ID: 1107630135

View in Genome Browser
Species Human (GRCh38)
Location 13:42334502-42334524
Sequence CTGAATCTGAGGAGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107630135_1107630150 30 Left 1107630135 13:42334502-42334524 CCAGGTTCCCTCCTCAGATTCAG No data
Right 1107630150 13:42334555-42334577 CTGTCTTCATAGGCGCCACCTGG No data
1107630135_1107630144 6 Left 1107630135 13:42334502-42334524 CCAGGTTCCCTCCTCAGATTCAG No data
Right 1107630144 13:42334531-42334553 ACTGCTCCCCTGTGGTCATGGGG No data
1107630135_1107630142 4 Left 1107630135 13:42334502-42334524 CCAGGTTCCCTCCTCAGATTCAG No data
Right 1107630142 13:42334529-42334551 GAACTGCTCCCCTGTGGTCATGG No data
1107630135_1107630148 20 Left 1107630135 13:42334502-42334524 CCAGGTTCCCTCCTCAGATTCAG No data
Right 1107630148 13:42334545-42334567 GTCATGGGGCCTGTCTTCATAGG No data
1107630135_1107630143 5 Left 1107630135 13:42334502-42334524 CCAGGTTCCCTCCTCAGATTCAG No data
Right 1107630143 13:42334530-42334552 AACTGCTCCCCTGTGGTCATGGG No data
1107630135_1107630140 -2 Left 1107630135 13:42334502-42334524 CCAGGTTCCCTCCTCAGATTCAG No data
Right 1107630140 13:42334523-42334545 AGGCCAGAACTGCTCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107630135 Original CRISPR CTGAATCTGAGGAGGGAACC TGG (reversed) Intergenic
No off target data available for this crispr