ID: 1107640876

View in Genome Browser
Species Human (GRCh38)
Location 13:42441907-42441929
Sequence CTGTATACACACAGCCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107640875_1107640876 -10 Left 1107640875 13:42441894-42441916 CCTTATAGAGGTACTGTATACAC No data
Right 1107640876 13:42441907-42441929 CTGTATACACACAGCCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107640876 Original CRISPR CTGTATACACACAGCCAACA AGG Intergenic
No off target data available for this crispr