ID: 1107629168

View in Genome Browser
Species Human (GRCh38)
Location 13:42325947-42325969
Sequence GAGAATGTCAAATCTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107629168_1107629172 -10 Left 1107629168 13:42325947-42325969 CCAGCCACAGATTTGACATTCTC 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1107629172 13:42325960-42325982 TGACATTCTCCTCCAAAGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1107629168_1107629177 28 Left 1107629168 13:42325947-42325969 CCAGCCACAGATTTGACATTCTC 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1107629177 13:42325998-42326020 CATACTGCCATTTTATAACTAGG 0: 1
1: 0
2: 0
3: 17
4: 186
1107629168_1107629174 -6 Left 1107629168 13:42325947-42325969 CCAGCCACAGATTTGACATTCTC 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1107629174 13:42325964-42325986 ATTCTCCTCCAAAGGTGGGGAGG 0: 1
1: 0
2: 1
3: 12
4: 171
1107629168_1107629173 -9 Left 1107629168 13:42325947-42325969 CCAGCCACAGATTTGACATTCTC 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1107629173 13:42325961-42325983 GACATTCTCCTCCAAAGGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107629168 Original CRISPR GAGAATGTCAAATCTGTGGC TGG (reversed) Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
907182931 1:52586715-52586737 AAGAATGTCTATCCTGTGGCCGG - Intergenic
908257971 1:62318406-62318428 GGTAAGGTCAAATCTGTGACTGG - Intronic
908928925 1:69292482-69292504 GAGAATGTCTGATTTGTGTCAGG - Intergenic
909180178 1:72413953-72413975 GAAAATTTCAATTCAGTGGCAGG + Intergenic
910030239 1:82711753-82711775 GAGAAAGTCACTTATGTGGCAGG - Intergenic
910462166 1:87459249-87459271 GAGAAGGCCAAAGGTGTGGCTGG + Intergenic
913381932 1:118221007-118221029 TAGAATGTATAATCTGTGGAAGG + Intergenic
913698080 1:121347146-121347168 GAGAATGTCAAAACTGCGGTAGG - Intronic
914139470 1:144932906-144932928 GAGAATGTCAAAACTGCGGTAGG + Intronic
915072862 1:153286791-153286813 TAGAATGTCAGCTCTGTGGAGGG - Intergenic
916108177 1:161445544-161445566 GAGAATCTCAAACCTGTCGACGG + Intergenic
916109763 1:161452924-161452946 GAGAATCTCAAACCTGTCGACGG + Intergenic
916111350 1:161460335-161460357 GAGAATCTCAAACCTGTCGACGG + Intergenic
916112936 1:161467715-161467737 GAGAATCTCAAACCTGTCGACGG + Intergenic
918150944 1:181797867-181797889 GAGAAAGACAACTCTGTGGAAGG - Intronic
920102366 1:203525390-203525412 GAGAATGGAAAATCTCAGGCTGG - Intergenic
920206340 1:204295062-204295084 GAGAATCTCAAATGTGAGGGAGG + Intronic
920485475 1:206365796-206365818 GAGAATGTCAAAACTGCGGTAGG - Intronic
923454204 1:234149028-234149050 GAAGATGTCAAATCAGTGGTTGG + Intronic
1063345287 10:5306351-5306373 GAGCAAGTCACATCTGTGGATGG + Intergenic
1065257742 10:23889928-23889950 GACAATGTCATATCTTTAGCAGG + Intronic
1068443972 10:57096102-57096124 GAGGATGTCACAGATGTGGCTGG - Intergenic
1068798349 10:61109850-61109872 AAGAATGGCAAGGCTGTGGCTGG + Intergenic
1073389983 10:103166947-103166969 TAGAACATCAAAACTGTGGCTGG - Intronic
1074882558 10:117670088-117670110 GAGATTCTCAAATTTGTGGATGG - Intergenic
1075658554 10:124177475-124177497 GAGAATGTCAGCGCTGTGGGAGG + Intergenic
1076030651 10:127155032-127155054 CGGAATGTTAAATTTGTGGCAGG + Intronic
1077274107 11:1695402-1695424 GAGAAAGCCAAAGCTGTGGGAGG - Intergenic
1081965413 11:47166311-47166333 CAGGGTGTCAAGTCTGTGGCTGG - Exonic
1082992460 11:59219776-59219798 GAGGATGTTAAATCATTGGCTGG - Intergenic
1084555036 11:69870921-69870943 GAGTTTGTAAAATCTGTGGAAGG + Intergenic
1084959306 11:72707937-72707959 GAGCATGTCACATTTGGGGCTGG - Intronic
1087450158 11:98310119-98310141 GTGAATATCAAATCTGCAGCAGG - Intergenic
1092037351 12:5348536-5348558 GTGAATGTCTGATCTGTGTCTGG - Intergenic
1093215042 12:16351952-16351974 GTGAATGCCTACTCTGTGGCTGG - Intronic
1095467569 12:42504062-42504084 CAGAATATCAACTCTGTGGATGG + Intronic
1096263031 12:50104707-50104729 GAGAATGTCAAATACCTGCCAGG + Exonic
1097680518 12:62644999-62645021 GAGAACCTCAAACCTGTGGAAGG + Exonic
1099210578 12:79783159-79783181 CAGAATTTCAAATATGAGGCTGG + Intronic
1099823285 12:87742752-87742774 GATAATGACAAATCCCTGGCTGG - Intergenic
1101214609 12:102567825-102567847 GGCATTGTCAAATCTGAGGCAGG - Intergenic
1101998831 12:109544163-109544185 GAGAATGAGAACTCTGTGTCTGG - Intergenic
1102027421 12:109721401-109721423 AAGGATGGCAAATCTGTGGCAGG + Intronic
1102517501 12:113459746-113459768 GAGAAGATTAAATCTGTGGCAGG - Intergenic
1103336061 12:120190624-120190646 GACAATGTCACAACTGGGGCGGG - Intronic
1106846450 13:33742678-33742700 GATAAAGTAAAATCAGTGGCTGG + Intergenic
1107028482 13:35826994-35827016 GAAAATGTCAAATGTATGGAAGG + Intronic
1107629168 13:42325947-42325969 GAGAATGTCAAATCTGTGGCTGG - Intergenic
1108098083 13:46925699-46925721 GAGAATGTCAAACTTCTGACAGG - Intergenic
1109861969 13:68211915-68211937 GAGAATAGCACATGTGTGGCGGG + Intergenic
1110705046 13:78595739-78595761 GATAAATTCAAATCTGTAGCAGG + Intergenic
1112291628 13:98148506-98148528 TAGAATGTCAAATTTGGCGCAGG - Intronic
1114523932 14:23356388-23356410 GCAAATGTCGAATCTATGGCAGG + Exonic
1116408865 14:44599849-44599871 TTGAATGTCAAATATGTGTCAGG - Intergenic
1117400606 14:55355480-55355502 GAGTATTTTAAATCTGAGGCTGG - Intronic
1118004568 14:61553876-61553898 GAAATGGTCAAATCCGTGGCTGG - Intronic
1120616361 14:86710214-86710236 GAAAATGTAAAATCTGTGGAAGG - Intergenic
1123180853 14:106468850-106468872 GAGAAAGGCAATTCTGTGCCAGG + Intergenic
1202946043 14_KI270726v1_random:27808-27830 GAGAAAGGCAATTCTGTGCCAGG - Intergenic
1124545147 15:30619842-30619864 TAAAATTTTAAATCTGTGGCCGG + Intergenic
1124778672 15:32609237-32609259 TAAAATTTTAAATCTGTGGCCGG + Intergenic
1128918716 15:71591527-71591549 GAGCATGTCACATGTGTGACAGG - Intronic
1129956209 15:79638892-79638914 GTGAATTTGAAATCTGTAGCTGG - Intergenic
1130198959 15:81807630-81807652 AAGGATCTCAAATCTGTGGAGGG + Intergenic
1131075995 15:89495328-89495350 GAGAATGTCTAAGGTGTGGAGGG + Intronic
1135409173 16:22220305-22220327 GAGAACGTCAGGTCTGTGGTGGG + Intronic
1136269580 16:29140763-29140785 GGGAATGTCACTTCTGAGGCCGG - Intergenic
1137860753 16:51844223-51844245 GATAATATCAAATCTTTAGCAGG - Intergenic
1142073065 16:88102032-88102054 GTGAATGTCACTTCTGAGGCCGG - Intronic
1143211176 17:5189041-5189063 AAAAATGTCAAATTTTTGGCTGG - Intronic
1143670767 17:8394177-8394199 GAGAATGACTGAGCTGTGGCAGG - Exonic
1144314285 17:14045154-14045176 TAGAAAGTCAAATCAGTGACTGG - Intergenic
1146116142 17:30140822-30140844 GAAAAAGTAAAATCTGGGGCCGG - Intronic
1146199995 17:30848653-30848675 GAGCATGACAAGTCTGAGGCAGG - Intronic
1151110250 17:71667992-71668014 GGGAATGTCATATCTTTGGGAGG - Intergenic
1155558029 18:27043333-27043355 AAGAATGTCAAATAAGTGGTAGG - Intronic
1159858949 18:73623688-73623710 GAAAAAGTCAAAATTGTGGCTGG + Intergenic
1161424737 19:4196955-4196977 GAGAATGTCAGAGCTGCGCCGGG + Intronic
1162095229 19:8306270-8306292 CAGAATGTCCAGTCTGTGGGTGG - Intronic
1165983394 19:39746115-39746137 GAGATTGGCAAAGCTGTGGATGG - Intergenic
926096143 2:10081431-10081453 TAGAATTTCAAGTCTGTGGTTGG - Intergenic
927359917 2:22221210-22221232 GAGAATGCCAAGAATGTGGCTGG + Intergenic
927436302 2:23069432-23069454 GTGAATGACAGATCTGTGGCTGG - Intergenic
928400376 2:30973561-30973583 TAAAATGCCGAATCTGTGGCTGG + Intronic
928945829 2:36770974-36770996 GAGAAAGTGAAATTTGAGGCAGG + Intronic
929063043 2:37942776-37942798 GTGAGTGTCTACTCTGTGGCAGG + Intronic
929372152 2:41238733-41238755 TAGAATGTGTAATCTGTTGCTGG + Intergenic
930969181 2:57373671-57373693 GAGAATGAGAAATATGTGTCAGG + Intergenic
936925868 2:117736279-117736301 TAGATTGTCCACTCTGTGGCAGG + Intergenic
937458099 2:122061429-122061451 GGGAATGTCAAAAATGTGACAGG - Intergenic
939686247 2:145204328-145204350 GAGAATATCACATCAGAGGCAGG - Intergenic
940332440 2:152489817-152489839 GTGGATGTGAAATCTTTGGCAGG - Intronic
945272162 2:207951923-207951945 AAGAATGAGAAAGCTGTGGCTGG + Intronic
945541587 2:211094053-211094075 ATAAATGTCAAATGTGTGGCAGG + Intergenic
946581345 2:221131193-221131215 GAGAATGTAAAAGATGTGCCTGG + Intergenic
946784661 2:223230257-223230279 GAGAATGTGAGAGCTGTGTCAGG - Intergenic
946949677 2:224859894-224859916 GAGAAATTAAAATCTTTGGCTGG + Intronic
1168949293 20:1785627-1785649 TAGAGTGTCAATTATGTGGCAGG + Intergenic
1170148207 20:13200545-13200567 GGGAATGTGATATCTGTGGTTGG + Intergenic
1171000741 20:21413513-21413535 AAGAATGTGTATTCTGTGGCTGG + Intergenic
1174412136 20:50343218-50343240 GAGAATGGCAAGGCTGTCGCCGG + Intergenic
1175016707 20:55799209-55799231 CAGATTTTCAAATCTGTGGTAGG - Intergenic
1177158294 21:17521088-17521110 GAGAAGGTGAAATGTGAGGCGGG + Intronic
1177907407 21:26988621-26988643 GAGAAGATCAAAAGTGTGGCTGG - Intergenic
1178016238 21:28348867-28348889 AAGAATCTCCAATCTGTGACTGG + Intergenic
1180154641 21:45972024-45972046 GAGAATGTCCACTCTGTCGGTGG - Intergenic
1180741824 22:18058824-18058846 GAGAATGTCTACTCTGTGGTAGG + Intergenic
1182302097 22:29342700-29342722 GAGAAGCTCACATGTGTGGCTGG + Intronic
1184017995 22:41800409-41800431 GAGGAAGTTAAATCTGTGGGTGG - Intergenic
949093795 3:61876-61898 GAGAAAGCCAAAGTTGTGGCTGG + Intergenic
949799873 3:7892055-7892077 GAGAATCTTAAAACAGTGGCAGG + Intergenic
952314889 3:32224010-32224032 GAGAACTTAAAATCTGTGGGAGG - Intergenic
955503227 3:59605607-59605629 GGGACTGTCAATTTTGTGGCAGG - Intergenic
958857952 3:99409552-99409574 GAGAATGTCAATCGTGTAGCTGG - Intergenic
959668996 3:108953737-108953759 GGGAATGGCAAATCTATAGCTGG - Exonic
962076315 3:132085788-132085810 GAGAATTTCTGATCTGTGGTTGG - Intronic
962304288 3:134272091-134272113 AATAATGTCAACTCTGTAGCAGG + Intergenic
966774308 3:183530652-183530674 GAGAACGCCAAAAATGTGGCTGG + Intronic
968984840 4:3869480-3869502 GAGAATGTGACAACTGAGGCAGG - Intergenic
970156422 4:13146009-13146031 GAGAAAGTCAAATCTGAACCTGG + Intergenic
974157097 4:58087922-58087944 AAGGATATCAAATCTTTGGCAGG + Intergenic
979449149 4:120849199-120849221 GAGAATGTCTTATCTGTGCTTGG + Intronic
979815731 4:125101348-125101370 GAGAAAGCCAAAGGTGTGGCTGG + Intergenic
980820809 4:138014141-138014163 GAGAATCTGAAATATGTGGCAGG - Intergenic
982132640 4:152244397-152244419 GAGAATGTCAAATAAATGTCAGG - Intergenic
983625447 4:169797410-169797432 CAGAATGTACAAACTGTGGCAGG - Intergenic
984149213 4:176105911-176105933 GAAATTGTCAAACCTGTAGCTGG + Intronic
984422363 4:179540526-179540548 GAGTATATCAAGTCTGTGCCTGG + Intergenic
984580954 4:181509554-181509576 AAGAAGGTCAATTCTGTGGATGG - Intergenic
984691982 4:182736832-182736854 GAGAGTTTCAAATCTGTTCCTGG - Exonic
985810204 5:2077768-2077790 GCGAAGGTCAAAGCTCTGGCTGG + Intergenic
986310369 5:6546705-6546727 TAGGTTGTCAATTCTGTGGCAGG - Intergenic
986913070 5:12581507-12581529 GAGAATGTAAAATGTGTAGATGG + Intergenic
987319823 5:16758214-16758236 GATAAAGTCAAATCTGTGTGAGG + Exonic
987897274 5:23963518-23963540 GAGAATGGCAACTCTGTAGTTGG + Intronic
988659158 5:33245997-33246019 AAGAATTTCAAATTTTTGGCAGG - Intergenic
989798216 5:45501734-45501756 AAAAATGTGAAATTTGTGGCTGG - Intronic
992101593 5:73412974-73412996 TAGAATGGGAAATATGTGGCTGG - Intergenic
999233871 5:150078973-150078995 TCGAATGTCAAATCCGTGACAGG + Intronic
1000386557 5:160679877-160679899 GAAAAATACAAATCTGTGGCTGG + Intronic
1003155061 6:3586365-3586387 GAGAATGTCAAAGGTGAGACTGG - Intergenic
1003514598 6:6807452-6807474 AAGAATGTCTAGTCTGTGTCAGG - Intergenic
1003546349 6:7062629-7062651 GAAAGTGTCAAATATGAGGCTGG - Intergenic
1004117109 6:12780160-12780182 TAAAATTTCAAATCTTTGGCAGG + Intronic
1011113236 6:83861341-83861363 GAGAATGTAAAAACTGAGTCAGG + Intronic
1012754831 6:103215173-103215195 AAGAATGGCACATCTGTGGATGG - Intergenic
1014618896 6:123640820-123640842 GACAATGTCAAATGTGTGTGAGG - Intergenic
1015086247 6:129295205-129295227 GAGAATGACAACTCTCTGCCAGG + Intronic
1016151466 6:140747151-140747173 GAGAAATTCAAGCCTGTGGCAGG + Intergenic
1016367727 6:143337411-143337433 GAGAATGCCAAGGGTGTGGCTGG - Intronic
1016684472 6:146865628-146865650 GAGAAGCTCAAAACTGTAGCTGG + Intergenic
1018249029 6:161849792-161849814 GAAAAAGACAAATCTGAGGCGGG + Intronic
1018834398 6:167472153-167472175 CATAATGTCAAATCAGTGGGAGG + Intergenic
1020684525 7:11276645-11276667 GAGACTGTCAGATTTGTGGATGG + Intergenic
1021073881 7:16276170-16276192 GAGAATGTAATAGCTGTGGATGG + Intronic
1023248769 7:38235198-38235220 TAAAATGTCAAATCTGTTCCTGG - Intergenic
1024904070 7:54356177-54356199 GATCATGGCAAAACTGTGGCTGG - Intergenic
1027217766 7:76195009-76195031 GAGAATGACAAAACCTTGGCTGG - Intergenic
1027410708 7:77914761-77914783 GAAAATGTCAAATTTCTGGTAGG - Intronic
1027783885 7:82554945-82554967 CAGAATGTAAAATTTGTGGTTGG - Intergenic
1030779990 7:113588540-113588562 GTCAAGGTCAGATCTGTGGCAGG - Intergenic
1033181400 7:139182858-139182880 GAGAGTGTCAAATCTGCAACTGG + Intronic
1034386279 7:150743785-150743807 GGGAATGTCCACTATGTGGCAGG - Exonic
1036463923 8:8978759-8978781 CAGATTGTCAAATCTGTGGGTGG + Intergenic
1037047518 8:14326608-14326630 GAAAATGTCAAAACTGATGCTGG + Intronic
1038666944 8:29545981-29546003 GATAATCTCATCTCTGTGGCAGG - Intergenic
1039863850 8:41483815-41483837 GAGAAAGGCACATTTGTGGCTGG - Intergenic
1041175023 8:55187095-55187117 GAGAATGTCAAGGCTGTGAAAGG - Intronic
1041338980 8:56822008-56822030 GAGAAAGACATATCTGTGACTGG - Intergenic
1042390231 8:68226091-68226113 GATAATGTCAACTTTATGGCTGG - Intronic
1044529918 8:93295467-93295489 GAGCACTTCAAATGTGTGGCTGG - Intergenic
1044866221 8:96573777-96573799 GAGAAGGTCAAAACTGTGTTTGG - Intronic
1045215897 8:100147977-100147999 GAGAATTGCAAATGTGGGGCAGG - Intergenic
1046977028 8:120290992-120291014 GAGAATGTGAAAGCTATGGAAGG + Intronic
1047334444 8:123922306-123922328 CAGAAGGTAACATCTGTGGCTGG + Intronic
1047717404 8:127608257-127608279 GAGGATGTCAAATCAATGGCTGG + Intergenic
1048196243 8:132334183-132334205 AAAAATGTCAAAGTTGTGGCCGG + Intronic
1049176082 8:141193507-141193529 GAGAATGTCTAACCTCTGCCTGG - Intronic
1050066279 9:1762963-1762985 GGGAATATCAAATCTCAGGCTGG + Intergenic
1052331678 9:27276536-27276558 GAAAATGTTAGATCTGTGGGTGG + Intergenic
1052728436 9:32258261-32258283 GAGAATTTCAAATATTTGTCTGG - Intergenic
1054895678 9:70308307-70308329 AAGAATTACTAATCTGTGGCCGG + Intronic
1058690737 9:107518373-107518395 GAGTGTGTCAAAACTGGGGCAGG - Intergenic
1058821229 9:108731957-108731979 AAGAATGTGTATTCTGTGGCTGG - Intergenic
1187359553 X:18612320-18612342 AAGAATGCCAAAACGGTGGCAGG + Intronic
1196917087 X:120548535-120548557 TAGATTTTAAAATCTGTGGCTGG + Intronic
1200334562 X:155335809-155335831 ATGAATGTCAACTCTGTGCCAGG + Intergenic
1200361368 X:155610914-155610936 ATGAATGTCAACTCTGTGCCAGG - Intronic
1200690146 Y:6299422-6299444 GAAAATGTAAAATCTGTGAAAGG - Intergenic
1201045127 Y:9875294-9875316 GAAAATGTAAAATCTGTGAAAGG + Intergenic