ID: 1107626677

View in Genome Browser
Species Human (GRCh38)
Location 13:42293746-42293768
Sequence TAGGGTTTTGAAGATGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107626677_1107626684 23 Left 1107626677 13:42293746-42293768 CCCCCGGCATCTTCAAAACCCTA 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1107626684 13:42293792-42293814 ATTCAGTAAAGCAAACTTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107626677 Original CRISPR TAGGGTTTTGAAGATGCCGG GGG (reversed) Intronic
900755797 1:4433731-4433753 TTGGGATTAGAAGATGCAGGAGG + Intergenic
911931891 1:103915008-103915030 TATGGCTTTGAAGATGACTGAGG - Intergenic
913507838 1:119534438-119534460 TATGGTGGTGAAGATGTCGGTGG + Intergenic
917598988 1:176556840-176556862 CAGGGTTGTGAAAATGGCGGTGG - Exonic
922740104 1:228009746-228009768 TAGGCTTTTGAAGTTGGCAGAGG + Intronic
1069265959 10:66457878-66457900 ATGGGTTTTGAAGAGGCCTGAGG - Intronic
1071789646 10:88940499-88940521 TAGGTTTCTGAACATGCCTGAGG - Intronic
1072047070 10:91667468-91667490 CATGGTATTGAAGATGCCAGTGG + Intergenic
1086219127 11:84420488-84420510 TAGGCATTTGATGATGCTGGTGG - Intronic
1092628691 12:10355799-10355821 TAGGGTAATGAAGATGACAGAGG + Intergenic
1100737864 12:97557740-97557762 TAGAGTTTGGAAGATGGCTGTGG + Intergenic
1103038148 12:117673006-117673028 CAGGGTTTTGGAGATGACCGTGG - Intronic
1104112609 12:125717892-125717914 TAAGGTTTTGTAGATGTTGGGGG - Intergenic
1107305319 13:39012892-39012914 GAGGGATTTGAAGATGACAGAGG + Exonic
1107626677 13:42293746-42293768 TAGGGTTTTGAAGATGCCGGGGG - Intronic
1116018011 14:39430746-39430768 TAGGGTTTTGGAGGTGGCGATGG + Intronic
1121917204 14:97846209-97846231 TAGGGTATTGAAAATGGCAGTGG + Intergenic
1130826806 15:87557195-87557217 TAGGGCTTTGAAGAAGCTGCAGG + Intergenic
1130853674 15:87822057-87822079 TAGGGTTTTGACCATACTGGTGG + Intergenic
1133068775 16:3231416-3231438 TAGGTTTTAGAAGTTGCCTGGGG - Intronic
1135705525 16:24671410-24671432 TGGGGTGCTGAAGATGCTGGTGG + Intergenic
1136090603 16:27917111-27917133 GAGGATTTTAAAGAAGCCGGTGG + Intronic
1136535520 16:30896851-30896873 TAGGGTTTAGAGGAGGCCTGGGG + Intronic
1138145406 16:54604713-54604735 CAAGGTTTTGAAGGTGCCTGTGG - Intergenic
1138150234 16:54650136-54650158 TAGGGCTCTGAAGATGCCACGGG + Intergenic
1140256155 16:73338013-73338035 TAGGGTTTTGATGATCAAGGAGG - Intergenic
1145888856 17:28400693-28400715 GAGTGAGTTGAAGATGCCGGAGG + Exonic
1146489726 17:33271666-33271688 TAGGGTTTTGGTGATGGAGGTGG - Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148016061 17:44523427-44523449 TAGGGGTTTAAAGAAGCCGTTGG + Intergenic
1150883618 17:69059446-69059468 TACGGCTTTGAAGATGGAGGAGG + Intronic
1154386367 18:13895931-13895953 TAGGTTTTAGAAGATTCAGGGGG + Intronic
1156846945 18:41677047-41677069 TTGGATTTGGAAGATGCAGGGGG - Intergenic
1158829465 18:61261879-61261901 GAGTGTTTTGAAGATGCTTGAGG - Intergenic
1159101090 18:63960155-63960177 TAGGGTTTTACAGATTCCTGTGG + Exonic
1159122506 18:64187228-64187250 CAGGGTTTAGAAGCTGCCTGAGG - Intergenic
926985237 2:18615636-18615658 TAGGATATTGAAGATGAAGGAGG - Intergenic
928286785 2:29996967-29996989 GAGGTTTTTGAAGCTGCCTGTGG - Intergenic
935813563 2:106825020-106825042 TAGTGTTTTTGAGTTGCCGGAGG - Intronic
937901089 2:127019686-127019708 AAGTGTTTGGAAGATGGCGGGGG + Intergenic
945585108 2:211651676-211651698 CTGGGTTTTGAAGATGGTGGGGG + Intronic
945763310 2:213942358-213942380 TAGGGATTTGAATATGGAGGAGG - Intronic
1169039326 20:2480129-2480151 TAGGGTTTTGAAGAGGGAAGGGG - Intronic
1181591851 22:23890102-23890124 CAGGGTTGTGAGGATGGCGGTGG + Intronic
1182441759 22:30368722-30368744 TAGCTTTTTGCAGATGCAGGAGG - Intronic
954331898 3:49895650-49895672 TAGGGACTTGAAGATGCCATTGG + Intronic
957509990 3:81175290-81175312 AAGGATTTTGAAGACGCAGGTGG - Intergenic
958149059 3:89666710-89666732 GAGGGATTTGAAGAAGACGGGGG + Intergenic
961708215 3:128806466-128806488 TAGGGTTTTGAATGTGTTGGGGG - Exonic
964805440 3:160604886-160604908 TAGGATTTTGAAGACCCAGGGGG - Intergenic
966595816 3:181724012-181724034 TAGGGTCGTGAAGATGCTGCGGG + Intergenic
973573855 4:52266321-52266343 TAGGGGTTTGCAGCTGCTGGTGG - Intergenic
979779631 4:124634157-124634179 TAGGGTTTTGAAAATGTTTGTGG + Intergenic
982137429 4:152285089-152285111 GAGGGTTGTGAAGATGGCAGGGG + Intergenic
993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG + Exonic
996092095 5:119361435-119361457 TATGGTTTTGAAGATGGGGGAGG + Intronic
1003281368 6:4695166-4695188 TGGGCTTTTGAAGATGCTAGAGG - Intergenic
1007740654 6:44007677-44007699 CAGGGTTCTGAAGAGGGCGGTGG - Intergenic
1012802079 6:103843283-103843305 TGGGAATTTGAAGATGCCTGTGG - Intergenic
1015917301 6:138230252-138230274 CAGGGTTTTGAAGATGGGGAGGG - Intronic
1016915227 6:149238262-149238284 CAGACTTTTGAAGATGCCAGGGG - Intronic
1017816801 6:158022096-158022118 TAGGGTTCTGAACCTGCGGGTGG + Intronic
1026847711 7:73707030-73707052 TGGGTTCTTGAAGATGCCAGTGG + Intronic
1030869096 7:114733609-114733631 TAGGGATGTGAAGATGCAGTGGG + Intergenic
1035342735 7:158174559-158174581 TAGGGGTTTGATGATGCTGATGG - Intronic
1036731775 8:11271815-11271837 TTAGGTATTGAAGATGCGGGCGG + Intergenic
1039569641 8:38576504-38576526 TAGAGTTTTAAAGATGCCCCAGG + Intergenic
1040830922 8:51676183-51676205 AAGGGTTTAGAAGATGCAAGTGG - Intronic
1045258616 8:100551401-100551423 TATGGTCATGAAGATGCCAGTGG + Intronic
1046676489 8:117114531-117114553 TAGGGATTTAAAGCTGACGGGGG - Intronic
1048311351 8:133324705-133324727 CAGGGTTTGGAAGCTGTCGGGGG - Intergenic
1049417353 8:142501312-142501334 TGTGGTTTTGATGATGACGGTGG + Intronic
1054962508 9:70984437-70984459 AAGTGTTTGGAAGATGCCAGGGG - Intronic
1057852302 9:98575091-98575113 TAGGGTTTTGCAGATTTGGGGGG - Intronic
1061395422 9:130341136-130341158 TCGGGTTCTGAAGGTGCTGGTGG + Intronic
1062586145 9:137250913-137250935 TAGGGCTTGGTGGATGCCGGTGG + Intergenic
1190699563 X:52976985-52977007 TAGAGTTTTCACGATGCCTGTGG + Intronic
1195850354 X:109276053-109276075 CTGGGTTTTGAGGATGCCAGTGG - Intergenic
1199434813 X:147801706-147801728 TAGGGTTTTAAAAAAGCCGCAGG - Intergenic
1201237199 Y:11922917-11922939 TAGGGTCTTGTAGATGCCTCAGG + Intergenic