ID: 1107631175

View in Genome Browser
Species Human (GRCh38)
Location 13:42344138-42344160
Sequence CTCCAAAACTCAATGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107631175_1107631183 11 Left 1107631175 13:42344138-42344160 CCCAGGTCCATTGAGTTTTGGAG No data
Right 1107631183 13:42344172-42344194 CACGCAGGTCCCACTATGGAAGG No data
1107631175_1107631182 7 Left 1107631175 13:42344138-42344160 CCCAGGTCCATTGAGTTTTGGAG No data
Right 1107631182 13:42344168-42344190 GCATCACGCAGGTCCCACTATGG No data
1107631175_1107631181 -4 Left 1107631175 13:42344138-42344160 CCCAGGTCCATTGAGTTTTGGAG No data
Right 1107631181 13:42344157-42344179 GGAGGTTGGTGGCATCACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107631175 Original CRISPR CTCCAAAACTCAATGGACCT GGG (reversed) Intergenic
No off target data available for this crispr