005 TTGAATCAGCAGACTGAGTAAGG + Intergenic
1013767627 6:113593308-113593330 TTTTATCAGCAGCATGAAAACGG - Intergenic
1014054642 6:116999676-116999698 TTAAGGCTGCAGCAGGAGAATGG - Intergenic
1014330826 6:120061412-120061434 CTGTATTAGCAGCATGAGAATGG - Intergenic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1014715645 6:124861863-124861885 CTGTATCAGCAGCATGAAAATGG - Intergenic
1015292987 6:131559664-131559686 CTGAGGCAGGAGAATGAGAATGG - Intergenic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1016168555 6:140978676-140978698 CTTTAGTAGCAGCATGAGAATGG - Intergenic
1016477443 6:144442464-144442486 TTTTATCAGCAGCATGAAAATGG - Intronic
1016682454 6:146846106-146846128 CTGTATTAGCAGCATGAGAATGG - Intergenic
1016728360 6:147401087-147401109 CTGAAGCAACAGCCTGAGCAGGG + Intergenic
1016779725 6:147944235-147944257 ATGTATCAGCAGCATGAAAAAGG - Intergenic
1017569177 6:155724875-155724897 TCCAGGCAGCAGCATAAGAAAGG + Intergenic
1018267802 6:162043768-162043790 AGGAAGCAGCAGGAAGAGAAAGG + Intronic
1018997736 6:168723091-168723113 TTTTATCAGCAGCATGAAAACGG + Intergenic
1019591475 7:1837661-1837683 TAGAAGCAGCCAGATGAGAAAGG + Intronic
1020405215 7:7825351-7825373 TTTTATCAGCAGCATGAAAATGG - Intronic
1020782553 7:12535188-12535210 CTTAATCAGCAGCATGAAAATGG - Intergenic
1021883038 7:25112229-25112251 TTTTATCAGCAGCATGAAAACGG + Intergenic
1022521004 7:31006816-31006838 TTGAATCAGCAGGTAGAGAAGGG - Intergenic
1022678554 7:32523048-32523070 ATGAATCAGCAGCATGAAAATGG + Intronic
1023726090 7:43143663-43143685 TTGAAGCAGCAGCTGCATAAGGG - Intronic
1024202119 7:47118300-47118322 TTGCAGGACCAGCAAGAGAATGG - Intergenic
1024363241 7:48491625-48491647 TTGATGCATCATCATGGGAAAGG + Intronic
1024771843 7:52732324-52732346 TTGTATTAGCAGCATGAGAATGG + Intergenic
1026051467 7:66950576-66950598 CTTTATCAGCAGCATGAGAAAGG + Intronic
1026257566 7:68725713-68725735 TGGAGGCCGAAGCATGAGAATGG + Intergenic
1026892491 7:73990432-73990454 TTTAAGCAGGAGAATGAGATGGG - Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027818198 7:83006494-83006516 ATGAAACAGCAGTATGAGAAAGG - Intronic
1028210339 7:88066741-88066763 CAGAAGCAGCAGCAAGAGAAAGG + Intronic
1028314636 7:89384762-89384784 TTTTATCAGCAGCATGAAAATGG + Intergenic
1028544166 7:91979166-91979188 CTGTATCAGCAGCATGAAAATGG - Intronic
1028817765 7:95167022-95167044 CTTCAGCAGCAGCATGAAAATGG - Intronic
1028866216 7:95716708-95716730 ATGAAGCACCAACATGACAACGG + Intergenic
1029009910 7:97248853-97248875 TGAAAGCAGCAGTATGAGGAAGG + Intergenic
1030342878 7:108400768-108400790 GCAAAGCAGCAGCGTGAGAATGG + Intronic
1030848106 7:114447479-114447501 TGGCTGCAGCAGCAAGAGAATGG - Intronic
1030909167 7:115225377-115225399 TTCAATCATCAGCATGAAAATGG + Intergenic
1030943677 7:115688812-115688834 TTGACAGAGCAGCATGTGAAAGG + Intergenic
1031379130 7:121063003-121063025 CTTCAGCAGCAGCATGAAAAAGG + Intronic
1031545597 7:123048778-123048800 TTTTATCAGCAGCATGAAAATGG - Intergenic
1031778349 7:125930758-125930780 CTTTATCAGCAGCATGAGAAAGG - Intergenic
1032352951 7:131182849-131182871 CTGACGCAGCAGCACAAGAAAGG + Intronic
1032482215 7:132256268-132256290 CTGAGGCAGCAGCAAGAAAACGG + Intronic
1032695804 7:134335141-134335163 TGAAAGCGGCAGCAAGAGAAGGG - Intergenic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1032703973 7:134406183-134406205 CTTTATCAGCAGCATGAGAATGG + Intergenic
1032961588 7:137041622-137041644 ATGAAGAAGCAGCAAGAAAATGG - Intergenic
1033031434 7:137831317-137831339 TTTTATCAGCAGCATGAAAACGG - Intronic
1033048407 7:137982727-137982749 CTTTATCAGCAGCATGAGAACGG + Intronic
1033091120 7:138387094-138387116 TTGAACAAGCAGAATGTGAATGG + Intergenic
1033918825 7:146362466-146362488 GTGAAGGAGCAGCCTGTGAATGG + Intronic
1034016748 7:147596020-147596042 TTGGAGCTGCAGCATGAAGACGG - Intronic
1034029231 7:147741873-147741895 CTTTATCAGCAGCATGAGAATGG - Intronic
1034252428 7:149703098-149703120 TAGAAGCAACAGCATGACAGAGG + Intergenic
1034633651 7:152550398-152550420 TTGAAGCAGAAGAATGTGAGAGG + Intergenic
1034681247 7:152929877-152929899 TTTTATCAGCAGCATGAAAATGG + Intergenic
1034758071 7:153641751-153641773 TTAATGCAGCAGCCTGAGAGAGG + Intergenic
1035061041 7:156069872-156069894 TGAAAGCAAGAGCATGAGAAAGG - Intergenic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1036674552 8:10819114-10819136 TGGAAGCAGCAGGCTGGGAAAGG - Intronic
1037178527 8:15975059-15975081 CTTTATCAGCAGCATGAGAACGG + Intergenic
1038164075 8:25067825-25067847 TTGGAGCAGCAGCTTGAGCTGGG - Intergenic
1038899524 8:31826575-31826597 CTTAATTAGCAGCATGAGAATGG + Intronic
1038913490 8:31993693-31993715 CTTTATCAGCAGCATGAGAATGG + Intronic
1039029412 8:33293506-33293528 CTTTATCAGCAGCATGAGAATGG - Intergenic
1039156232 8:34561605-34561627 TTTCAGCAGCAGCATTTGAAAGG + Intergenic
1039287547 8:36058739-36058761 TTCAAGCAGCAGCAGTAGAGAGG - Intergenic
1040934315 8:52766993-52767015 ATGAGGCAGCATCCTGAGAAAGG + Intergenic
1041318337 8:56587621-56587643 TTGGAGAACCAACATGAGAAAGG + Intergenic
1041986413 8:63926140-63926162 TTAAATCAGCAGGCTGAGAAGGG + Intergenic
1042273352 8:66978073-66978095 TTTTATCAGCAGCATGAAAATGG - Intronic
1044252413 8:90019369-90019391 TTGAAGCAGCAGCAGTGGAATGG + Intronic
1045852082 8:106713960-106713982 ATCAAGCAGCAGCCAGAGAATGG + Exonic
1046159517 8:110342092-110342114 TTTAATCAGCAGCGTGAAAACGG - Intergenic
1046504418 8:115118580-115118602 TTGAATGAACAGTATGAGAAAGG + Intergenic
1046600687 8:116314242-116314264 CTTTATCAGCAGCATGAGAATGG - Intergenic
1046786330 8:118271103-118271125 ATCAATTAGCAGCATGAGAATGG - Intronic
1046902123 8:119535028-119535050 TTGATTCAGAAGCATGAGAGAGG - Intergenic
1047056831 8:121174319-121174341 TTGAGGTAGCAGCATGAGCCAGG - Intergenic
1047415134 8:124658478-124658500 TTTTATCAGCAGCATGAAAATGG + Intronic
1047809894 8:128396990-128397012 TTGAAGCAGCAGGATGTGAGAGG + Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047884568 8:129234905-129234927 TTGTAGAAACACCATGAGAAAGG + Intergenic
1048155851 8:131950234-131950256 CTGAAGTAGCAAAATGAGAATGG + Intronic
1048268032 8:133004812-133004834 TCCCAGCACCAGCATGAGAATGG + Intronic
1048478699 8:134768428-134768450 TTTTATCAGCAGCATGAAAATGG - Intergenic
1048508448 8:135041653-135041675 TTTTATCAGCAGCATGAAAACGG - Intergenic
1048896351 8:138995890-138995912 TTAAATCAGCAGAATGAGTAAGG - Intergenic
1048927168 8:139281452-139281474 TAGAAGCAGCAGCCAGAGAGAGG + Intergenic
1048984148 8:139723237-139723259 CTGACGAAGCAACATGAGAAAGG - Intergenic
1049101864 8:140585629-140585651 TTTAAGCAGCAGCAAGGGAGGGG - Intronic
1050214257 9:3304813-3304835 CTTTATCAGCAGCATGAGAACGG + Intronic
1051263809 9:15291511-15291533 CTTTATCAGCAGCATGAGAACGG + Intronic
1051483598 9:17585190-17585212 TTGAGGCAGCGGCGAGAGAAGGG + Intronic
1052129474 9:24824838-24824860 TTCAAGTAACAGCAAGAGAAAGG - Intergenic
1052351887 9:27466554-27466576 TTTTATCAGCAGCATGAAAATGG - Intronic
1052998685 9:34565464-34565486 CTCAGGCAGCAGCAGGAGAAGGG + Intronic
1053615852 9:39765437-39765459 TGGAGGCAGAAGCAAGAGAACGG - Intergenic
1053615905 9:39765849-39765871 TGGAGGCAGAAGCAAGAGAACGG - Intergenic
1053898543 9:42769426-42769448 TGGAGGCAGAAGCAAGAGAAAGG + Intergenic
1054237611 9:62576541-62576563 TGGAGGCAGAAGCAAGAGAACGG + Intergenic
1054237668 9:62576954-62576976 TGGAGGCAGAAGCAAGAGAACGG + Intergenic
1054551747 9:66611052-66611074 TGGAGGCAGAAGCAAGAGAACGG + Intergenic
1054551800 9:66611461-66611483 TGGAGGCAGAAGCAAGAGAACGG + Intergenic
1055006035 9:71507857-71507879 CTTTAACAGCAGCATGAGAATGG + Intergenic
1055251225 9:74308546-74308568 ATGAAGCAGCTGCATGCTAATGG + Intergenic
1055858607 9:80722616-80722638 ATGTATTAGCAGCATGAGAATGG - Intergenic
1056284098 9:85070498-85070520 CTTAATCAGCAGCATGAAAATGG + Intergenic
1057060422 9:91999143-91999165 TTGAATCAGCAACCTGAGTAAGG + Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1058598112 9:106637876-106637898 TTAAAGCAGTAGCATGAAATTGG + Intergenic
1058725269 9:107797322-107797344 CTTTATCAGCAGCATGAGAACGG - Intergenic
1058855768 9:109060629-109060651 TAGAAGCAAAAACATGAGAAAGG - Intronic
1059263520 9:113003409-113003431 TTTTATTAGCAGCATGAGAATGG + Intergenic
1059775753 9:117473708-117473730 TTGAGGCAGAAGTATCAGAAAGG + Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060179406 9:121522670-121522692 CTTTAGCAGCAGCATGAAAATGG + Intergenic
1060185506 9:121561810-121561832 GTAAAGGAGCAGCATGAGAGAGG - Intergenic
1060308786 9:122440536-122440558 TTTTATTAGCAGCATGAGAATGG - Intergenic
1060987387 9:127827598-127827620 ATGAAACAGCAGCAGCAGAAGGG + Intronic
1062052310 9:134453983-134454005 TGGGAGCAGCAGCATGGGAGCGG + Intergenic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1186024420 X:5293219-5293241 TTGAACTTGTAGCATGAGAAAGG + Intergenic
1186134654 X:6506190-6506212 TTTAGGCTGCAACATGAGAATGG - Intergenic
1186167306 X:6840327-6840349 CTTTATCAGCAGCATGAGAATGG + Intergenic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1186930904 X:14388923-14388945 TTATAGCAGCAGTATGAGGAAGG - Intergenic
1187778066 X:22786229-22786251 TTGAAGCAGGACAATGAGCATGG - Intergenic
1189945150 X:46170460-46170482 ATGTATCAGCAGCATGAAAACGG - Intergenic
1190114585 X:47618412-47618434 TTGAAGAAGTAGCTGGAGAACGG + Intronic
1190256276 X:48765102-48765124 CTGAAGCTGCAGAATGGGAAAGG + Intronic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193302853 X:79912560-79912582 TTTTATCAGCAGCATGAAAACGG + Intergenic
1193682883 X:84542761-84542783 TTGTAGTAGCAGGAAGAGAACGG + Intergenic
1194272489 X:91834460-91834482 TTCAAGGAACAGCTTGAGAAGGG - Intronic
1194437669 X:93888561-93888583 TTTTATCAGCAGCATGAAAATGG - Intergenic
1194697443 X:97071890-97071912 ATAAAGCAGCAGCATGATTATGG + Intronic
1194864543 X:99049539-99049561 TTGAAGCATGAGCAGGAGAAAGG + Intergenic
1195680455 X:107542163-107542185 CTGAGGCAGAAGCAAGAGAAAGG - Intronic
1195738009 X:108033424-108033446 TGGGTGCAGCAGCATGAGGAGGG - Intergenic
1197288490 X:124625698-124625720 TGGAAGCAGGAGCAAGAGAGAGG + Intronic
1197502410 X:127258181-127258203 TAGAGGCAGCAGCAAGAGACTGG - Intergenic
1198477010 X:137004899-137004921 CTGTATCAGCAGCGTGAGAATGG - Intergenic
1198734498 X:139771373-139771395 TTTTATCAGCAGCATGAAAACGG + Intronic
1199324595 X:146482702-146482724 CTTATACAGCAGCATGAGAATGG - Intergenic
1200589733 Y:5055888-5055910 TTCAAGGAACAGCTTGAGAAGGG - Intronic