ID: 1107631175 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:42344138-42344160 |
| Sequence | CTCCAAAACTCAATGGACCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1107631175_1107631183 | 11 | Left | 1107631175 | 13:42344138-42344160 | CCCAGGTCCATTGAGTTTTGGAG | No data | ||
| Right | 1107631183 | 13:42344172-42344194 | CACGCAGGTCCCACTATGGAAGG | No data | ||||
| 1107631175_1107631182 | 7 | Left | 1107631175 | 13:42344138-42344160 | CCCAGGTCCATTGAGTTTTGGAG | No data | ||
| Right | 1107631182 | 13:42344168-42344190 | GCATCACGCAGGTCCCACTATGG | No data | ||||
| 1107631175_1107631181 | -4 | Left | 1107631175 | 13:42344138-42344160 | CCCAGGTCCATTGAGTTTTGGAG | No data | ||
| Right | 1107631181 | 13:42344157-42344179 | GGAGGTTGGTGGCATCACGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1107631175 | Original CRISPR | CTCCAAAACTCAATGGACCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||