ID: 1107631654

View in Genome Browser
Species Human (GRCh38)
Location 13:42349212-42349234
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107631654_1107631661 16 Left 1107631654 13:42349212-42349234 CCATCCCCATTTTGCTGATGAGG No data
Right 1107631661 13:42349251-42349273 AGTATTAGATGACTTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107631654 Original CRISPR CCTCATCAGCAAAATGGGGA TGG (reversed) Intergenic
No off target data available for this crispr